ID: 1073338661

View in Genome Browser
Species Human (GRCh38)
Location 10:102729159-102729181
Sequence CACTGTGAGTGAGGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 560}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073338655_1073338661 -8 Left 1073338655 10:102729144-102729166 CCAAGGGGGCTGGAGCACTGTGA 0: 1
1: 0
2: 2
3: 35
4: 333
Right 1073338661 10:102729159-102729181 CACTGTGAGTGAGGGGGAGAGGG 0: 1
1: 0
2: 5
3: 58
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073338661 Original CRISPR CACTGTGAGTGAGGGGGAGA GGG Intronic
900243410 1:1627242-1627264 GTCTGAGAGTGAGGGGCAGAGGG + Intronic
900244028 1:1629553-1629575 CACCGTGTGTGAGGGTGAGTGGG + Exonic
900292479 1:1929356-1929378 CATGGTGCGGGAGGGGGAGAGGG + Intronic
901304507 1:8222971-8222993 TAATGTGAGAGATGGGGAGATGG - Intergenic
901784726 1:11617106-11617128 TGCTGTGAGGGTGGGGGAGAAGG - Intergenic
903261494 1:22134030-22134052 CGCTGTGAGTCAAGAGGAGAGGG + Intronic
903560684 1:24224804-24224826 CACAGTGAGTGAGGCCCAGAAGG - Intergenic
903676040 1:25065289-25065311 CACTTTGAGTTTGGGGGAGTCGG - Intergenic
904913150 1:33950324-33950346 CATTGGGTGTGAGGAGGAGACGG - Intronic
905276711 1:36823110-36823132 CACCAGGAGTGAAGGGGAGATGG + Intronic
905483798 1:38281397-38281419 TGCTGAGAGTGAGGGGGTGAAGG + Intergenic
905650985 1:39656831-39656853 CCCTGGGAGTGAGAAGGAGAGGG + Intergenic
906125859 1:43426581-43426603 CCCTGTGAGGGTGGGGGAAAAGG - Intronic
906330102 1:44877282-44877304 CTGTCTGAGTGAGGGGGAGCAGG + Intronic
906477929 1:46182320-46182342 CACTGTGAAGGAGATGGAGAAGG + Intronic
906697164 1:47830745-47830767 CACTGTGAGCCAGGGAAAGACGG + Intronic
906976664 1:50581675-50581697 CAATGTGAGAGAAGGGGAGGAGG + Intronic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907080523 1:51617383-51617405 CAATGAGGGTGAGGGAGAGAGGG + Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907745573 1:57209824-57209846 GTGTGTGTGTGAGGGGGAGAGGG - Intronic
908003121 1:59701110-59701132 CACTGGGAGTGCTGGGGATAGGG + Intronic
908389929 1:63675244-63675266 CGCAGTGTGGGAGGGGGAGAGGG - Intergenic
908420507 1:63954248-63954270 CACTCCCAGGGAGGGGGAGATGG + Intronic
908545959 1:65162350-65162372 CACTGTAAGTGGGGAGGAGATGG + Intronic
909882038 1:80891797-80891819 CACTTGGAGTGTGGGGGAGATGG + Intergenic
910113001 1:83701904-83701926 CACCGGGAGTGAGGGGTTGAGGG - Intergenic
910295582 1:85642019-85642041 CACTGTGCGTGAGCGGAAGCAGG + Intergenic
913081096 1:115387916-115387938 ACCTGAGAGTGATGGGGAGATGG - Intergenic
914237971 1:145829686-145829708 CACAGTGAGTAAGATGGAGACGG - Intronic
914374865 1:147064066-147064088 CACTGTGAACGAGGTGGAGCAGG + Intergenic
915020138 1:152771420-152771442 CCCTGTGAGAGAGGGTGACATGG - Intronic
915241382 1:154524809-154524831 CGCTGTGAAGGTGGGGGAGAGGG - Intronic
915322206 1:155062230-155062252 CCCTGAGACTGAGGGAGAGAAGG - Exonic
915461623 1:156073947-156073969 CCCTGAGGGGGAGGGGGAGAGGG + Exonic
915581194 1:156814293-156814315 CCCTGTGGGTGACGGAGAGAGGG + Exonic
915708430 1:157869730-157869752 CATTGTCAGTGAGGGGCAGATGG + Intronic
916240748 1:162636521-162636543 TAGTGTGAGTGAGAGGGAGAGGG + Intronic
917490855 1:175497303-175497325 GACGGTGAGAGAGAGGGAGATGG - Intronic
917531466 1:175839828-175839850 CACAGTGACTAAGGAGGAGAAGG + Intergenic
917640128 1:176975342-176975364 CACTGCTAGTAAGGGGCAGAGGG + Intronic
918015886 1:180632175-180632197 GAGTGGGAGTGAGGGGGAAACGG + Exonic
