ID: 1073336562

View in Genome Browser
Species Human (GRCh38)
Location 10:102714475-102714497
Sequence GGAGCTGCAGAGGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 451}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073336557_1073336562 -1 Left 1073336557 10:102714453-102714475 CCCACGCAGTGGGCGGGCTACGG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336556_1073336562 2 Left 1073336556 10:102714450-102714472 CCGCCCACGCAGTGGGCGGGCTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336548_1073336562 30 Left 1073336548 10:102714422-102714444 CCCAGAGTGCGCAAGTGCGCTAA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336549_1073336562 29 Left 1073336549 10:102714423-102714445 CCAGAGTGCGCAAGTGCGCTAAG 0: 1
1: 0
2: 1
3: 0
4: 16
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336555_1073336562 3 Left 1073336555 10:102714449-102714471 CCCGCCCACGCAGTGGGCGGGCT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336559_1073336562 -2 Left 1073336559 10:102714454-102714476 CCACGCAGTGGGCGGGCTACGGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073336562 Original CRISPR GGAGCTGCAGAGGCCGCCGC CGG Intergenic
900611212 1:3545363-3545385 GGGACTGCACAGGCAGCCGCAGG + Intronic
900831230 1:4967156-4967178 GGAGCAGCAGAGGCCGGGGTGGG - Intergenic
901057501 1:6455471-6455493 GCAGCTGCTGAGGCAGCGGCAGG + Intronic
901646035 1:10717264-10717286 GGAGCTGCAGAGGCTGGGGGTGG - Intronic
902410043 1:16207088-16207110 GGAGGGGCCGGGGCCGCCGCGGG - Exonic
902450082 1:16491277-16491299 GGAGTTGCAGAGGCAGCTACAGG - Intergenic
902472257 1:16657136-16657158 GGAGTTGCGGAGGCAGCTGCAGG - Intergenic
902476859 1:16693007-16693029 GCAGCTGCTGAGGCAGCGGCAGG - Intergenic
902486546 1:16750310-16750332 GGAGTTGCGGAGGCAGCTGCAGG + Intronic
902504383 1:16929920-16929942 GGAGTTGCGGAGGCAGCTGCAGG + Exonic
902824892 1:18966142-18966164 GTAACTGCAGAGGCCTCCGCCGG + Intergenic
903193529 1:21669298-21669320 AGAGCTGCAGCGGCGGCCGCGGG - Intronic
903319837 1:22536132-22536154 GGAGCAGCAGAGGCCTCACCTGG + Intergenic
903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG + Exonic
906027003 1:42682520-42682542 GGAGCCGCAGCTGCCGCAGCCGG + Exonic
907430044 1:54406331-54406353 GGAGGCGCAGAGGGCGGCGCAGG - Exonic
912685033 1:111755663-111755685 TGGCCTGCAGAGGGCGCCGCGGG - Exonic
912910931 1:113758953-113758975 GGAGGGGCAGGGGCCGCCGCTGG + Intronic
916212008 1:162367137-162367159 GGACCTGCATTCGCCGCCGCTGG + Exonic
916920399 1:169460464-169460486 GGGGCTGCAGCGCCCGCCGCCGG + Exonic
917641373 1:176986038-176986060 GCAGCTTCAGAGGCGGGCGCAGG - Intronic
920441760 1:205985498-205985520 GGACCTGCTGAGACCGCCCCTGG - Intronic
921466772 1:215497676-215497698 GCAGCAGCAGAGGCAGCAGCAGG + Intergenic
922473169 1:225888955-225888977 TGAGCTGCAGCTGCCGCAGCAGG + Exonic
922481202 1:225941029-225941051 TGAGCTGCAGCTGCCGCAGCAGG + Exonic
922734835 1:227973372-227973394 GGGCCTGCAGAGGCCGCCATGGG + Intergenic
923040757 1:230318478-230318500 CAAGCTGCAGAGGCCACCGGTGG + Intergenic
924527160 1:244863331-244863353 GGAGCTGCAGCTGCCGCTGTAGG - Intronic
924943174 1:248826253-248826275 GGAGCTGCGGCGGCGGCTGCCGG + Exonic
924949287 1:248867581-248867603 GGAGCTGCAGAGGCAGGCCTAGG - Intergenic
1062774931 10:136212-136234 GAAGCTGCTGAGGACGCGGCTGG + Intronic
1063214830 10:3914825-3914847 GGAGCTGCAGATGCACCTGCTGG + Intergenic
1063794322 10:9493891-9493913 GGACCTGCAGAAGCAGCGGCTGG + Intergenic
1064209018 10:13347915-13347937 GGATTTGCAACGGCCGCCGCGGG + Intronic
1065188880 10:23193007-23193029 GGAGCTGCAGCAGCTGCGGCAGG + Exonic
1065763169 10:29002152-29002174 AGAGCTGCAGAGTCCGCACCTGG - Intergenic
1067015669 10:42755070-42755092 CGGGAAGCAGAGGCCGCCGCCGG - Intergenic
1067662759 10:48248941-48248963 GGAGCTGGGGAGGCTGCCGCTGG + Intronic
1067840101 10:49668900-49668922 GGAGCTTCAGAGGCCTCAGGAGG - Intergenic
1068589160 10:58836276-58836298 GGAGCTGCAGTAGCAGCCACAGG - Intergenic
1068763089 10:60733668-60733690 GGAGCAGCAGAGGCAGCTCCAGG + Intergenic
1069761757 10:70816123-70816145 GGAGGTGGAGGGGCCGCCGCGGG + Exonic
1069846703 10:71377201-71377223 GGAGGTGCCCAGGCCGCCGGCGG + Intergenic
1070103920 10:73414137-73414159 GGAGCCGGAGAGGGCGCTGCGGG + Intergenic
1070162438 10:73874298-73874320 GGAGCCGCAGCGGCCGGTGCAGG + Intronic
1070809857 10:79292234-79292256 GCTGCTGCAGCGGCTGCCGCGGG - Exonic
1071597585 10:86939514-86939536 GGAATTGCAGAGGCAGCCGCCGG - Intronic
