ID: 1073336530

View in Genome Browser
Species Human (GRCh38)
Location 10:102714323-102714345
Sequence GTTACCAGGGGCAACTGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 168}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073336516_1073336530 7 Left 1073336516 10:102714293-102714315 CCTCCTCCTCCTCCTCCTGCTGC 0: 9
1: 108
2: 3211
3: 8811
4: 17727
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336515_1073336530 10 Left 1073336515 10:102714290-102714312 CCTCCTCCTCCTCCTCCTCCTGC 0: 37
1: 2424
2: 6754
3: 13394
4: 22576
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336519_1073336530 -2 Left 1073336519 10:102714302-102714324 CCTCCTCCTGCTGCCTCCCCCGT 0: 1
1: 0
2: 10
3: 96
4: 1154
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336509_1073336530 28 Left 1073336509 10:102714272-102714294 CCATCCTCCCGCCGAGTCCCTCC 0: 1
1: 0
2: 4
3: 35
4: 489
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336514_1073336530 11 Left 1073336514 10:102714289-102714311 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336520_1073336530 -5 Left 1073336520 10:102714305-102714327 CCTCCTGCTGCCTCCCCCGTTAC 0: 1
1: 0
2: 0
3: 25
4: 295
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336517_1073336530 4 Left 1073336517 10:102714296-102714318 CCTCCTCCTCCTCCTGCTGCCTC 0: 1
1: 4
2: 229
3: 2512
4: 10356
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336518_1073336530 1 Left 1073336518 10:102714299-102714321 CCTCCTCCTCCTGCTGCCTCCCC 0: 1
1: 2
2: 43
3: 732
4: 4824
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336512_1073336530 20 Left 1073336512 10:102714280-102714302 CCGCCGAGTCCCTCCTCCTCCTC 0: 1
1: 0
2: 16
3: 207
4: 1408
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336511_1073336530 21 Left 1073336511 10:102714279-102714301 CCCGCCGAGTCCCTCCTCCTCCT 0: 1
1: 0
2: 3
3: 86
4: 636
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336513_1073336530 17 Left 1073336513 10:102714283-102714305 CCGAGTCCCTCCTCCTCCTCCTC 0: 1
1: 7
2: 138
3: 860
4: 4094
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336510_1073336530 24 Left 1073336510 10:102714276-102714298 CCTCCCGCCGAGTCCCTCCTCCT 0: 1
1: 1
2: 3
3: 65
4: 736
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168
1073336521_1073336530 -8 Left 1073336521 10:102714308-102714330 CCTGCTGCCTCCCCCGTTACCAG 0: 1
1: 0
2: 0
3: 34
4: 205
Right 1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG 0: 1
1: 0
2: 0
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073336530 Original CRISPR GTTACCAGGGGCAACTGCTG CGG Exonic
901117925 1:6863707-6863729 GTTAGCAGGGGAAACAGGTGTGG - Intronic
902273556 1:15323860-15323882 CTTACCAAGGGAAACTGCTCTGG - Intronic
902466331 1:16620774-16620796 GTTGCTAGGGACAACTGCTGAGG - Intergenic
902508350 1:16952529-16952551 GTTGCTAGGGGCAAGTGCTGAGG + Intronic
903568406 1:24286006-24286028 GTTAGAAGGGGCATGTGCTGTGG + Intergenic
905385264 1:37598916-37598938 GTTACCAGGAGCAACATTTGAGG - Intergenic
906125898 1:43426715-43426737 GTGCCGAGGGGCCACTGCTGGGG + Exonic
907166056 1:52412415-52412437 GTTCCAAGGAGCAACAGCTGAGG - Intronic
