ID: 1073336524

View in Genome Browser
Species Human (GRCh38)
Location 10:102714311-102714333
Sequence GCTGCCTCCCCCGTTACCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073336512_1073336524 8 Left 1073336512 10:102714280-102714302 CCGCCGAGTCCCTCCTCCTCCTC 0: 1
1: 0
2: 16
3: 207
4: 1408
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336508_1073336524 25 Left 1073336508 10:102714263-102714285 CCACACTCACCATCCTCCCGCCG 0: 1
1: 0
2: 0
3: 30
4: 270
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336510_1073336524 12 Left 1073336510 10:102714276-102714298 CCTCCCGCCGAGTCCCTCCTCCT 0: 1
1: 1
2: 3
3: 65
4: 736
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336505_1073336524 28 Left 1073336505 10:102714260-102714282 CCCCCACACTCACCATCCTCCCG 0: 1
1: 0
2: 4
3: 80
4: 484
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336509_1073336524 16 Left 1073336509 10:102714272-102714294 CCATCCTCCCGCCGAGTCCCTCC 0: 1
1: 0
2: 4
3: 35
4: 489
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336507_1073336524 26 Left 1073336507 10:102714262-102714284 CCCACACTCACCATCCTCCCGCC 0: 1
1: 0
2: 0
3: 44
4: 478
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336517_1073336524 -8 Left 1073336517 10:102714296-102714318 CCTCCTCCTCCTCCTGCTGCCTC 0: 1
1: 4
2: 229
3: 2512
4: 10356
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336513_1073336524 5 Left 1073336513 10:102714283-102714305 CCGAGTCCCTCCTCCTCCTCCTC 0: 1
1: 7
2: 138
3: 860
4: 4094
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336515_1073336524 -2 Left 1073336515 10:102714290-102714312 CCTCCTCCTCCTCCTCCTCCTGC 0: 37
1: 2424
2: 6754
3: 13394
4: 22576
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336516_1073336524 -5 Left 1073336516 10:102714293-102714315 CCTCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336511_1073336524 9 Left 1073336511 10:102714279-102714301 CCCGCCGAGTCCCTCCTCCTCCT 0: 1
1: 0
2: 3
3: 86
4: 636
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336506_1073336524 27 Left 1073336506 10:102714261-102714283 CCCCACACTCACCATCCTCCCGC 0: 1
1: 1
2: 1
3: 50
4: 543
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99
1073336514_1073336524 -1 Left 1073336514 10:102714289-102714311 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073336524 Original CRISPR GCTGCCTCCCCCGTTACCAG GGG Exonic
901172106 1:7266701-7266723 CCTGCCTCCTCCGTCACCAAGGG - Intronic
903741399 1:25560594-25560616 GCTCCCTCCCCCATGACCATTGG + Intronic
907239077 1:53070714-53070736 GCTGCGGCACCCGTTCCCAGAGG + Intronic
908089175 1:60668751-60668773 GCTGCCTCCCTCCCTCCCAGTGG + Intergenic
915410425 1:155697369-155697391 GCTGGTTCCCCCGATACCGGAGG - Intronic
919958790 1:202445113-202445135 GCTACCTCACCCATTACCATTGG + Intronic
923348044 1:233076451-233076473 GCTGCCTCTCCCGAGACAAGTGG - Intronic
1062848771 10:727450-727472 GCTGCCTGCCCAGCTCCCAGGGG - Intergenic
1064033048 10:11894941-11894963 GCTTCCTCCCTCCTTTCCAGTGG - Intergenic
1065929021 10:30462826-30462848 TCTGCCTCTGCCCTTACCAGAGG - Intergenic
1067112111 10:43408364-43408386 GCTGCGTCTCCCGATCCCAGTGG + Intronic
1069930410 10:71877922-71877944 GCTGCCTCCCCAGTCACCCCTGG + Intergenic
1070336777 10:75463059-75463081 GCTGCCTCCTCTCTCACCAGCGG - Intronic
1072656468 10:97333919-97333941 GCGGCCTCCCCCGGGCCCAGGGG + Exonic