1071919415 10:90332417-90332439 ACAGCTGCAGAGGCTGCAGCAGG + Intergenic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1073541027 10:104316195-104316217 GAAGCTCCTGAGGCAGCCGCAGG - Intronic
1073571256 10:104582828-104582850 GGAGTTGCTGAGGCAGCTGCAGG + Intergenic
1074772263 10:116742050-116742072 TGGGCTGCGGAGGCCGGCGCTGG - Intronic
1074861082 10:117511137-117511159 GGAGCAGCAGAGGCCAGCTCAGG + Intergenic
1074865510 10:117542435-117542457 GAAGCCGCAGCGGGCGCCGCAGG + Exonic
1074881701 10:117664796-117664818 AGAGGTGCAGAGGCCGGCACAGG - Intergenic
1075239513 10:120765154-120765176 GGAGATGAAGAGGCAGCCACAGG + Intergenic
1075855693 10:125627803-125627825 GGAGCTGCAGACGCCAGCACAGG + Intronic
1076238982 10:128888030-128888052 TGGGCTGCAGAGGCCACTGCTGG + Intergenic
1076450587 10:130554601-130554623 GGAGCTGCAGGGGTCCCCCCAGG + Intergenic
1076554221 10:131311593-131311615 GCAGCTGCCGCCGCCGCCGCTGG + Exonic
1076662630 10:132065563-132065585 CGAGCGGCAGAGGCCACGGCTGG - Intergenic
1076726176 10:132414469-132414491 GGATCCGCAGAGGCCACAGCTGG - Intronic
1076785867 10:132749651-132749673 GAAGCTGCAGAGTCCTGCGCAGG - Intronic
1076864396 10:133160008-133160030 GCCGCTGCAGAGGCCACCCCGGG + Intergenic
1076996739 11:300726-300748 GGAGCTCCAGAGGCTGTCACAGG - Intergenic
1077012323 11:384827-384849 GGAGCAGCAGTGGCGGCAGCAGG + Intergenic
1077072461 11:682085-682107 GCAGCAGCCGAGGCCGCCCCAGG - Intronic
1077117453 11:891570-891592 GGAGCTGCAGAAGCAGCCATCGG - Intronic
1077186113 11:1236136-1236158 GGAGCAGCAGAGGCTGCAGTAGG - Intronic
1077213337 11:1383433-1383455 GCAGCAGCGGAGGCCGCGGCCGG + Intergenic
1077443896 11:2581366-2581388 GGAGTTGCAGAGGCAGACACAGG - Intronic
1077542161 11:3151839-3151861 GGGGCTGCAAAGCCCGCCCCAGG - Intronic
1078451869 11:11446537-11446559 GGAGCTGCAGAGACCACTCCTGG - Intronic
1081661576 11:44891757-44891779 GGAACTTCAGAGGCTGCTGCTGG + Intronic
1081832081 11:46122098-46122120 GGAGTTGGGGGGGCCGCCGCGGG - Intergenic
1082816870 11:57514962-57514984 GAGGCTGCAGCGGCCGCGGCGGG - Intronic
1083763534 11:64831601-64831623 TGAGCTGCAGCGGCTGCTGCTGG - Exonic
1083940124 11:65891232-65891254 GGCGCCGCTGGGGCCGCCGCGGG - Exonic
1084317042 11:68351600-68351622 GGAGCTGCAGCGACCCACGCTGG - Intronic
1084363741 11:68684823-68684845 GGAGGAGCAGAGGCGGCGGCCGG - Intronic
1084553978 11:69864993-69865015 GGGACTGCAGAGGCAGCCGCTGG + Intergenic
1084933574 11:72575297-72575319 GGAGCTGCAGAGGAAGCAGATGG + Intergenic
1085597140 11:77820546-77820568 GGTGCTGCAGGCGCCGCCGCCGG - Exonic
1088693017 11:112343987-112344009 GGACCTTCAGAGGCTGCAGCAGG - Intergenic
1089611346 11:119671246-119671268 AGAGCTGCAAGGGCCGCAGCTGG + Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089829681 11:121315913-121315935 GGAGCTGCAGCTGCTGCCTCAGG - Intergenic
1090076823 11:123584886-123584908 GCAGCTGCACAGGGCGCCCCAGG - Intronic
1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG + Exonic
1096466186 12:51848683-51848705 GCGGCTGCTGCGGCCGCCGCGGG + Intergenic
1097057428 12:56258302-56258324 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1097233872 12:57527063-57527085 GGATCTGCAGAGGGAGCCGGGGG + Exonic
1097848635 12:64390484-64390506 CGGGCGGCAGATGCCGCCGCAGG + Exonic
1098255489 12:68611257-68611279 GGAGCAGCCGCCGCCGCCGCGGG + Intronic
1098426059 12:70366535-70366557 GGCGCTGCCGCCGCCGCCGCCGG + Exonic
1101272477 12:103162264-103162286 GGTGGTGGAGAGGCCCCCGCAGG - Intronic
1102023914 12:109702409-109702431 GGAACTGCAGAGGCAGGCTCAGG + Intergenic
1102472200 12:113165676-113165698 GGAGCTGCAGCGGCTGAGGCTGG - Exonic
1103239104 12:119398253-119398275 GGAGCTGCAGAGGTTGCGCCGGG - Intronic
1103433025 12:120904103-120904125 GGAGCCGCCGCCGCCGCCGCGGG - Exonic
1104835037 12:131784206-131784228 GGAGCTGCAGTGGCTGTCACCGG + Intronic
1104873983 12:132020134-132020156 GGAGCAGCAGAGGCCGTGGTGGG - Exonic
1104908686 12:132229165-132229187 GGAGGAGCAGAGGCAGCTGCAGG - Intronic
1107779107 13:43879518-43879540 GGAACTGCTGAGGCAGCAGCGGG + Exonic
1112061598 13:95745498-95745520 TGAGCTGCAGTGGCCGCTGCAGG - Intronic
1112415535 13:99200871-99200893 GGAGCCCCAGAGGGCGCCGGGGG - Exonic
1113582745 13:111440455-111440477 GGAGCTGCAGGGGAAGCTGCAGG - Intergenic
1113582752 13:111440479-111440501 GGAGCTGCAGGGGAAGCTGCAGG - Intergenic
1113582759 13:111440503-111440525 GGAGCTGCAGGGGAAGCTGCAGG - Intergenic
1113582766 13:111440527-111440549 GGAGCTGCAGGGGAAGCTGCAGG - Intergenic
1113582773 13:111440551-111440573 GGAGCTGCAGGGGAAGCTGCAGG - Intergenic
1113582780 13:111440575-111440597 GGAGCTGCAGGGGAAGCTGCAGG - Intergenic