918863306 1:189860712-189860734 CACTGTGGTAGAGAGGGAGAGGG - Intergenic
919033075 1:192269719-192269741 CACTGTGAGTAATGAGGATAAGG + Intergenic
919701829 1:200638930-200638952 CAATGTGAGTGTGGGTGAGTGGG + Intronic
919786498 1:201261596-201261618 CACTGTGAGCAAGGGGGTGATGG + Intergenic
920312795 1:205058380-205058402 CACTTTGGGGGAGGGGGAGAGGG + Intronic
920516635 1:206589319-206589341 CACTGGGAGCGGGGGAGAGAGGG + Intronic
920794761 1:209128448-209128470 GACCGTGAGGGAGAGGGAGAGGG - Intergenic
921148984 1:212385164-212385186 CACACTGAGTGAGTGGAAGAAGG + Intronic
921195865 1:212757193-212757215 CACAGTAAGCGAGGGTGAGATGG + Intronic
921592191 1:217017325-217017347 CAGTGTGAATGAGGCTGAGAGGG - Intronic
923156104 1:231280770-231280792 TACTGTGTTTGATGGGGAGATGG - Intergenic
923256168 1:232223432-232223454 CACTCTGAGGGAGGGGCAAAGGG - Intergenic
923497083 1:234535060-234535082 AACTGTGAGTCTGGGGGAGAGGG - Intergenic
923719751 1:236456718-236456740 CAGAGGGAGTGAGGGGGAGGGGG - Intronic
923876113 1:238049496-238049518 CAGTGTGGGAGAGGGTGAGAGGG + Intergenic
924055177 1:240118090-240118112 CAGTGTGTTTGAGGAGGAGAAGG + Intronic
924217805 1:241842517-241842539 CAAGGTGAATGAGTGGGAGAGGG - Intergenic
1062824355 10:557308-557330 CACCGTGACTCAGGGGGACAGGG + Intronic
1062915378 10:1239207-1239229 CACCGGGAGGGAGAGGGAGAGGG - Intronic
1063236217 10:4119223-4119245 CAATGTGAGGGAGGTGGAGGAGG - Intergenic
1064487732 10:15813234-15813256 CACTGAGAATTAGGGGGACAAGG - Intronic
1066644430 10:37591326-37591348 CACTGGGAGTGAGTGAGACAGGG + Intergenic
1067684509 10:48458474-48458496 CAGTGTGGGTGAGGCGCAGACGG + Intronic
1067845950 10:49721455-49721477 CACGGTGGGTCAGGGGCAGAGGG + Intergenic
1068506431 10:57905796-57905818 CAGTGTGAGTGATGGGCAGTGGG - Intergenic
1068738113 10:60437683-60437705 CAGTGTGCATAAGGGGGAGAGGG + Intronic
1069146363 10:64896591-64896613 CACTGTGAGAGAGAAGGAGGTGG + Intergenic
1070467770 10:76741702-76741724 CTCTGTGAATGAGGAGGTGAGGG + Intergenic
1070669260 10:78366651-78366673 CACTGGCAGGGATGGGGAGAGGG + Intergenic
1071333565 10:84584275-84584297 TTCTGTGAGAGAGAGGGAGAGGG - Intergenic
1073102654 10:101014874-101014896 CACTGTGTGTGAGGGCGAGCTGG - Intronic
1073338661 10:102729159-102729181 CACTGTGAGTGAGGGGGAGAGGG + Intronic
1073449073 10:103598882-103598904 TGCTGTGAGTTAGGGGGTGAGGG + Exonic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1075055494 10:119215430-119215452 CAGTGTGGAGGAGGGGGAGAAGG + Intronic
1075242778 10:120793266-120793288 CAGTGTGTGTGTGGGGGGGAGGG - Intergenic
1075488394 10:122846321-122846343 CCCTGTGGGGGAGGGGAAGAGGG + Intronic
1075531830 10:123236370-123236392 CACAGTGGGTGAGTGGGAGGTGG + Intergenic
1076340987 10:129744682-129744704 CACTGAGAGTGAGCGGGAGGAGG - Intronic
1076598586 10:131642062-131642084 GACTGTGAGTGTGGGGGGGAAGG - Intergenic
1076670713 10:132119484-132119506 AGCTGTGAGAAAGGGGGAGACGG - Intronic
1077562801 11:3275029-3275051 CACTGTGAGTGGTTGAGAGATGG - Intergenic
1077568695 11:3320848-3320870 CACTGTGAGTGGTTGAGAGATGG - Intergenic
1077635180 11:3837277-3837299 CACTGTCAGTGAGGCAGAGCTGG + Intronic
1077701428 11:4445511-4445533 CACTGGGAGTGAGGGAGATGAGG + Intergenic
1077771586 11:5224920-5224942 CACTGTGAGTGGGGGAGGCAGGG + Intergenic
1079161557 11:17999652-17999674 GTCTGTGTGTGAGGGGGACAGGG - Intronic
1079378680 11:19917519-19917541 CACTGTCTGTGAGGGTAAGAGGG - Intronic
1080267615 11:30418013-30418035 CACAGTGATTGTGAGGGAGAAGG - Intronic