907338807 1:53718971-53718993 GTTACCCTGGGCCACTTCTGTGG + Intronic
909381386 1:75002839-75002861 GTGAGGAGGGGGAACTGCTGAGG + Intergenic
910691870 1:89973711-89973733 GTTGACAGGGGCCACTGCTTTGG + Intergenic
912227588 1:107752856-107752878 GTTAAGTGGGGCAGCTGCTGTGG + Intronic
912340680 1:108911843-108911865 GTCACCAGGCGGAACTGCAGTGG + Intronic
913099987 1:115554683-115554705 GTTATTAGTGGAAACTGCTGAGG - Intergenic
913228303 1:116720052-116720074 GTTACCAGAAGCCAGTGCTGAGG - Intergenic
913613356 1:120530370-120530392 GTTTCCAGGTGCAGCTGCAGGGG - Intergenic
914371710 1:147031126-147031148 GTTTCCAGGTGCACCTGCAGGGG - Intergenic
914577830 1:148991877-148991899 GTTTCCAGGTGCAGCTGCAGGGG + Exonic
916657310 1:166887587-166887609 GTTACCAGAGGAGACTGCTTTGG - Intergenic
918340840 1:183566915-183566937 ATTACCTGGGGCTGCTGCTGAGG + Exonic
919814430 1:201428661-201428683 GTCCCCAGGGGCAGCTGATGGGG + Intronic
919856483 1:201709652-201709674 GCCACCAGGGGCCACTGCTGGGG + Intronic
922401296 1:225259721-225259743 GTTGCCAGGGGCAACAGGTAAGG - Intronic
922420845 1:225460376-225460398 GGTACCAGAGGCAGCTGCCGAGG - Intergenic
922558514 1:226550226-226550248 CTTAGCAGGGGCCTCTGCTGCGG + Intronic
923502849 1:234580613-234580635 GTTACCAGGGTCTTCTGCTATGG + Intergenic
924651816 1:245935863-245935885 GTTACCAGAGGCATGGGCTGGGG + Intronic
1065785910 10:29214582-29214604 TTTCCCAGGGGCAGCTGCTTTGG + Intergenic
1068898556 10:62236952-62236974 GTTACCATGGGCAAGGACTGGGG + Intronic
1069616646 10:69810793-69810815 GTCAGCAGGGGCTGCTGCTGGGG - Intronic
1069623004 10:69849361-69849383 GTGATCAGGGGGCACTGCTGCGG - Intronic
1069706118 10:70459903-70459925 GGCACCACGGACAACTGCTGTGG - Intergenic
1073336530 10:102714323-102714345 GTTACCAGGGGCAACTGCTGCGG + Exonic
1074160625 10:110833809-110833831 TTTACCTGGTGCACCTGCTGGGG + Intronic
1075388572 10:122075666-122075688 GTTAACAGAGGCAGCAGCTGTGG - Intronic
1075579826 10:123608958-123608980 GTTGCCAGGGGCAATGGGTGAGG - Intergenic
1076365604 10:129919583-129919605 CTTACCAAGGGCAACGCCTGGGG - Intronic
1076922711 10:133463454-133463476 GTTACCAGGGGCAGGTGGTGGGG - Intergenic
1077262868 11:1632358-1632380 GTCTCCAGGGGCCCCTGCTGTGG - Intergenic
1077488728 11:2850814-2850836 GGTGCCAGGAGCATCTGCTGGGG + Intergenic
1078268714 11:9774855-9774877 GTTACCAAGGACCAATGCTGTGG + Intergenic
1080699680 11:34634001-34634023 GTTCCCAGGGGCAACATCTGAGG - Intronic
1089008175 11:115110444-115110466 GGTACCAAGGGCAGGTGCTGAGG + Intergenic
1090777048 11:129975001-129975023 GTTACCAGGGGCCAGGGCAGGGG + Intronic
1094417115 12:30228773-30228795 GTTACCAGAGGCTACTGGAGGGG - Intergenic
1094553209 12:31472051-31472073 GTTACCCAGGGCAAATGCTGCGG + Intronic
1095295985 12:40528078-40528100 GCTTCCAGGGGCAACTGTTGTGG - Intronic
1095723452 12:45426646-45426668 GTTTCCAGGGGCAAGTGATGAGG - Intronic
1099750131 12:86762605-86762627 TTAACCAGGGGAAAATGCTGAGG - Intronic
1100028631 12:90159948-90159970 CTTGCCAGGGACAAGTGCTGTGG - Intergenic
1107798911 13:44084849-44084871 GTTAATAGGGGAAACTGTTGGGG - Intergenic
1109467757 13:62760751-62760773 GGTACCAGGGGCTAGTGTTGGGG + Intergenic
1113841942 13:113365418-113365440 GTTACCAAAGGCCAGTGCTGAGG - Intergenic