1113582783 13:111440587-111440609 GGAGCTGCAGGGGGAGCTGCAGG - Intergenic
1113582787 13:111440599-111440621 GGAGCTGCAGGGGGAGCTGCAGG - Intergenic
1113582791 13:111440611-111440633 GGAGCTGCAGGGGGAGCTGCAGG - Intergenic
1113582799 13:111440635-111440657 GGAGCTGCAGGGGAAGCTGCAGG - Intergenic
1113582802 13:111440647-111440669 GGAGCTGCAGGGGGAGCTGCAGG - Intergenic
1113931758 13:113972479-113972501 GGAGCTGCCGAGGCCGCGGGAGG + Intergenic
1114069769 14:19097706-19097728 CGGGAAGCAGAGGCCGCCGCCGG + Intergenic
1114092493 14:19302297-19302319 CGGGAAGCAGAGGCCGCCGCCGG - Intergenic
1114120700 14:19668497-19668519 GGAGGCGCAGAGGGCGGCGCAGG + Intergenic
1114224031 14:20722597-20722619 GGAGTTGCAGAAGCTGCCACTGG - Intergenic
1116626511 14:47271613-47271635 GGAGGTGCAGAGCCAGCCACAGG - Intronic
1118463920 14:66013813-66013835 GGAGCCGCAGCTGCCGCAGCCGG - Intergenic
1118849412 14:69572818-69572840 GGAGCTGCGCTGGCCGCCTCGGG - Exonic
1119779997 14:77271064-77271086 GGAGCGGCTGCGGCCCCCGCCGG - Exonic
1120953436 14:90062019-90062041 GGAGCTACCGAGGCGGCGGCCGG + Exonic
1121275802 14:92666846-92666868 GGAGCTGAAAAGGCAGCCTCTGG - Intronic
1121775132 14:96585307-96585329 GGAGCTGCAGTTCCCGCCCCAGG + Intergenic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1122695344 14:103549621-103549643 GCGCCTGCAGAGGCCGCTGCGGG - Intergenic
1122976946 14:105174629-105174651 GGCGCAGCCGCGGCCGCCGCCGG - Intronic
1123703327 15:22932184-22932206 GGAGCTGCACAGGCACCCGAGGG - Intronic
1123710077 15:22980455-22980477 GGAGCGGCCGGGGCCGCGGCCGG - Intronic
1123980471 15:25597399-25597421 GGAGCTGCAGAGCCTTCAGCCGG + Intergenic
1124345428 15:28918687-28918709 GGGGCTGCAGAGGCTACTGCTGG + Intronic
1124383093 15:29184349-29184371 GGACCTGCTGAGGGCACCGCTGG + Intronic
1125411839 15:39414788-39414810 GCACCTGCAGAGGCCACGGCAGG + Intergenic
1125578554 15:40770552-40770574 GGAGCCGCCGTGGCCGCCCCAGG - Exonic
1125598587 15:40903107-40903129 GGAGCTGCAGAGGAAGCTGGGGG + Exonic
1125605644 15:40938381-40938403 GGAGCTGCTGTGGCCTCCACTGG + Exonic
1125746804 15:42002609-42002631 GTAGCTCCAGAGGCCACGGCTGG - Intronic
1125968169 15:43890901-43890923 GGAGCTGAAGAGGGCACAGCGGG + Intronic
1128112191 15:65083632-65083654 AGGGCTGCAGAGGACGCTGCTGG - Intergenic
1128972243 15:72117957-72117979 GCACCGGCAGAGGCGGCCGCTGG - Exonic
1129269090 15:74410114-74410136 GGAGCTGCAGAGGACAGGGCTGG + Exonic
1130517146 15:84634093-84634115 GGCGCTGCAGCGGGCGGCGCGGG - Intergenic
1131052760 15:89359312-89359334 GGAGCCACGGAGGCCGGCGCGGG - Intergenic
1131160714 15:90102901-90102923 GGAGGCGCAGACGCCGCCGGCGG - Intergenic
1131367808 15:91854222-91854244 AGTGGTGCAGAGGCGGCCGCCGG + Intronic
1132465680 16:76451-76473 GGAGGTGGAGAGGCCGGCACCGG - Intergenic
1132557484 16:578974-578996 GGAGGTGCAGAGGCTCCGGCTGG + Intronic
1132660191 16:1057803-1057825 GGAGCTGGGGAGTCCGGCGCTGG + Intergenic
1132666601 16:1083731-1083753 GGTGCAGCAGAGGCGGGCGCTGG + Intergenic
1132735799 16:1385287-1385309 GGAGCTGCCGGAGCCGGCGCTGG + Intronic
1132779422 16:1614471-1614493 GGGGCGGCAGGGGCCGCGGCGGG + Intronic
1132860759 16:2070655-2070677 GAAGCTGCAGAGACGGCCCCAGG + Intronic
1132915346 16:2340816-2340838 GGAGCGGCCGAGGCGGCCGGGGG - Intergenic
1134290828 16:12901970-12901992 GAAGCTGCCGAGGCTGCTGCCGG - Exonic
1135976116 16:27109848-27109870 GGCACTGCAGAGGCGGCGGCGGG + Intergenic
1136068614 16:27775093-27775115 GGAGCTGCGGTGGCCGCTGCCGG - Intronic
1136417672 16:30113591-30113613 GGACCTGCTGAGCCTGCCGCTGG + Exonic
1136683661 16:31981977-31981999 GGGGCTGCGGCGGCCGGCGCAGG + Intergenic
1137437808 16:48471702-48471724 GGAGCTGGGGTGGCCCCCGCAGG - Intergenic
1137673050 16:50290685-50290707 GGAGCTGCTGAAGGCGCAGCTGG - Intronic
1137817145 16:51409277-51409299 GGTGCTGCAGAGGTCTCCACTGG - Intergenic
1139467907 16:67164070-67164092 GGAGCTGCAGAGTCCGCAGAGGG - Exonic
1139967632 16:70754545-70754567 GAAGCTGCAGGGACAGCCGCGGG + Intronic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1141828660 16:86497680-86497702 CTCGCTGCAGAGGCCGCCGCCGG - Intergenic
1142194606 16:88733638-88733660 GAAGCTCCAGCAGCCGCCGCAGG + Exonic
1142212644 16:88815820-88815842 GGGGCAGCAGAGGCAGCCGCAGG + Intronic
1142253707 16:89003805-89003827 GGAGCAGCAGAGGCTGCCCAGGG + Intergenic
1142364942 16:89645255-89645277 GGAGCTGCAGACGCACCCGCTGG + Exonic
1142497493 17:314147-314169 TGTGCTGCAGAGGCCGCTGCTGG - Intronic
1142547399 17:714540-714562 GGCGCTGGGGAGGCCGCGGCGGG - Intronic
1142574076 17:894699-894721 AGAGCTGCAGAGGCTGCCCCCGG - Intronic
