ID: 1073336556

View in Genome Browser
Species Human (GRCh38)
Location 10:102714450-102714472
Sequence TAGCCCGCCCACTGCGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073336556_1073336567 18 Left 1073336556 10:102714450-102714472 CCGCCCACGCAGTGGGCGGGCTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1073336567 10:102714491-102714513 CCGCCGGCTCGCCTGGACCAGGG 0: 1
1: 0
2: 0
3: 5
4: 63
1073336556_1073336569 23 Left 1073336556 10:102714450-102714472 CCGCCCACGCAGTGGGCGGGCTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1073336569 10:102714496-102714518 GGCTCGCCTGGACCAGGGAGTGG 0: 1
1: 0
2: 2
3: 25
4: 293
1073336556_1073336565 17 Left 1073336556 10:102714450-102714472 CCGCCCACGCAGTGGGCGGGCTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1073336565 10:102714490-102714512 GCCGCCGGCTCGCCTGGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 146
1073336556_1073336562 2 Left 1073336556 10:102714450-102714472 CCGCCCACGCAGTGGGCGGGCTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336556_1073336561 -8 Left 1073336556 10:102714450-102714472 CCGCCCACGCAGTGGGCGGGCTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1073336561 10:102714465-102714487 GCGGGCTACGGGAGCTGCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 152
1073336556_1073336563 11 Left 1073336556 10:102714450-102714472 CCGCCCACGCAGTGGGCGGGCTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1073336563 10:102714484-102714506 GAGGCCGCCGCCGGCTCGCCTGG 0: 1
1: 0
2: 0
3: 32
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073336556 Original CRISPR TAGCCCGCCCACTGCGTGGG CGG (reversed) Intergenic