1114939856 14:27595185-27595207 GTTACCAGGGGCAGAGGATGAGG + Intergenic
1117759868 14:59015456-59015478 GCTAGCAGGGGCAGTTGCTGTGG + Intergenic
1118162908 14:63309040-63309062 GATGCCAGGGGAAGCTGCTGTGG - Intergenic
1119262690 14:73246938-73246960 GTTGCCACGGGCATGTGCTGGGG - Intronic
1121044076 14:90775197-90775219 GTTACCTGGGGCATCTGAAGAGG + Intronic
1121078522 14:91089067-91089089 TTTAGAAGGGGCAACTGGTGCGG - Intronic
1122451613 14:101813109-101813131 GTGACCAGGGGCTGCTGCAGAGG - Intronic
1122994187 14:105253695-105253717 GTGACCAGGAGGAGCTGCTGTGG - Intronic
1124648577 15:31458002-31458024 GATTCCAGGTGCAACTGCGGAGG + Intergenic
1125194364 15:37029874-37029896 ATTACCATGGCCAAGTGCTGTGG + Intronic
1125814006 15:42568173-42568195 GTTCCCAGATGCAACAGCTGAGG - Exonic
1127837659 15:62803779-62803801 GTTACCAGGGACTAATCCTGGGG - Intronic
1129623301 15:77169622-77169644 GTTACCAGGGGCAAGAGATTAGG + Intronic
1130751796 15:86720300-86720322 GTTACCAGGCTCAAATCCTGGGG + Intronic
1130910331 15:88266318-88266340 GTCCCCAGGGGCATGTGCTGAGG + Intergenic
1130917715 15:88318949-88318971 GTGTCCGGGGGCAAGTGCTGGGG - Intergenic
1131241953 15:90752865-90752887 TTTACCAGGTGAAACAGCTGAGG + Intronic
1131282217 15:91031278-91031300 GTTCTCTGGGGCAGCTGCTGAGG + Intergenic
1132831278 16:1929647-1929669 GGTGCCAGGGGCAGCTGCAGGGG - Intergenic
1133089248 16:3390603-3390625 GTTGCCAGGGGCTGCTGATGCGG - Intronic
1139709280 16:68763492-68763514 CTTGGCAGAGGCAACTGCTGAGG + Intronic
1139938485 16:70588112-70588134 GTTAACTGGTGCAGCTGCTGTGG + Intronic
1139967593 16:70754383-70754405 GGTACCAGCAGCCACTGCTGGGG - Intronic
1143589881 17:7876823-7876845 CTTCCCAGTGGCAACTACTGTGG + Intronic
1143970307 17:10790546-10790568 GTTACCAGTGTCAAATGCTAAGG + Intergenic
1146016577 17:29238594-29238616 GTTAGGCTGGGCAACTGCTGAGG + Intergenic
1146571967 17:33960792-33960814 GTTAGAAGGTGGAACTGCTGTGG - Intronic
1148339784 17:46866590-46866612 GTTATCAGGAGCATCTGATGGGG + Intronic
1151264908 17:72947331-72947353 TTTACCTGGGGAGACTGCTGTGG - Intronic
1152901069 17:82941466-82941488 GTTACCTGGGGCACCAGCTGGGG - Exonic
1153158839 18:2179995-2180017 GTGAGCAGGTGCAAGTGCTGGGG - Intergenic
1153228344 18:2914343-2914365 GTTAGCCTGGGCAGCTGCTGTGG - Exonic
1153301251 18:3594110-3594132 ATTTGCAGGGGCAGCTGCTGTGG - Intronic
1153710106 18:7790069-7790091 GTCACCTGGGGCAACAGCAGAGG - Intronic
1155478888 18:26263827-26263849 GCTACTTGGGACAACTGCTGAGG - Intronic
1156898341 18:42272236-42272258 GTTCCCAGTGGGAAATGCTGAGG + Intergenic
1157224777 18:45852918-45852940 CTTACCAAGAGCCACTGCTGTGG + Intronic
1157835049 18:50893511-50893533 GTTACCAAGGCTAACTACTGGGG - Intronic
1159945500 18:74441730-74441752 GCGACCAGGGGCATCTGATGAGG - Intronic
1160578780 18:79871925-79871947 GTCACCAGGGCCAGCTGCTCTGG + Intronic
1162537146 19:11269617-11269639 GTTAATAGGGGAAACTGCTCTGG - Intergenic
1163216531 19:15882300-15882322 GTTACCAGAGGCCAGGGCTGAGG + Intronic
1163769698 19:19183476-19183498 GGTATCTGGGGCAACTTCTGTGG + Intronic
1164440758 19:28277456-28277478 ATTTCCAGAGCCAACTGCTGAGG - Intergenic
1167199046 19:48051235-48051257 GTTAGCAGGGCCAACTCCTGCGG - Intronic