1142640195 17:1280974-1280996 GGAGCTGCAGAGGGCTCCGGAGG - Intronic
1142740686 17:1930294-1930316 GGAGCTGCAGAAGCAGTGGCTGG + Intergenic
1142762475 17:2050396-2050418 GGAGCAGCAGAGCCCCCAGCCGG - Intergenic
1142956428 17:3526186-3526208 GAAGCAGAAGAGGCCGGCGCAGG + Intronic
1143057488 17:4173242-4173264 GGAGCTGCAAAACCGGCCGCTGG - Intronic
1143381290 17:6497955-6497977 GGAGCGGGTGAGGCAGCCGCAGG + Intronic
1143548596 17:7614838-7614860 GGAGCGGCAGCGGCAGCAGCGGG - Exonic
1144339674 17:14301369-14301391 GCAGCAGCAGCGGCGGCCGCGGG + Exonic
1144825748 17:18104825-18104847 GGTGCTGCAGACGCAGCCCCAGG - Intronic
1147144580 17:38477684-38477706 GGGGCTGCGGCGGCCGGCGCAGG + Exonic
1147183653 17:38702367-38702389 GGGGCCGCCGCGGCCGCCGCCGG - Intergenic
1147651181 17:42062834-42062856 TGAGCTGCCGAAGCCGCCTCTGG + Exonic
1147986610 17:44310680-44310702 GGAGATGCAGTGGCTGCTGCAGG - Intronic
1148212543 17:45817197-45817219 GGAGCTGCAAAGCCCGGCTCTGG - Intronic
1148462891 17:47848258-47848280 AGAGCTGCAGAGCCTCCCGCTGG - Exonic
1148868462 17:50641544-50641566 GAAGCTGCAGAGGCTGCGGCTGG + Intronic
1149599708 17:57885523-57885545 GGAGCAGCAGCGGCAGCGGCGGG - Exonic
1150840245 17:68600546-68600568 GGCGCTCCCGAGGCCGCAGCTGG + Exonic
1151683215 17:75632718-75632740 GCAGCTGCAGAGGCCGCAAGAGG + Intronic
1151977552 17:77491038-77491060 GGAGCTGGAGAGGCCATCTCAGG - Intronic
1151986682 17:77548368-77548390 GGAGGTGCAGAGGCTGCAGGTGG - Intergenic
1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG + Intergenic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152357404 17:79813731-79813753 TGGGCTGCAGGGGCCCCCGCCGG - Intergenic
1152367471 17:79864888-79864910 GGAGCTCCAGAGGCCACAGCAGG - Intergenic
1152586645 17:81192341-81192363 GGAGCTGGAGAGGCAGGCGTGGG - Exonic
1152751793 17:82065705-82065727 GGAGCTGCAGGGGCCCCGGGCGG - Intronic
1152932301 17:83116039-83116061 GGTGCTGCAGAGGCCGGCAAGGG + Intergenic
1154344700 18:13532133-13532155 AGAGCTGCAGAGGCAGCTGCCGG + Intronic
1156036155 18:32770288-32770310 GCAGCAGCAGCCGCCGCCGCAGG - Exonic
1157102639 18:44744297-44744319 GGAGCTGGGGAGGCCCCTGCAGG - Intronic
1158570929 18:58596482-58596504 GCTGCTGCAGCAGCCGCCGCAGG + Intronic
1159578294 18:70206069-70206091 CGGGCTGCAGAGGCCCCAGCAGG + Intergenic
1159874951 18:73800622-73800644 GCAGCAGCAGAGGCAGCAGCTGG + Intergenic
1160513527 18:79465913-79465935 GGAGCTGAAGCTGCCGCCGGAGG - Intronic
1160535145 18:79587580-79587602 GGGGCTGCAGAGGCCTGTGCGGG + Intergenic
1160719131 19:589895-589917 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1160912984 19:1483400-1483422 GGAGTTGTGGAGGCCGGCGCAGG + Exonic
1161293126 19:3506389-3506411 GGAGCTGCGGAGGCCGGAGGCGG + Intronic
1161355411 19:3816676-3816698 GGAGCTGCCGGGGCAGCTGCTGG + Exonic
1161435099 19:4258379-4258401 GGAGCGGCGGAGGCAGCAGCAGG + Exonic
1161960491 19:7520470-7520492 GCAGCTGCAGCAGCGGCCGCCGG + Exonic
1162063270 19:8109674-8109696 GCAGCTGCAGAGGTAGCTGCCGG + Exonic
1162341896 19:10096311-10096333 CGAGCTGCAGAGGCTGGCGGCGG - Exonic
1162396489 19:10420579-10420601 GAAGCTGCAGAGCCCGGCCCGGG + Intronic
1162412504 19:10514981-10515003 GGGGCTGCTGCGGCCGGCGCCGG - Exonic
1162524635 19:11200360-11200382 GGGGCTGCAGAGCCTCCCGCAGG + Exonic
1162861268 19:13507101-13507123 GGAGCAGAAGAGGCAGCCGTTGG - Intronic
1163400928 19:17091944-17091966 AGAGCTGCAGAAGCCCCCACAGG + Intronic
1163737933 19:18992906-18992928 GCAGCTGCAGAGCCCACCCCAGG + Exonic
1164908527 19:31986796-31986818 GGAGCTTCAGAGCCAGCCCCTGG - Intergenic
1165351695 19:35279286-35279308 GGGGCAGCAGAGGCCGGCGTGGG - Exonic
1165463616 19:35959196-35959218 GGAGCTGCAGGGCTCGCGGCAGG + Intergenic
1165742112 19:38210737-38210759 GCAGCTGCAGCGGGCGCAGCCGG - Intergenic
1165900370 19:39166844-39166866 GGAGCTGCACAGGACGGCCCAGG + Intronic
1166043915 19:40218393-40218415 GTAGCTGCAGCGGCGGCGGCAGG - Exonic
1166373117 19:42313409-42313431 GGAGCAGCAGCGGCGGCAGCAGG - Exonic
1166375147 19:42323816-42323838 GGAGCTGCTGGCGCCGCCCCTGG + Intronic
1166694422 19:44844682-44844704 GGAGCTGGTGAGGCCGCGCCGGG - Intergenic
1167049716 19:47070955-47070977 GGAGCTGCTGTGGCAGCTGCTGG - Intronic
1167219238 19:48186762-48186784 GGAGCTGCAGGGGCAGAGGCAGG + Intronic
1167368047 19:49064950-49064972 GGAGCCGAAGAGGGCGCCCCAGG - Intronic
1167469083 19:49665486-49665508 GGAGCTACAGTGGCCGACGCTGG - Exonic
1168092713 19:54096130-54096152 GGAGCTGCCGCGGCCGTCGCTGG - Exonic
1168100352 19:54138125-54138147 CGCGCTGCAGAGGCGGCGGCAGG - Intronic