1073048910 10:100655564-100655586 GCTGCCTTCCCAATTCCCAGTGG + Intergenic
1073336524 10:102714311-102714333 GCTGCCTCCCCCGTTACCAGGGG + Exonic
1076595454 10:131622346-131622368 GCTTCCTCCCCTGTGACCTGGGG - Intergenic
1076797619 10:132805846-132805868 CCTGCCTCCCCTGGTCCCAGGGG + Intergenic
1077179713 11:1206901-1206923 GCTGCCTCCACCATTGACAGGGG - Intergenic
1077432041 11:2520497-2520519 GCTGTCACCCCCCTCACCAGTGG - Intronic
1077509244 11:2947435-2947457 GCTGCCTCCCCCGTGCCTTGAGG + Intronic
1078869307 11:15328784-15328806 CCTGCCTCCTCAGTAACCAGGGG + Intergenic
1082785180 11:57312856-57312878 GCTGCCTCCCTGGTAGCCAGGGG + Exonic
1083655016 11:64225402-64225424 GCTGCCTCCACCGCTCCCTGAGG - Intronic
1083780554 11:64915273-64915295 CCTGCCTCCCCCGTCACCCCAGG + Intronic
1084799266 11:71531292-71531314 GCTGCCTCCAGCCTTGCCAGTGG + Intronic
1085645622 11:78220410-78220432 TCTGCATCTCCCGTTCCCAGTGG - Exonic
1094287751 12:28814501-28814523 ACTGCCTCCCACGTTTCCACTGG - Intergenic
1097515037 12:60594302-60594324 GCTGCTTCCCCCTTTTCCAGAGG - Intergenic
1101530159 12:105566519-105566541 GCTGCCTCCTCCATTTCCAGTGG + Intergenic
1101842430 12:108337815-108337837 GCTGCCTCCTCCTGCACCAGAGG + Intronic
1105773744 13:23637770-23637792 GCTGCCTTCCCTGTCATCAGTGG - Intronic
1118743343 14:68756927-68756949 GCGGCCTTCCCCTTTACCTGGGG + Intergenic
1119830130 14:77694857-77694879 CCTTCCTCCCAGGTTACCAGTGG - Exonic
1121560116 14:94868405-94868427 GCCTCATCCCCCGTTGCCAGGGG - Intergenic
1122315784 14:100825432-100825454 GCTTCCTCCACCTTAACCAGGGG - Intergenic
1122612153 14:102992475-102992497 GCTGCCTCTTCCGTAACGAGAGG - Intronic
1122901481 14:104784020-104784042 GCTGCTTCCCCCTTGCCCAGGGG - Intronic
1122939787 14:104976127-104976149 CCTGTCTCCCCAGTTATCAGGGG + Intronic
1124369937 15:29098854-29098876 GCTGCCTCCTCTGTCCCCAGAGG - Intronic
1126953707 15:53911013-53911035 ACTGCCTCCCGCGTTTCCACTGG - Intergenic
1131029885 15:89177657-89177679 GCTGACTCCCCAGTGTCCAGAGG - Intronic
1134002304 16:10792345-10792367 GCTGCCTCCCCTGGCACCTGGGG - Intronic
1135189817 16:20345612-20345634 GCCACCTCCCTCATTACCAGAGG - Intronic
1142395138 16:89828017-89828039 GCTCCCTCCCGCGTTCCCAGCGG + Intronic
1143300015 17:5902164-5902186 GCTGCCTGACCCATGACCAGGGG + Intronic
1156101129 18:33596139-33596161 GCTGCCTACCCTGTTTCTAGTGG - Intronic
1156997174 18:43482354-43482376 ACTGCCTCCCACGTTTCCACTGG - Intergenic
1157003932 18:43559630-43559652 GCTGCCTTCCTGGCTACCAGTGG + Intergenic
1160685802 19:436133-436155 GCTGCCTCCCCCGTGCCCTGGGG - Intronic
1162336684 19:10065610-10065632 GGTGCCTCTCCCGTTGCCACTGG - Intergenic
1166015216 19:39974435-39974457 GCAGGCTCCCCCTTTACCTGAGG - Exonic
1166750431 19:45161850-45161872 GCTGCCTCCCCCATCCCCATCGG - Intronic
1168294527 19:55372412-55372434 GCTGCCTCCCCCCTGGCCTGTGG - Intergenic
925882051 2:8361048-8361070 GCTGCTTCCTCCATTCCCAGCGG - Intergenic
927713593 2:25340222-25340244 GCTGCCTCCCCCGGCTCCTGAGG - Intronic
929537325 2:42792011-42792033 TCTGCCTCCCCCTTTGCCTGTGG + Intronic
929937704 2:46306291-46306313 GCTCCCTGCCCCCTAACCAGAGG - Intronic
930731183 2:54729532-54729554 GCTGCCTCCCCTGTAGCCTGGGG - Intronic
941806667 2:169717053-169717075 ACTGCCTCCCACGTTTCCACTGG + Intronic
1168757326 20:326304-326326 GCTGCCGCCACCGCTACCACCGG - Exonic
1173252942 20:41374233-41374255 CCTGCCTCCCCCATCACCAGTGG - Intergenic
1173307173 20:41861858-41861880 TCTGCTTCCCCCGTAACCTGGGG + Intergenic