1167856767 19:52248295-52248317 CTTACCAGGGACAGCTGCTTTGG - Intergenic
1168365248 19:55781131-55781153 GTTACCAGGGGCCGGGGCTGGGG + Intergenic
930645190 2:53899102-53899124 GTTACCAGGCTGAACTGCAGGGG + Intronic
932902988 2:75721250-75721272 GTTTCCAGGGGCCAGCGCTGTGG - Intergenic
936596690 2:113854854-113854876 GTTACCTGGGCCCTCTGCTGTGG - Intergenic
938704107 2:133905540-133905562 GTTACCAGAGGCTAATGGTGGGG - Intergenic
939152911 2:138494372-138494394 GTAACCTGGGGTAATTGCTGGGG + Intergenic
940321633 2:152383696-152383718 GTTTCCAGGGTTAGCTGCTGTGG - Intronic
940514188 2:154659308-154659330 GTTGCCAGGAGCAAATGCAGTGG - Intergenic
940813178 2:158268742-158268764 GTTACCAGGGGCAAGGGCATGGG - Intronic
941374619 2:164711828-164711850 CTTACTAGGGGAAACTGCTTTGG + Intronic
941419778 2:165268971-165268993 GTTACCAGGGGCTACTGGGTAGG + Intronic
946120069 2:217503243-217503265 GTTACCAGGGGCTGGGGCTGAGG - Intronic
946135183 2:217640246-217640268 GTTACCAGGGGCCGGTGGTGAGG + Intronic
947538187 2:230954166-230954188 GATGCCAGGGGCAGCTGTTGTGG - Intronic
948271617 2:236678294-236678316 CTTATCAGGGCCAACTGCGGTGG - Intergenic
1170598398 20:17822579-17822601 GTTTCCAGTGGCAGCTCCTGGGG + Intergenic
1171214350 20:23341577-23341599 GATCCCAGGGGCACCTGTTGGGG + Intergenic
1173250298 20:41360933-41360955 GCTGGCAGGGGCAGCTGCTGTGG - Exonic
1173621631 20:44441359-44441381 GCTGCCAGGGGCAAGGGCTGGGG + Intergenic
1174452518 20:50628925-50628947 CTTCCCAGGGGCATTTGCTGCGG - Intronic
1175583793 20:60121414-60121436 GCTCCCAGGGGCTACTGGTGGGG + Intergenic
1179526978 21:41985510-41985532 CTTAGGAGGGGCAACTGCCGTGG + Intergenic
1181751838 22:24994369-24994391 GTTACCTTGGGGAACAGCTGGGG + Intronic
1182058854 22:27382380-27382402 GTAGCCAGGAGCACCTGCTGTGG + Intergenic
1183035604 22:35138867-35138889 CTTACAAGGGCCAATTGCTGTGG - Intergenic
1183211118 22:36451996-36452018 GTGAACATGGGCAGCTGCTGGGG - Intergenic
1183781685 22:40003003-40003025 ATTCCCAAGGGCAACTGCCGTGG - Intronic
1184654404 22:45933906-45933928 GGTGCCAGGGCCAGCTGCTGGGG + Intronic
949603319 3:5625712-5625734 GTTACCAGGGGCTACAGGGGAGG - Intergenic
950949720 3:16985816-16985838 GTTTCCAGTGGCAGCTGCTGAGG + Intronic
951257278 3:20464613-20464635 GATAACAGGGGGAACTGATGGGG - Intergenic
951800742 3:26593237-26593259 GTTACCAGGGGCAGGAGGTGGGG - Intergenic
956492015 3:69782838-69782860 GTTACAAATGGCAAATGCTGAGG + Intronic
958729938 3:97950781-97950803 CTTACCAGGAGCAGCTGCCGGGG + Exonic
959740887 3:109718281-109718303 GTTACCAGGGGCTGATGATGGGG + Intergenic
960385554 3:117018161-117018183 GGTGCCAGGGGCAACTTCTCAGG - Intronic
962311928 3:134332752-134332774 GTGAGCAGGGGCAACCTCTGTGG - Intergenic
963633039 3:147758016-147758038 TCTTCCATGGGCAACTGCTGAGG + Intergenic
969551990 4:7875907-7875929 GTTACTAGGGGCTAGTGGTGGGG + Intronic
970770507 4:19606603-19606625 GTTACCAGGAGCAACTGAATAGG - Intergenic
974660468 4:64881612-64881634 GTGGCCAGGGGCAAATGCTATGG + Intergenic
980002242 4:127503355-127503377 CTTAGCAGGGGATACTGCTGTGG + Intergenic
984491347 4:180438496-180438518 GTTCCCAGGTGACACTGCTGGGG - Intergenic
984961210 4:185100277-185100299 CTGACCAGGGGCAGTTGCTGTGG + Intergenic