1081155680 11:39686759-39686781 GTCTGAGAGTGAGGTGGAGAAGG + Intergenic
1081510910 11:43772419-43772441 CACTGTGCATGAAGGGGTGATGG - Intronic
1081878323 11:46426311-46426333 CACAGTGAGGGCTGGGGAGATGG + Intronic
1082786191 11:57318345-57318367 TACTTGGAGTGAGGGAGAGAAGG + Intronic
1083173629 11:60936605-60936627 CCCTGTGAGAGTGGGGGAGGAGG + Exonic
1083176298 11:60952074-60952096 CAGTGGGGGTGAGGGGGACAGGG - Intronic
1083931632 11:65849537-65849559 CGCAGTGAGTGAGCGGGACAAGG + Exonic
1084472155 11:69368810-69368832 CACTGCGAGTGGGGTGGGGAAGG - Intergenic
1085396228 11:76208549-76208571 CACTTTGGGAGAGGGGAAGACGG - Intronic
1086453535 11:86940147-86940169 CACTGTTAGTGGAGGGGACAGGG - Intronic
1086486613 11:87310145-87310167 AACTGTGAGTGGGTGGAAGAAGG - Intronic
1087613448 11:100461588-100461610 CACAGTGAGTGTGAGGAAGATGG - Intergenic
1088039315 11:105357783-105357805 CTCTGTGAGGGAGCTGGAGAGGG + Intergenic
1089895793 11:121929019-121929041 CGATGTGAGTGTGGAGGAGAGGG + Intergenic
1090240130 11:125175988-125176010 CGCTGTGAGTGAGTATGAGAAGG - Intronic
1090381196 11:126328724-126328746 CCCTGAGAGTGGGGGAGAGATGG - Intronic
1090545799 11:127766517-127766539 TACTGTTAGTGAGGAAGAGAGGG + Intergenic
1091046878 11:132332937-132332959 CACAGGGAGGGAGCGGGAGACGG + Intronic
1091191729 11:133701315-133701337 CACTGTTAGTGCAGGGGAGGCGG - Intergenic
1091296286 11:134476086-134476108 GACTGTGAGTGAGAGGGAAGGGG + Intergenic
1091814743 12:3429132-3429154 CACTGTGGGTGGGGCGGAGGGGG + Intronic
1091839710 12:3612052-3612074 CACAGAGAGGGAGGGAGAGAGGG + Intronic
1091936082 12:4435450-4435472 CAGGGTGAGTGATGGGGACATGG - Intronic
1092097041 12:5851352-5851374 GTCTGGGAGTGAGGAGGAGAAGG + Intronic
1092570906 12:9720247-9720269 TACTGTGTGTGCTGGGGAGAAGG - Intronic
1093124365 12:15310663-15310685 CATTCTGATGGAGGGGGAGAAGG + Intronic
1093660814 12:21754370-21754392 CAAGGTGAGAGAAGGGGAGAGGG + Intronic
1094827082 12:34277842-34277864 CAGAGTGAGGGAGGAGGAGAAGG - Intergenic
1095905097 12:47369349-47369371 GACTATGAGGGAGGGGGAGCAGG + Intergenic
1096198508 12:49664525-49664547 CCCTGTGTGTGAGGGCAAGAAGG - Intronic
1096610234 12:52796086-52796108 CACTGAGAGTCAGAGGAAGAGGG + Exonic
1096792028 12:54051473-54051495 GACTGTGAGTGAGGGGGCGGAGG - Intronic
1097053492 12:56237268-56237290 CCCAGGGAGTGAGGGGGACAGGG - Exonic
1097494266 12:60310423-60310445 CACTGAGAGTGTGGGATAGATGG - Intergenic
1097780884 12:63703150-63703172 CACTGTGGGTCAGTGGGAGCAGG + Intergenic
1100540923 12:95556627-95556649 CATTGTGATTGGGAGGGAGAGGG + Intergenic
1100560105 12:95739881-95739903 TTCTGAGGGTGAGGGGGAGATGG - Intronic
1100569969 12:95838099-95838121 CAATTTGACTGAGGGGCAGAAGG + Intergenic
1101908560 12:108846012-108846034 CACTGTAGGGGAGGGGGTGAAGG + Intronic
1102787622 12:115617411-115617433 GACCTTGAGTGAAGGGGAGAGGG + Intergenic
1103123368 12:118399570-118399592 CACTTTGAGGGAGGGGAGGATGG + Intronic
1103193356 12:119021117-119021139 CACTGGAAGTGAGTGTGAGAAGG + Intronic
1103795322 12:123499313-123499335 GAATGAGAGTGAGGGAGAGAAGG + Intronic
1103918747 12:124388860-124388882 CACGGTGAGGGAGGGAGGGAGGG + Intronic
1104608410 12:130206579-130206601 CACTGTGAGTGGTATGGAGATGG + Intergenic
1104734730 12:131129831-131129853 CACAGAGAGGGAGGTGGAGATGG - Intronic
1104792461 12:131492682-131492704 CACCCTCAGTGCGGGGGAGAGGG - Intergenic
1104806411 12:131592195-131592217 CACTGGGAGTGGGGCGGGGACGG - Intergenic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1106207328 13:27612327-27612349 CACTTTGAGGGAGGGGGAGGAGG - Intronic
