ID: 1073336562

View in Genome Browser
Species Human (GRCh38)
Location 10:102714475-102714497
Sequence GGAGCTGCAGAGGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 451}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073336555_1073336562 3 Left 1073336555 10:102714449-102714471 CCCGCCCACGCAGTGGGCGGGCT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336549_1073336562 29 Left 1073336549 10:102714423-102714445 CCAGAGTGCGCAAGTGCGCTAAG 0: 1
1: 0
2: 1
3: 0
4: 16
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336557_1073336562 -1 Left 1073336557 10:102714453-102714475 CCCACGCAGTGGGCGGGCTACGG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336556_1073336562 2 Left 1073336556 10:102714450-102714472 CCGCCCACGCAGTGGGCGGGCTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336548_1073336562 30 Left 1073336548 10:102714422-102714444 CCCAGAGTGCGCAAGTGCGCTAA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451
1073336559_1073336562 -2 Left 1073336559 10:102714454-102714476 CCACGCAGTGGGCGGGCTACGGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073336562 Original CRISPR GGAGCTGCAGAGGCCGCCGC CGG Intergenic