1168257594 19:55175177-55175199 GGAGCTGCAGGCGGCTCCGCGGG - Exonic
1202704653 1_KI270713v1_random:13930-13952 GGAGTTGCGGAGGCAGCTGCAGG - Intergenic
1202710874 1_KI270714v1_random:18833-18855 GCAGCTGCTGAGGCAGCGGCAGG - Intergenic
925328721 2:3042270-3042292 AGAGCAGCAGAGGCCGCGGCCGG - Intergenic
925977466 2:9151089-9151111 GCAGCCACAGCGGCCGCCGCAGG - Intergenic
926066385 2:9843623-9843645 GGAGCGGCGGAGGACGCCGCGGG + Intronic
926166208 2:10523246-10523268 AGAGGAGCAGAGGCAGCCGCAGG + Intergenic
926189951 2:10721276-10721298 GGGGCTGCGGCGGCCGCAGCGGG + Intergenic
927944009 2:27123844-27123866 GGACCTGCACAGGCCGCCTATGG + Exonic
930762377 2:55050324-55050346 GCAGCTGCTGCCGCCGCCGCCGG + Exonic
931356031 2:61538220-61538242 GCGGCTGCAGCGGCCGCGGCAGG - Exonic
932496205 2:72147118-72147140 GGCGCTGCCGACGGCGCCGCAGG + Intronic
932567934 2:72921067-72921089 TTCGCTGGAGAGGCCGCCGCCGG - Intronic
934503188 2:94874480-94874502 GGTGCTGCAGAGGGGGCCTCCGG + Intronic
935126467 2:100227748-100227770 GGAGCTGCTGAGGCTCCCACTGG - Intergenic
935681007 2:105636955-105636977 GGGGCTGCAGAGGCAGGCCCTGG - Intergenic
935702182 2:105822255-105822277 GGAGCAGCAGAGGCCCTCGGGGG - Intronic
938058284 2:128233199-128233221 GAGGCTGCAGAGGCTGACGCGGG - Intergenic
938088404 2:128416868-128416890 GGGGCTGCAGAGGCTGCCTGAGG - Intergenic
938303407 2:130231544-130231566 GGAGCTGCAGCGGCTGGCCCAGG + Intergenic
938453266 2:131442688-131442710 GGAGCTGCAGCGGCTGGCCCAGG - Intergenic
938770472 2:134496919-134496941 GGAGCTGCAGAGGGGGCCACAGG - Intronic
938986863 2:136585007-136585029 GGAGCTGCAGAGTCAGCCTGAGG + Intergenic
939999132 2:148949575-148949597 GGAGCTGCAGATGCTTCCCCAGG - Intronic
940353701 2:152717413-152717435 GTAGCGGCAGTGGCCGCCGGCGG - Exonic
942279792 2:174348701-174348723 GGAGCAGCAGAAGCCACGGCAGG - Exonic
942448429 2:176093224-176093246 GGCGCTGCAGCGGCCGCTGCAGG - Exonic
942965869 2:181891938-181891960 GGAGCTGAAGCGGGCGCCGGAGG - Exonic
944457507 2:199911042-199911064 GCAGCAGCAGGGGCGGCCGCAGG - Intergenic
946159338 2:217826592-217826614 GGAGCAGCGGAGGCAGCAGCAGG - Intronic
946164730 2:217857138-217857160 GGAGCAGCAGAGGCAGCCGTGGG - Intronic
946203950 2:218089907-218089929 CCAGCTGCAGAGGCCGCCCCAGG + Exonic
946379171 2:219332787-219332809 GGAGCTGGGGAGGCGACCGCAGG - Intronic
947670778 2:231934145-231934167 GGGGCTGTGGAGGCCCCCGCTGG + Intergenic
948263004 2:236618067-236618089 TGAGCTGCAGAGGAAGCCCCTGG + Intergenic
948365414 2:237451639-237451661 GGAGCTGCAGCGGCCACAGCGGG - Intergenic
948456404 2:238106510-238106532 GGAGCTGGAGAGGCAGCCCCGGG - Intronic
948757433 2:240167649-240167671 GCTGCTGCAGAGGCCGCCCCAGG - Intergenic
948886853 2:240888931-240888953 GGAGCTGCAGAGGCCCCCAAGGG - Intronic
1171222192 20:23408710-23408732 GGAGATGCAGAGGCCCCAGAAGG + Intronic
1171484436 20:25476992-25477014 GGAGCTGGAGGAGCCGCCGCAGG - Exonic
1171753667 20:29080170-29080192 GGAGCTACAGCGGCCGCAGAGGG - Intergenic
1172064277 20:32207983-32208005 GGAGCGGCAGAAGCAGCAGCAGG - Exonic
1172446798 20:34997421-34997443 GGAGCTGGGGAGGCTGCGGCGGG + Exonic
1172446977 20:34998360-34998382 GGAGCTGCAGCGGCAGCTGGCGG + Exonic
1173926476 20:46784836-46784858 GAAGCTGCAGAGGCCGCTGAGGG - Intergenic
1174981292 20:55398304-55398326 GGAGCTGCAGTGGCCGTCTTGGG - Intergenic
1175223800 20:57433285-57433307 GGAGCTGCAGAGGGGGAGGCTGG - Intergenic
1175448539 20:59042988-59043010 GCAGCTGGAGGGGCCGGCGCGGG + Intergenic
1175981261 20:62739812-62739834 GGAGGTGCAGCGGCCGGCGACGG + Intronic
1176045795 20:63092003-63092025 GGCGCTGCAGAGGGCACCCCAGG + Intergenic
1176120378 20:63451865-63451887 CGTGCAGCAGAGGCCGCTGCTGG - Intronic
1176867646 21:14062972-14062994 GGGGCTGCAGTGCCCCCCGCAGG + Intergenic
1178753558 21:35326500-35326522 GGAGGTGCAGAGTCCTGCGCTGG - Intronic
1179346411 21:40561778-40561800 GGAGATGCAGAGGCCAACACTGG + Intronic
1179513738 21:41892280-41892302 GGAGCTGGAGAGGCGGGAGCAGG + Intronic
1179877752 21:44279784-44279806 GGAGCTGCACAGCCCGCCATGGG - Intergenic
1180037636 21:45257875-45257897 GGACCTGCAGAGGCCGAGGATGG - Intergenic
1180064340 21:45405140-45405162 CGCGCTGCAGCCGCCGCCGCTGG - Intronic
1180090520 21:45531533-45531555 GGCGCAGCTGCGGCCGCCGCAGG + Exonic
1180124830 21:45783673-45783695 TGAGCTGCAGAGGCCAGGGCTGG + Intronic
1180201977 21:46229506-46229528 GGAGGAGCCGAGGGCGCCGCCGG + Intergenic
1180304979 22:11066778-11066800 GGAGCTGCACTGCCTGCCGCAGG + Intergenic
1180488236 22:15820269-15820291 CGGGAAGCAGAGGCCGCCGCCGG + Intergenic