1106902576 13:34369419-34369441 CATAGTAAGTGATGGGGAGAGGG + Intergenic
1106934345 13:34701879-34701901 CCCTGTGAGTGAAGTGGAGAGGG - Intergenic
1107263731 13:38526224-38526246 CACTATGAGAGTGGGTGAGACGG - Intergenic
1108276979 13:48820938-48820960 CAGAGTGAGTGAGGGGAAGTGGG + Intergenic
1108668533 13:52656500-52656522 CACTGTTAGTAAGGGGAACATGG - Intronic
1108684199 13:52804698-52804720 CCCTGTGGGTGTGGAGGAGAGGG - Intergenic
1110143441 13:72159769-72159791 CACTCTGAGGGAAGGGAAGATGG - Intergenic
1110660244 13:78052330-78052352 CACAATGAGTGAAAGGGAGAGGG + Intergenic
1110976183 13:81838478-81838500 AAGTGTGAGAGAGTGGGAGAAGG + Intergenic
1112223411 13:97514156-97514178 CACAGTGAGAGAGGGAGTGAGGG + Intergenic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113715959 13:112508079-112508101 GGCTGGGAGTGAGGGAGAGAAGG - Intronic
1114368118 14:22052563-22052585 CAATGTGAGTTAGAGGGAAATGG + Intergenic
1114401644 14:22415785-22415807 CACTGTGTGTGTGTGTGAGATGG - Intergenic
1116502736 14:45639849-45639871 CACTTTGAGGGAGGGGCAAACGG - Intergenic
1117240688 14:53829473-53829495 CACTGTGAGAGATGGGAGGATGG - Intergenic
1117596700 14:57333060-57333082 GACCGTGAGGGAGAGGGAGAGGG - Intergenic
1118038202 14:61890784-61890806 TTCTGTGAGTGAATGGGAGAGGG + Intergenic
1118646214 14:67843289-67843311 CATTGTGGGGGAGGGGGGGAGGG - Intronic
1119137178 14:72231823-72231845 CCCTGTAAGTGAGGAGGAGAGGG + Intronic
1119426649 14:74539707-74539729 GACTGAGAGGGAGAGGGAGAGGG + Intronic
1119515209 14:75242555-75242577 CGCTGTGACAGAGAGGGAGATGG + Intronic
1120044397 14:79790275-79790297 CATGGTGAGAGAGGGAGAGAGGG + Intronic
1120403417 14:84063203-84063225 AAGTGTGACTGAGGGGGAGCTGG + Intergenic
1120750226 14:88190540-88190562 CACTGTGCGTAAGGGGAAAATGG + Intronic
1122680382 14:103456411-103456433 AAGTGTGAATGAGGGGAAGAGGG - Intronic
1123143398 14:106105273-106105295 CCCTGTGGGTGTGGGGGACAGGG + Intergenic
1123191486 14:106576270-106576292 CCCTGTGGGTGTGGGGGACAGGG + Intergenic
1123480247 15:20624495-20624517 CACTGTGAGTGTGGGGGCAGGGG - Intergenic
1123637759 15:22375868-22375890 CACTGTGAGTGTGGGGGCAGGGG + Intergenic
1125354392 15:38802075-38802097 AACTGAAAGTGATGGGGAGAAGG - Intergenic
1125460170 15:39898848-39898870 CACTGTGTGGGTGGGGGAGAAGG + Intronic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1125778590 15:42242503-42242525 ATGTATGAGTGAGGGGGAGAGGG + Intronic
1126105015 15:45141788-45141810 TTCTGTGTGTGAGGGAGAGATGG + Intronic
1126569427 15:50134170-50134192 GACTGTCAGTGAGAGGGAAATGG + Intronic
1126758235 15:51945331-51945353 CCTTGTGAGTGAGAGGAAGAGGG - Intronic
1127599258 15:60518784-60518806 CAGGGTCAGTGAAGGGGAGAGGG - Intronic
1127629873 15:60818076-60818098 TACTGTGAGTGAGAGGGATTAGG + Intronic
1127827312 15:62715995-62716017 CCCTGGGAGAGATGGGGAGAGGG + Intronic
1127878682 15:63135849-63135871 CTCTGTGTATAAGGGGGAGAAGG + Intronic
1127900747 15:63339118-63339140 CACAGTGGGTGAGTGGGAGCTGG + Intronic
1127982917 15:64047161-64047183 GAATGAGAGTGAGGGGGTGAAGG + Intronic
1128084390 15:64875753-64875775 CATTGTGAATGTGGGAGAGATGG + Intronic
1129326916 15:74805043-74805065 CAGTGTGAGAGTGGAGGAGAGGG + Intergenic
1130106562 15:80932887-80932909 GACTGTGTGTGAGAGGGAGGTGG - Intronic
1130509532 15:84577467-84577489 CACTGTGAGTTGGGGTGAGGAGG - Intergenic
1130662999 15:85845351-85845373 CACTGTGAGGGAAGGTGAGATGG + Intergenic