1174040738 20:47697657-47697679 CCTGGCCCCCCAGTTACCAGGGG - Intronic
1174185483 20:48703254-48703276 GCTGCTTCCCCAGTCTCCAGAGG - Intronic
1179358993 21:40688141-40688163 ACTGCCTCCCTCTTTAGCAGTGG - Intronic
1179916892 21:44483521-44483543 GGTGCCTCCCTCGGCACCAGTGG + Intergenic
1180224077 21:46379211-46379233 GCTGCCTCCCCTGTCATCCGGGG + Intronic
1182066460 22:27434803-27434825 GCAGTCTCCCCGGATACCAGGGG + Intergenic
1184462280 22:44645978-44646000 GCTCCCTCCCCCAATGCCAGGGG + Intergenic
1184865060 22:47197702-47197724 GCTGCGTCCCACCTTCCCAGCGG + Intergenic
1185258893 22:49850609-49850631 TGTGCCTCCCCAGTGACCAGTGG + Intergenic
954847042 3:53568524-53568546 GCTGCCTCCCCTGTTAGCATGGG + Intronic
956682171 3:71790989-71791011 GCTGCCAACACCGTTAGCAGAGG - Intergenic
960136507 3:114111032-114111054 GCTGTCTCCCCCTTTATCACTGG - Intergenic
961210408 3:125120843-125120865 GATGCCTCCCTAGTTGCCAGGGG - Intronic
961583641 3:127903782-127903804 GCAGCTTCCCCCGTGACCACTGG - Intergenic
968976494 4:3824798-3824820 GCTGGCTCCTCCATCACCAGCGG + Intergenic
975678405 4:76850891-76850913 TCTGCCTCCCCCCATAGCAGAGG - Intergenic
979851204 4:125573230-125573252 GCTGCCTCCTCTGTTTACAGTGG - Intergenic
988297882 5:29390276-29390298 GCTGCCTCCTCTGTTTACAGTGG + Intergenic
988736452 5:34026641-34026663 GCTCCCTCCCCTGCTGCCAGGGG - Intronic
994065942 5:95542411-95542433 CCTGCCTCCCCCGCCACCAGTGG - Intronic
996324090 5:122252694-122252716 GCTTCATCCCCCCTTTCCAGGGG + Intergenic
998295635 5:140966742-140966764 GCTGCCTCCGCCGCGGCCAGTGG + Exonic
999149020 5:149414611-149414633 GCTGCCTCCTGCCTTCCCAGGGG + Intergenic
1001445190 5:171777424-171777446 TCTGCATGCCCCGTAACCAGAGG - Intergenic
1001932911 5:175685932-175685954 GCTGCCACCCCCATTCCCAGGGG + Exonic
1002067189 5:176657787-176657809 ACTGCCTCCCCAGTCACCAAGGG + Exonic
1004442905 6:15670965-15670987 GCTTCCTCCCTAGGTACCAGTGG - Intergenic
1007222434 6:40289636-40289658 GCTTTCTCCCCTGTTACCACTGG - Intergenic
1010056785 6:71575594-71575616 GCTTCCTCCCCTTTTCCCAGAGG - Intergenic
1014132130 6:117846569-117846591 GTTGCCTGCCTCGTTACCAGTGG - Intergenic
1016783674 6:147987560-147987582 GCTGCCTCCCCTGTGACCAAAGG + Intergenic
1019212518 6:170418088-170418110 GCTGCCTCTCCCTATAGCAGGGG - Intergenic
1026015713 7:66669305-66669327 GCTCCCTCCCCAGTCACCAGAGG + Intronic
1031515380 7:122692524-122692546 ACTGCCTCCCACGTTTCCACTGG + Intronic
1034303663 7:150035449-150035471 GGTGCCTCCCCCGTTGCGATGGG + Intergenic
1034449609 7:151130223-151130245 GCTGCCTCCACTGTTGGCAGAGG - Intronic
1042817192 8:72890539-72890561 ACTGCCTCACCTGTTCCCAGTGG + Intronic
1049760458 8:144329859-144329881 CCTGCCTACCTGGTTACCAGGGG + Intergenic
1053925377 9:43048912-43048934 GCTTCATCACCAGTTACCAGTGG + Intergenic
1054288136 9:63202319-63202341 GCTTCATCACCAGTTACCAGTGG - Intergenic
1054386682 9:64562638-64562660 GCTTCATCACCAGTTACCAGTGG + Intergenic
1059669447 9:116478641-116478663 CTTGCCTCCCCAGTTGCCAGGGG + Intronic
1060488141 9:124062564-124062586 GCAGCCTCACCCTTTCCCAGAGG - Intergenic
1061943454 9:133894965-133894987 CCTGCCTCCCACGTCAACAGCGG - Intronic
1062327847 9:136020833-136020855 GCTGCCTCCTCCGTTGACAAAGG - Intronic
1185461198 X:333467-333489 GCTGCCACCTCCGTTTCCTGGGG + Intergenic
1191778318 X:64842799-64842821 GCTGCCTCCTCTGTTTACAGTGG + Intergenic
1192531786 X:71894076-71894098 GCTGCATACCAGGTTACCAGAGG + Intergenic