1180706193 22:17811464-17811486 GGGTCTGCAGAGGCAGCCGCTGG + Intronic
1180763152 22:18223836-18223858 GGCCCTGCAGAGGCAGCCCCAGG - Intergenic
1180772493 22:18400711-18400733 GGCCCTGCAGAGGCAGCCCCAGG + Intergenic
1180803873 22:18650327-18650349 GGCCCTGCAGAGGCAGCCCCAGG + Intergenic
1180806890 22:18719122-18719144 GGCCCTGCAGAGGCAGCCCCAGG - Intergenic
1181047743 22:20223631-20223653 GGAGCTTCAAAGGCCCCTGCTGG - Intergenic
1181085211 22:20436652-20436674 GCAGCCGCAGAGGCGGCCGCCGG - Intronic
1181217845 22:21344932-21344954 GGCCCTGCAGAGGCAGCCCCAGG - Intergenic
1181235492 22:21445736-21445758 GGAGGAGCAGAGGCCGCAGGGGG - Exonic
1182349083 22:29688580-29688602 GGAGCAGCGGAGGGCCCCGCCGG + Intronic
1183230153 22:36577077-36577099 GGGGCAGCAGAGGCCCCCGGGGG - Intronic
1183431005 22:37765750-37765772 GGAGCTGCAGCGCCTGCAGCAGG + Exonic
1183481791 22:38069274-38069296 GGAGCTGGAGAGGCCTCTGGGGG - Intronic
1183566079 22:38616297-38616319 GCAGCTGCAGTGGCTGCCGGGGG + Intronic
1183708174 22:39487716-39487738 GATGCTGGAGAGGCCGCCCCCGG + Exonic
1183725478 22:39586870-39586892 GGGGCTGCAGATGCCTCCTCTGG - Intronic
1183736018 22:39645396-39645418 GCAGCTGCAGAGGCAGGGGCGGG + Intronic
1184411861 22:44330781-44330803 TGAGCTTCCGAGGCTGCCGCCGG + Intergenic
1184523691 22:45009525-45009547 GGAGCTGCAGAGCCGGCCCGAGG - Exonic
1184759690 22:46537443-46537465 GGAGCCGCCGCCGCCGCCGCAGG - Intergenic
1184892947 22:47390503-47390525 GGACCTGCAGAGGACGCTGCGGG + Intergenic
1185053305 22:48564918-48564940 GGAGGTGCAGAAGCTGCAGCTGG + Intronic
1185068202 22:48642387-48642409 GGAGCTGTGGAGGCCGCACCAGG - Intronic
1185135400 22:49068758-49068780 GTAGGTGCAGGGGCTGCCGCAGG - Intergenic
1185301633 22:50084011-50084033 GGTGCTGCAGGGGCTGCCGGCGG + Intronic
1203234333 22_KI270731v1_random:141699-141721 GGCCCTGCAGAGGCAGCCCCAGG + Intergenic
950435379 3:12976258-12976280 GGGGCAGCAGTGGCCGCCCCAGG + Intronic
953410994 3:42690483-42690505 GGGGCTGCAGGGGCCGCTGAGGG + Intronic
954272476 3:49520548-49520570 GGACCTGCAGAGGCCTGCGTTGG - Intronic
954433841 3:50485563-50485585 GGAGCTGCTGAGGCCCCCATGGG - Intronic
954687454 3:52378537-52378559 GGACCTGCAGAGGCGGCAGAGGG + Intronic
954748178 3:52798784-52798806 GGAGCTGCAGAGCACGCCACCGG + Intronic
956650756 3:71502279-71502301 GGAGCTGCAGAGGCTCCCCTGGG - Intronic
961368635 3:126416393-126416415 CCAGCTGCAGCTGCCGCCGCAGG - Exonic
961444376 3:126972323-126972345 GGAGCCACAGAGGCCCCCGGAGG - Intergenic
961820706 3:129574371-129574393 TGGGCTGCAGAGGCCCCCGCAGG + Exonic
962853190 3:139323236-139323258 GGTGCTGCAGAGGCCACAGGGGG - Intronic
964490465 3:157230602-157230624 TGACCTGGAGAGGCCGCCTCTGG - Intergenic
964509721 3:157437631-157437653 CGAGCTGCAGAGGCTGCGGGAGG + Exonic
968451117 4:676500-676522 ACAGCTGCAGAGGCCCCTGCGGG - Intronic
968850199 4:3073695-3073717 TGAGCTGGAGAGGCCCCTGCAGG - Intergenic
968907909 4:3463146-3463168 GCGGCTCCAGTGGCCGCCGCGGG + Intergenic
969114559 4:4863012-4863034 GCAGCTGTAGCGGCCGCGGCGGG + Exonic
969350134 4:6593551-6593573 GGAGCTGGAGAGGCCAGCGTGGG - Intronic
969363065 4:6677451-6677473 TGGGCTGCAGAGGCCGCCCGTGG + Intergenic
969453804 4:7289751-7289773 TGAGCTGCAGAGGCGGACGTGGG + Intronic
971280529 4:25239444-25239466 GCAGCTGCAGAGGGTGCTGCTGG - Intronic
971281677 4:25246826-25246848 GCAGCTGCAGAGGGTGCTGCTGG - Intronic
972285450 4:37643849-37643871 GAAGCTGAAGAGGCCACAGCTGG + Intronic
972780137 4:42279992-42280014 TGAGCTGCAGAGGCTGCCCCAGG - Intergenic
973793588 4:54400953-54400975 TCAGCTGCAGAGGCAGCCTCTGG + Intergenic
973981904 4:56314633-56314655 GGAGGTGCAGGGGCCGCCCGAGG + Exonic
975985192 4:80196526-80196548 GGAGTTGCCGAGGCCGTCTCGGG - Exonic
976024956 4:80675833-80675855 GGACCTGCTGAGGCAGGCGCAGG + Intronic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
979107476 4:116705852-116705874 GGAGCTGCAGAGGCCAAGGACGG + Intergenic
981093533 4:140756530-140756552 GGAGCTCCAGTCGGCGCCGCGGG - Intergenic
984778537 4:183504725-183504747 GCAGGCGCAGAGGCGGCCGCGGG + Intergenic
984964332 4:185127723-185127745 CGGGCTGCAGAGGCCCCGGCAGG + Intergenic
985975684 5:3417686-3417708 TGAGCAGCAGAGGGCGCCGGGGG - Intergenic
987073326 5:14358195-14358217 GGAGCTGCAGAAGGAGCTGCTGG + Exonic
989515316 5:42336881-42336903 GGAGCTGCAGAGGCTGTTGTGGG - Intergenic
993457318 5:88141488-88141510 GCAGCCGCAGAGGCTGACGCGGG + Intergenic
994043468 5:95284148-95284170 GCTGCTCCCGAGGCCGCCGCGGG + Exonic
994083216 5:95731183-95731205 GGAGCTCCCGGGGCCTCCGCGGG + Exonic