1130931665 15:88432886-88432908 CACAGTGAGGCAGAGGGAGAGGG + Intergenic
1131388871 15:92031010-92031032 CCCTGTGAGGGAGGGAGGGAGGG + Intronic
1131406143 15:92166546-92166568 TAGTGTGAGTGAGGGGAAGCTGG - Intronic
1131466713 15:92661352-92661374 CACTGTCCGAGAAGGGGAGAGGG + Intronic
1131828338 15:96337492-96337514 CTCTATGACTGAGGAGGAGACGG - Exonic
1132120139 15:99169118-99169140 CACAGGGAGTGAGGGAGAAAGGG - Intronic
1132323138 15:100941978-100942000 CACTGTGCGTGAGGTGGAGAAGG - Intronic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1133485325 16:6214375-6214397 GAGTGAGAGTGAGAGGGAGAGGG + Intronic
1133804875 16:9117765-9117787 CAGTATTAGTGAGAGGGAGAGGG + Exonic
1134257122 16:12621733-12621755 CACTGTGGGTGACTGGGGGAGGG - Intergenic
1134763400 16:16734151-16734173 CATTGAGAGGGAGAGGGAGAGGG + Intergenic
1134982652 16:18625006-18625028 CATTGAGAGGGAGAGGGAGAGGG - Intergenic
1135964537 16:27024868-27024890 CACTGTGTGTGTGGGGGGGGGGG - Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136497900 16:30655056-30655078 CACTGTGGGTGGTGGGGAAATGG + Exonic
1136721394 16:32321706-32321728 CACTGTGAGTGAGTGAGCCACGG - Intergenic
1137468317 16:48731438-48731460 CCCTGTGAGTGCCTGGGAGAGGG + Intergenic
1137568959 16:49552243-49552265 CACAGTGAGTCAGTGGCAGAGGG - Intronic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1139238922 16:65370443-65370465 CGCTGTGAGTGAGGGGATGTAGG + Intergenic
1140221076 16:73044475-73044497 CAGTACGAGTGAGGGTGAGATGG + Intronic
1140230184 16:73111576-73111598 CTCTGTGAGGGAGGGAGGGAGGG + Intergenic
1141300477 16:82810865-82810887 GATTGTGAGTCAGGGGGAAATGG + Intronic
1141609169 16:85171386-85171408 CACGGTGAGGAAGGGGAAGAAGG - Exonic
1141621865 16:85240567-85240589 CACCTGGAGTGAGGGGAAGATGG + Intergenic
1141794341 16:86260028-86260050 TACTGTGGGCGAGGGTGAGAGGG - Intergenic
1141927453 16:87178734-87178756 GACGGAGAGTGAGAGGGAGAGGG - Intronic
1203005038 16_KI270728v1_random:196064-196086 CACTGTGAGTGAGTGAGCCACGG + Intergenic
1203136588 16_KI270728v1_random:1732183-1732205 CACTGTGAGTGAGTGAGCCACGG + Intergenic
1203140575 16_KI270728v1_random:1762894-1762916 CACTGTGGGTGAGGTCGCGATGG + Intergenic
1143387807 17:6542448-6542470 CTTTGTGTGTGAGGGAGAGAGGG - Intronic
1143448074 17:7020264-7020286 GACTGGGAGTGTGGGTGAGATGG - Intergenic
1143551025 17:7630606-7630628 CAGTGTGGGTTTGGGGGAGATGG - Intronic
1143750060 17:9021497-9021519 CGCTGGGAGTGAGGGGCGGAGGG - Intergenic
1144137787 17:12314768-12314790 CACTGGGAGGTAGGGGGTGATGG + Intergenic
1144209971 17:13005902-13005924 CAGTGTGAGTGTGGGGGGTAAGG - Exonic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1144942460 17:18951281-18951303 CACTGTCACTGCGGTGGAGACGG + Intronic
1146722974 17:35136343-35136365 TCCTGTGAGTGATTGGGAGAAGG - Exonic
1146889977 17:36500662-36500684 CGTTATGAGTGAGGGGGACAGGG + Intronic
1147782989 17:42957071-42957093 CACTGGGAGGGAGGCGGAGGTGG - Intronic
1147930429 17:43977176-43977198 CAGGGAGAGGGAGGGGGAGAGGG + Intronic
1148562763 17:48615326-48615348 CAGGGAGAGAGAGGGGGAGAGGG + Intronic
1148983196 17:51597410-51597432 CACTTTGAGGGAGGGGCAAAGGG + Intergenic
1149371268 17:55995518-55995540 CACTGATAGTAAGGTGGAGAAGG + Intergenic
1149544581 17:57493863-57493885 CACTGTGAGGTAGGCGGAGCAGG + Intronic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1151034854 17:70786783-70786805 GACAGAGAGTGAGGGAGAGAGGG - Intergenic