985520888 5:373566-373588 CTCACCATGGGCAACTGCGGTGG + Intronic
985779050 5:1860293-1860315 CTCACCAGGGGCAGCTTCTGCGG + Intergenic
986203456 5:5600352-5600374 GACACCAGAGACAACTGCTGAGG - Intergenic
987646152 5:20675272-20675294 GTTGGCTGGGGCAACTGATGAGG - Intergenic
990917569 5:60927126-60927148 TTTAACAGGTGCAACTGCAGAGG - Intronic
1003733602 6:8853217-8853239 GTTAGCAGGGTGAACTGCTGTGG - Intergenic
1006332629 6:33403350-33403372 GTTACCTGTGGCAATAGCTGTGG - Exonic
1006969334 6:38024787-38024809 GTTACCAGGGGCAATAGGAGAGG + Intronic
1008898178 6:56581421-56581443 GTTAACAGTGTCAACTGCTTCGG + Intronic
1009567284 6:65325065-65325087 GTTACCAGGGCCAGCTGCCTGGG - Intronic
1011335496 6:86255184-86255206 GTGGCCAGGGGCAACTTCTGTGG - Intergenic
1013989694 6:116239362-116239384 GTTACCAGGACAAGCTGCTGAGG + Intronic
1015359722 6:132325304-132325326 GTCACCTGGGGCAAATGCTATGG + Intronic
1015772394 6:136782662-136782684 GTTACCCTGTGCAACTTCTGTGG + Intronic
1018733445 6:166669946-166669968 GTTGCCAGGGGCAACCACTGTGG + Intronic
1018908458 6:168088527-168088549 GTTAACAGCGGCAGCAGCTGAGG - Intergenic
1022497142 7:30860279-30860301 GTTTCCAGGGGCCTCTGCTGTGG + Intronic
1023590455 7:41775716-41775738 GTTGCCAGGGGCTAGTGGTGAGG - Intergenic
1029096356 7:98087891-98087913 GTTACCAGGGGGAATGGATGGGG + Intergenic
1029202867 7:98850795-98850817 TTTAGCAGTGGCAACTGCTGGGG + Intronic
1029232155 7:99079182-99079204 GATTCCAGGCGCAGCTGCTGTGG - Intronic
1029815915 7:103094840-103094862 GTTACCAGTGGACACTGCTGAGG + Intronic
1033772265 7:144565584-144565606 GCTACTACGGGCCACTGCTGGGG - Intronic
1035071078 7:156145445-156145467 GTTACCAGGGGCTGTGGCTGTGG + Intergenic
1035423675 7:158751916-158751938 GTTACTAGGGGTTACTCCTGTGG - Intronic
1037088768 8:14886565-14886587 CTTCCCAGGGGCAAGTCCTGGGG + Intronic
1038811327 8:30848709-30848731 ATCACCAGGGACAACTTCTGAGG + Exonic
1040662413 8:49590022-49590044 GTTACCAGGGGAAAATGGAGGGG + Intergenic
1043134768 8:76507413-76507435 GGTACCAGAGGCAAATTCTGAGG - Intergenic
1045416768 8:101975436-101975458 GCTCCCAGGTGCTACTGCTGGGG + Intronic
1045885635 8:107094638-107094660 TTTACCAGTTGCTACTGCTGTGG + Intergenic
1046582888 8:116114720-116114742 ATAACTAGAGGCAACTGCTGAGG - Intergenic
1051366596 9:16325658-16325680 GTGCCGAGGGGCATCTGCTGAGG - Intergenic
1056735224 9:89203760-89203782 GTTACCAGGGGCAAGTGGGCAGG + Intergenic
1056857409 9:90144517-90144539 GTTACCAGGGGCAATGGGTGGGG - Intergenic
1057117702 9:92541353-92541375 GTTACCAGAGGCTAGTGATGGGG - Intronic
1057139432 9:92717728-92717750 GGTTCCAGAGGCAAGTGCTGAGG + Intronic
1058242777 9:102587137-102587159 GTTACCAGGGGCAGGGGATGGGG - Intergenic
1058329716 9:103744286-103744308 GTTAGCAGAGGCAACTTCAGGGG - Intergenic
1059934817 9:119299242-119299264 GTTACCAGGGTCTACGGTTGAGG - Intronic
1060400314 9:123344741-123344763 TTTAACAGGGGCTGCTGCTGGGG + Intergenic
1062352556 9:136146232-136146254 GTGACCAGGGGTGGCTGCTGGGG - Intergenic
1186203708 X:7179748-7179770 GTTACCAGGGGCAGAGGGTGCGG + Intergenic
1187392699 X:18896395-18896417 GTTCCCAGGGACAACAGCTGGGG + Intronic
1190445359 X:50518619-50518641 GTTACTATGGGCAAGTGTTGGGG - Intergenic