996871370 5:128197207-128197229 GGAGCTGCAGAGTCAGCTTCAGG - Intergenic
997192878 5:131955513-131955535 TGATCTGCAGAGGCCACTGCTGG + Intronic
997302937 5:132819716-132819738 CGAGCTGGGGAGGCGGCCGCGGG + Intergenic
997521288 5:134525902-134525924 GGAGCTCCTGGGGCCGGCGCGGG - Intronic
997691642 5:135831357-135831379 GGACCTGCAGAGCCTGGCGCAGG - Intergenic
997975415 5:138439078-138439100 GCCGCTGCAGCAGCCGCCGCGGG - Exonic
999281573 5:150369723-150369745 GGAGCTGGAAAGGCTGCAGCCGG + Intronic
999300946 5:150490030-150490052 AGAGCTGCAGAGGCGGCAGGAGG + Intronic
1001591872 5:172871144-172871166 GGGGCTGCAGAGGTCCCCGTGGG + Intronic
1001794437 5:174490346-174490368 GCACCTGCAGAGGCAGCAGCAGG + Intergenic
1002417964 5:179130585-179130607 GGAGCTGCTGGGGCCTCGGCTGG - Intronic
1002645004 5:180648775-180648797 TGAGGAGCAGAGGCCCCCGCGGG - Intronic
1002868878 6:1147829-1147851 TGAGCCGAAGAGGCCTCCGCAGG + Intergenic
1003049961 6:2771149-2771171 GCAGCTGCAGAGTCCACAGCAGG - Intronic
1003142632 6:3484374-3484396 AGAGCTGGAGAGGCCGGCGATGG - Intergenic
1003493043 6:6640470-6640492 GCAGCTACAGAGGCTGCGGCAGG + Intronic
1006134623 6:31888098-31888120 GGAGCTGCAGTGCCGGCCGGTGG + Exonic
1006472684 6:34237405-34237427 GGGGCTGCAGCGCGCGCCGCCGG + Intronic
1006834140 6:36986402-36986424 GGAGCTGTGGCGGCAGCCGCAGG + Intergenic
1007816240 6:44527577-44527599 GGAGAGGCAGAGGCCGTGGCAGG + Intergenic
1010414893 6:75601872-75601894 GGAGCGGCAGCGGCGGCGGCTGG + Intronic
1010716396 6:79234601-79234623 GGAACTGCTGGCGCCGCCGCTGG + Exonic
1013242710 6:108260928-108260950 GTAGCTGCTGCCGCCGCCGCGGG + Exonic
1014913393 6:127118900-127118922 GGAGCCGCCGGGGCGGCCGCAGG - Exonic
1018686573 6:166308255-166308277 GAAGCCGGAGAGGCCGCGGCTGG - Exonic
1018825562 6:167405876-167405898 GGAGGTGGAGAGGCCACAGCAGG + Intergenic
1019126821 6:169846228-169846250 GGCCCTGCAGAGGTCGCCCCAGG + Intergenic
1019309084 7:351438-351460 GGGGCTGCAGAGGAAGCCGGCGG + Intergenic
1019319939 7:411018-411040 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019319964 7:411090-411112 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320026 7:411270-411292 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320050 7:411342-411364 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320074 7:411414-411436 GGGGCTGGAGAGGCTGCCCCTGG - Intergenic
1019320086 7:411450-411472 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320123 7:411558-411580 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320174 7:411702-411724 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320188 7:411738-411760 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019320247 7:411892-411914 GGGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019515492 7:1438172-1438194 GGAGATACAGAGGCAGCTGCAGG - Exonic
1019567076 7:1689509-1689531 GGATCTGCAGAGGGCTCAGCTGG + Intronic
1019691655 7:2418169-2418191 GGGGCTGCAGAGTCTGCCCCTGG + Intronic
1019747696 7:2709732-2709754 AGAGGTCCAGGGGCCGCCGCAGG - Exonic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1022476426 7:30713609-30713631 GGAGCTGCATAGGGAGCCTCTGG - Intronic
1023177675 7:37449001-37449023 GGAGTTGCAGCCGCCGCCCCCGG + Exonic
1023405806 7:39833238-39833260 GGAGGCGCAGAGGGCGGCGCAGG + Intergenic
1023418298 7:39951393-39951415 GCAGCAGCAGCGGCGGCCGCCGG + Exonic
1023850113 7:44145790-44145812 GGAGAACGAGAGGCCGCCGCTGG - Intronic
1024601018 7:50981882-50981904 GGAGATGCAGAGGCCAGAGCAGG - Intergenic
1025017362 7:55449816-55449838 GGGGCTGCAGGGGCCGCAGGAGG - Intronic
1029195777 7:98804401-98804423 GGAGCTGTGGAGGCCACCCCTGG + Intergenic
1029403276 7:100358314-100358336 GGAGCAGCAGGGGCAGCAGCAGG - Exonic
1029465638 7:100722996-100723018 GGAGCAGCTGAGGCCGCATCTGG - Exonic
1029926920 7:104328482-104328504 GCAGCTGCAGCGGCGGCGGCGGG + Intergenic
1030055880 7:105583281-105583303 GGAGCCGCAGCTGCCGCAGCCGG - Intronic
1030676570 7:112391627-112391649 GGTGTTTCAGAGGCAGCCGCGGG - Intergenic
1031918257 7:127583009-127583031 GAAGCTGAAGAGGCTGCTGCAGG - Exonic
1032011819 7:128352067-128352089 CGAGCCGCAGGGGCCGCAGCGGG + Exonic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1032525460 7:132576196-132576218 GGAGGTGCAGCGGCCGGAGCAGG - Intronic
1034386138 7:150742718-150742740 GGAGGAGCAGAGGCAGCAGCAGG + Exonic
1034386796 7:150747208-150747230 GGAGGAGCAGAGGCAGCAGCAGG - Intronic
1034440037 7:151081677-151081699 GGAGCAGCAGGGGCAGCAGCAGG + Exonic
1035153274 7:156892791-156892813 AGAGCGGCAGAGGCCGGGGCGGG + Intronic