1151201041 17:72468158-72468180 CACTGAGAGGGAGGGAGAGAGGG + Intergenic
1152331819 17:79677874-79677896 CACTGGGTGAGAGGAGGAGAGGG - Intergenic
1153227729 18:2910687-2910709 CACTGGGAGGGAGGGGGACTTGG + Intronic
1153681826 18:7508279-7508301 CACTGTGAGTGATGTTGAAAGGG + Intergenic
1153800498 18:8663755-8663777 CACTGTGAGTGATCGGAAGAGGG + Intergenic
1154338980 18:13487899-13487921 CACTGAGAGCAAGGGGGAGATGG + Intronic
1155940226 18:31795263-31795285 CACTTTGAGGGAGGGGGAAGGGG + Intergenic
1156339811 18:36200877-36200899 CACTGTGAGTGAGTTACAGAGGG + Intronic
1156346416 18:36260825-36260847 CACTGTGACGGAGGCAGAGAGGG - Intronic
1156482271 18:37443708-37443730 CACAGAGAGGGAGAGGGAGAGGG - Intronic
1156586791 18:38439895-38439917 CATTGTGAGAGAGGAGGAGCTGG + Intergenic
1157271189 18:46277574-46277596 CACTGAGAGTGATGGTGAGAGGG - Intergenic
1157793328 18:50552704-50552726 CACTTTGAGGGAGGGTAAGATGG - Intergenic
1158929645 18:62311023-62311045 CACTTTGAGGGAGGGGTAAAGGG - Intergenic
1159450715 18:68598731-68598753 CACAGAGAGAGAGAGGGAGATGG + Intergenic
1159922267 18:74237098-74237120 CACTGAGAGGGAGAGGGAGGTGG - Intergenic
1159953361 18:74501847-74501869 CACTGTGTGTGAGGGGGAGCCGG - Intronic
1160098425 18:75897830-75897852 AACTGTGAGTGAAGGAGAGTTGG - Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160720961 19:596739-596761 CACAGAGTGTGAGGGGGAGTGGG + Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1160968761 19:1758128-1758150 GACGGAGAGGGAGGGGGAGACGG + Intronic
1161636223 19:5390905-5390927 CAGAGTGAGTAATGGGGAGATGG - Intergenic
1162117786 19:8442027-8442049 CAGTGTGATTGAGGGGCAGGTGG + Intronic
1162216721 19:9140614-9140636 CCCTGGAACTGAGGGGGAGAAGG - Intronic
1162576647 19:11503208-11503230 TGCAATGAGTGAGGGGGAGAAGG - Intronic
1163001374 19:14369924-14369946 TACGGTGAGTCAGGGGGAGAGGG - Intergenic
1164524212 19:29001449-29001471 CACTGTGAGAGAGAGAGAGCTGG + Intergenic
1164635924 19:29791518-29791540 GACTGTGAGGGAGGAGGAGGGGG - Intergenic
1164742703 19:30588360-30588382 CATGGTCAGTGAGGGGGACAAGG + Intronic
1164855035 19:31514075-31514097 CACGGTGCGTGGGGGGGAGAGGG - Intergenic
1164955827 19:32383277-32383299 TATTTTGAGTGAGGGGGAGTGGG + Exonic
1165323871 19:35102797-35102819 CAGAGTGAGTGAGGGGCAGGTGG - Intergenic
1165446626 19:35860331-35860353 CACTGTGCAGGAGGGAGAGAAGG + Exonic
1165670261 19:37672375-37672397 CCCTGGGAGTGAGGGAGGGATGG + Intronic
1165706521 19:37980094-37980116 AAGTGGGAGTGATGGGGAGAGGG - Intronic
1165764940 19:38344353-38344375 CACTGTGGGAGAGGAGGTGAGGG + Exonic
1166563903 19:43751692-43751714 CACTGGGAGGAAGGGGCAGAAGG - Intronic
1166711729 19:44942084-44942106 CACTGTGTGGGAGGGTGAGAAGG + Intergenic
1167575833 19:50317053-50317075 CTATGGGATTGAGGGGGAGAGGG - Intronic
1167862727 19:52298120-52298142 CAGTTTGAGAGTGGGGGAGAGGG + Intronic
926075003 2:9935424-9935446 CACTGTGGATAAAGGGGAGAGGG + Intergenic
926196879 2:10769266-10769288 CACTGTGTGGGAGAGGGAGCAGG + Intronic
927211523 2:20641866-20641888 CTCCGTGAGTGAAGGGGTGAAGG - Intronic
927321511 2:21752171-21752193 CACTGTGAGGGAGGGAGGAAAGG - Intergenic
927330640 2:21859393-21859415 GACCCTGAGTGAAGGGGAGAGGG + Intergenic
927652983 2:24923377-24923399 CACTGTGAGTGAGATGGATGAGG - Intergenic
927958695 2:27225923-27225945 CACGGTGAGTGAATGGGGGAAGG + Exonic
928045422 2:27926246-27926268 CACAGTAAATGAGGGAGAGAGGG - Intronic
928045428 2:27926283-27926305 CACAGTAAATGAGGGAGAGAAGG - Intronic
928693547 2:33825209-33825231 GAGGGTGAGTGAGGGGAAGAGGG - Intergenic