1035168043 7:157003215-157003237 GGAGGCGCAGGGGCCGGCGCAGG + Intronic
1035519692 8:266470-266492 GCAGCTGCAGAGGGGGCGGCCGG + Intergenic
1035678768 8:1472284-1472306 GGAGCAGGAGAGGACGCAGCTGG + Intergenic
1036747488 8:11420243-11420265 GCAGCTGCAGAGGCTGGCGGGGG - Intronic
1037815857 8:22111524-22111546 GGAGCTTCAGAGGCAGCCTAAGG + Intergenic
1037988373 8:23303557-23303579 GGTGCTGCAGAGGCAGCTTCAGG + Intronic
1038561757 8:28586896-28586918 GAAGCTGCTGAGGCAGCGGCAGG + Intergenic
1038566355 8:28622760-28622782 CCGGCTGCAGTGGCCGCCGCTGG + Intronic
1038583496 8:28770066-28770088 TGAGCAGCAGGGGCCACCGCAGG + Intronic
1044819361 8:96145303-96145325 GGACCCGCAGGGGGCGCCGCCGG - Exonic
1044967112 8:97584440-97584462 GGATCTGCAGAGGCCGGTGAAGG - Intergenic
1045971444 8:108083330-108083352 GGAATTCCAGCGGCCGCCGCGGG + Exonic
1046395602 8:113634118-113634140 GGAGCAGCAGTGGCGGCCGTGGG - Intergenic
1047615100 8:126557233-126557255 GGAGCCGCAGCCGCCGCCTCAGG - Exonic
1049257593 8:141622245-141622267 GGAACTGCGGAGGCAGCGGCAGG + Intergenic
1049681736 8:143921798-143921820 GGAGCTGCAGCGGTTGGCGCAGG - Exonic
1049681787 8:143922071-143922093 GGAGCAGCAGCGGCGGCAGCAGG - Exonic
1049682270 8:143924732-143924754 GGAGCAGCAGCGGCAGCTGCTGG - Exonic
1049762216 8:144336724-144336746 GGTGCTGCCCAGGCCGGCGCTGG - Intergenic
1049788396 8:144462224-144462246 GGGGCTGCAGCCCCCGCCGCGGG - Intronic
1049800980 8:144517441-144517463 GGAGCTGCGGAGCCCGCCGCCGG + Exonic
1051170115 9:14313334-14313356 GGAGTTGCAGCGGGCGTCGCGGG - Intronic
1051621014 9:19049487-19049509 GGGGCTGGAGAGGCCGCGGACGG - Exonic
1054731342 9:68705296-68705318 GGAGCAGCAGCGGCGCCCGCCGG - Intergenic
1056243290 9:84669939-84669961 GGAGTAGCCGAGGCCGCCCCAGG - Intronic
1056395300 9:86176191-86176213 GGGGCTGCAGAGGGCACAGCTGG + Intergenic
1056571004 9:87814613-87814635 TGAGCTGCAGAGAAGGCCGCTGG - Intergenic
1056780283 9:89544018-89544040 GGAGCTGCAGAGGAGACAGCAGG + Intergenic
1056856601 9:90134998-90135020 GGAGCTGCAGAGGCTCGAGCTGG + Intergenic
1057245635 9:93451978-93452000 GGAGCTGCAGAAGCTGGCCCGGG + Exonic
1057470065 9:95349430-95349452 GGCCCTGCAGAGGCAGCCCCAGG + Intergenic
1058912580 9:109534356-109534378 GGAGCCGCAGCTGCCGCAGCCGG - Intergenic
1059381358 9:113929283-113929305 GGAGCTGCAGTGGCTGGGGCTGG - Intronic
1060422742 9:123481206-123481228 GAATCTGCAGAGGCCGACTCAGG + Intronic
1060629572 9:125143458-125143480 GGAGCTGCTCCGGCGGCCGCAGG + Exonic
1060893485 9:127202886-127202908 GGAGGTGGGGAGGCGGCCGCAGG + Intronic
1061249285 9:129417088-129417110 GAAGCTGCAGACGCCTCTGCTGG - Intergenic
1061855165 9:133437989-133438011 GGAGCTGCAGTGCCCTCTGCAGG + Intronic
1061975035 9:134063752-134063774 TGATCTGCAGAGGCGGCTGCTGG - Intronic
1062232213 9:135487828-135487850 GGCCCTGCAGAGGCAGCCCCAGG - Exonic
1062289736 9:135789186-135789208 GGAGCTGCAGTGGGAGCCGCAGG - Intronic
1062560407 9:137139195-137139217 GGAGCCGCCGCCGCCGCCGCCGG + Intronic
1062577502 9:137215471-137215493 GGAGGAGCAGAGGCCCCGGCGGG - Exonic
1062641576 9:137521284-137521306 GGAGCTGCAGAGGCACCAGGCGG + Intronic
1062720304 9:138038458-138038480 GGAGCTGAAGAGGAAGCCCCTGG - Intronic
1203746035 Un_GL000218v1:41138-41160 GGTGCTGCAGAGGGGGCCTCGGG - Intergenic
1203564079 Un_KI270744v1:78344-78366 GGTGCTGCAGAGGGGGCCTCGGG + Intergenic
1185464539 X:346631-346653 GTTTCTGCAGCGGCCGCCGCGGG - Intronic
1185853150 X:3507938-3507960 GGAACTGCAGAGGCAGACACTGG - Intergenic
1187507206 X:19887478-19887500 GCAGCAGCAGAGGCAGCAGCGGG - Exonic
1187885570 X:23885821-23885843 GAAGCTGAAAAGGCCGCTGCAGG - Intronic
1191640276 X:63424182-63424204 GCACCTGCAGAGGCAGCAGCTGG + Intergenic
1192630751 X:72776607-72776629 GAAGCTGCAGAGGCAGCCGCTGG + Intergenic
1192650959 X:72944197-72944219 GAAGCTGCAGAGGCAGCCGCTGG - Intergenic
1193600101 X:83501152-83501174 GGAGCAGCAGAGGCTGCCCAGGG + Intergenic
1195702615 X:107716439-107716461 GCAGCCGCAGAGGCAGCCGGAGG - Intronic
1196684067 X:118495881-118495903 GCAGCGGCCGCGGCCGCCGCGGG + Intronic
1196755138 X:119150972-119150994 GGTGCTGCTGAGGGAGCCGCTGG + Intergenic
1199649723 X:149939545-149939567 GGGGCTTCGGAGGCAGCCGCGGG + Intergenic
1199843264 X:151672215-151672237 GGAGCAGCAGCGGCAGCTGCGGG + Exonic
1200100650 X:153687984-153688006 GCGGCTGCAGCCGCCGCCGCCGG + Intronic
1200102071 X:153693183-153693205 GGAGGTGGAGAGGCTGCAGCAGG + Intronic
1200150401 X:153948687-153948709 GGCGCTGCCCAGGCCGCCGCGGG + Exonic
1201159358 Y:11156150-11156172 GGTGCTGCAGAGGGGGCCTCTGG - Intergenic