929256459 2:39816207-39816229 CCCTGAGAGAGAGGGAGAGAGGG - Intergenic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929279726 2:40064830-40064852 GACTGTGAGAGAAGGTGAGAAGG - Intergenic
929660553 2:43780081-43780103 GACTGTTAGTGGGGGGAAGAGGG + Intronic
929878129 2:45814044-45814066 CTCTGTGCGGGAGGGGGAGGGGG - Intronic
930795210 2:55382561-55382583 CCCTGTGAATAAGGGAGAGATGG - Intronic
931420097 2:62119081-62119103 GACTGTGGGGCAGGGGGAGAGGG + Intronic
932558512 2:72846734-72846756 GACAGTGGGTGAGGGGGAGCAGG + Intergenic
932804175 2:74768773-74768795 AACTGTAAGTGTGTGGGAGACGG - Intergenic
933178791 2:79206734-79206756 AACTGTGAGTGAGGAAGATATGG + Intronic
934103855 2:88678627-88678649 TGATGGGAGTGAGGGGGAGATGG + Intergenic
934728017 2:96637826-96637848 CACTGGGGGTGAGGGTGAAAGGG - Intronic
934777388 2:96948207-96948229 CACAGGGAGCGAGGGGCAGAGGG - Intronic
934927017 2:98389138-98389160 CACAGTGAGGGAGGTGGAGAGGG + Intronic
935405105 2:102700426-102700448 AACTGAGAGGGAGGGTGAGAAGG + Intronic
935650262 2:105375821-105375843 CACTGGGAGTTGGGGGCAGAGGG + Intronic
937080299 2:119135675-119135697 CGCTTTGAGTGAGGGAGAGGGGG - Intergenic
937362555 2:121239169-121239191 CACTGAGTGTGGGGGTGAGAGGG - Intronic
937398392 2:121559068-121559090 CACTGTGATGGAGGGAAAGAAGG + Intronic
937496404 2:122425152-122425174 CTCAGTGAGTGAAGGGGAAAGGG + Intergenic
939338960 2:140868697-140868719 CATAGTGAGTGAGGAAGAGAGGG + Intronic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
941344664 2:164353009-164353031 CACTGTGAATGAGTGAAAGAAGG + Intergenic
941752601 2:169148879-169148901 CAATGTGGGTGAGAGTGAGAAGG - Intronic
941793501 2:169576126-169576148 GACCGTGAGGGAGAGGGAGAGGG + Intergenic
942047011 2:172105498-172105520 GAGTGTGAGGGAGGGGGAAAGGG + Intergenic
942643666 2:178087854-178087876 CACTGTGATTGAGGAGGAGTGGG - Intronic
943542850 2:189239439-189239461 CACAGTGAGGGAAGGGGACATGG + Intergenic
945385423 2:209193696-209193718 CAGTGTGAGTGTGGGGGTGAGGG - Intergenic
946015851 2:216603232-216603254 CACTGGGAGGGTGGGGGAGGAGG + Intergenic
946182995 2:217960132-217960154 CCCAGTGAGTGGGGGGCAGAAGG + Intronic
946428754 2:219613571-219613593 TGGGGTGAGTGAGGGGGAGATGG + Intronic
946725444 2:222657039-222657061 CACTGGGGGTGAGGGGGTGGAGG + Intergenic
947550478 2:231041877-231041899 CCCTGGGAGTGAGGTGCAGAAGG + Intronic
947821319 2:233073070-233073092 CAGGGTGAGTGAAGGGGGGATGG - Intronic
948093352 2:235314297-235314319 CACTGTGATTGTGGGGGGCATGG - Intergenic
948337724 2:237223743-237223765 CACTGTGAGGGAGGGGGCCTGGG - Intergenic
948850549 2:240703412-240703434 AACTGTGCATGAGGGAGAGAGGG + Intergenic
1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG + Exonic
1169269421 20:4187786-4187808 GCCTTTGAGTGAGAGGGAGAAGG + Intergenic
1169414934 20:5408230-5408252 CACTGTGAGTTGGGGTGAGAGGG + Intergenic
1170382343 20:15775078-15775100 CACTTTGAGGGAGGGGCAAAGGG + Intronic
1170445151 20:16418851-16418873 CACATTGAGGGAGGGGGAAAGGG - Intronic
1170577279 20:17673912-17673934 CACAGTGATTGAGGGGAGGAAGG - Intronic
1170703919 20:18728037-18728059 CATTGTGAGTGTGTGGGATAGGG + Intronic
1171124128 20:22586935-22586957 GACTGGGAGAGCGGGGGAGAAGG - Intergenic
1171483170 20:25468784-25468806 CAGTGAGAGTCAGGGGGACAGGG - Intronic
1171483300 20:25469227-25469249 CAATGAGAGTCAGGGGGACAGGG - Intronic
1172045809 20:32079424-32079446 CGCTGTGAGGGACAGGGAGATGG - Intronic
1172188480 20:33047506-33047528 CACTACGAGTGAGAGGGAGTCGG - Intergenic
1172547206 20:35771454-35771476 CACTGAGAATGTGGGGGAGCTGG + Intergenic
1172650370 20:36497964-36497986 TACAGTGGGTGAGGGCGAGAGGG + Intronic
1173247584 20:41347314-41347336 CAGTGTGAGTGAGGGAGAGATGG + Intronic
1173654348 20:44689713-44689735 CACAGTCAGTGAGGGGGTGAAGG - Intergenic
1174677556 20:52373055-52373077 CAGAGTGTGTGAGGGGAAGAGGG - Intergenic
1175365147 20:58448463-58448485 AACTGTGACTGGGGGGTAGATGG + Exonic
1175607344 20:60321843-60321865 GACTGAGAGTCTGGGGGAGAGGG + Intergenic
1176087320 20:63304043-63304065 CACTGGGAGGGAGGAAGAGAGGG - Intronic
1176223885 20:63983353-63983375 TACTGAGAGTGAGAGGGAGCAGG + Intronic
1177347523 21:19892378-19892400 CACGGTAAGTGAAGGGGAAAGGG - Intergenic
1178275136 21:31230145-31230167 CTCTGTGAGTTAGGGGGTGAGGG - Intronic
1178685208 21:34705335-34705357 AACAGGGAGTGAGGAGGAGATGG + Intronic
1179047623 21:37860619-37860641 CAGTGTGAGTGATGGGGAGAAGG - Intronic
1179129136 21:38618782-38618804 CACTGCTAGTGAGTGGTAGAGGG - Intronic
1179452093 21:41474267-41474289 AAGGGTGAGTGAGGGGGTGAGGG + Intronic
1180092135 21:45538610-45538632 CACAGTGAGGGAAGGGCAGAGGG + Intronic
1181339308 22:22165672-22165694 CTGTGTAAGTGAGGGGCAGAAGG + Intergenic
1181990691 22:26834598-26834620 CAGAGTGAGTGAAGAGGAGATGG - Intergenic
1182851452 22:33478093-33478115 CACTGGGAGAGAGGAGGATAGGG + Intronic
1183456918 22:37927834-37927856 CACTTTTAGTGAGGGTGAGGGGG - Intronic
1183624400 22:38992919-38992941 CTCTGTGAGTGAGGGTGGGCGGG - Intergenic
1184042949 22:41955085-41955107 CACTGAGCGAGAGGCGGAGAAGG - Intergenic
1184539077 22:45107805-45107827 CCTGGTGAGTGAGGGAGAGAGGG - Intergenic
949495374 3:4626682-4626704 CACTGAGAGTGAGGGGACAAGGG + Intronic
949676032 3:6454472-6454494 GACTGAGAGTGAGGTTGAGAAGG + Intergenic
949863910 3:8531695-8531717 CACTGTTAGCTAGGGGGATATGG - Intronic
950021371 3:9789978-9790000 AAGTGTCACTGAGGGGGAGAAGG + Intronic
950153196 3:10704045-10704067 CAGAGGGAGTGAGGGGAAGATGG - Intronic
950708217 3:14796960-14796982 CACTGTGGGGGAGGGGGTGGGGG - Intergenic
950897490 3:16466926-16466948 CACTCTGATTGAAGAGGAGATGG + Intronic
950980963 3:17303987-17304009 CACTGTGAGTGAGGCAGAGTAGG - Intronic
952049698 3:29369531-29369553 CACTTTGAGTGAGGGTGAGGAGG + Intronic
952150016 3:30579000-30579022 CACTTTGAGGGAGGGGTAAAGGG - Intergenic
952512578 3:34071972-34071994 CGCTGTCAGTGGGAGGGAGATGG + Intergenic
952649680 3:35710200-35710222 GAGTGTGAGAGAGAGGGAGATGG + Intronic
952668375 3:35935594-35935616 CAGAGGCAGTGAGGGGGAGAGGG - Intergenic
953548137 3:43879448-43879470 CACAGTGTGTGGGTGGGAGAAGG - Intergenic
953691134 3:45120696-45120718 CACAGTGACTAAGGTGGAGAGGG - Intronic
954593089 3:51800932-51800954 CAGAGTAAGGGAGGGGGAGAGGG + Intergenic
954993765 3:54863609-54863631 CACTGTGTGTGGGGAGGAGGCGG - Intronic
955472520 3:59300734-59300756 CCCTGTGAGTGTTGGGGAGGTGG + Intergenic
955674732 3:61435724-61435746 GACTGAGAGGGAGAGGGAGAGGG + Intergenic
956272796 3:67465642-67465664 GACTCTGAGTGAAGGAGAGAGGG - Intronic
956869461 3:73402555-73402577 CACTGTGAGTGAATGTGAGACGG + Intronic
957942127 3:87018626-87018648 ACCTGAAAGTGAGGGGGAGAAGG + Intergenic
958922514 3:100122670-100122692 CATTTTGAATAAGGGGGAGAGGG - Intronic
959377252 3:105602206-105602228 CACTGTGGGTGATGGTGAGTGGG + Intergenic
959687913 3:109167726-109167748 CACAGAGAGAGAGGGAGAGAGGG + Intergenic
961382508 3:126505055-126505077 CACGGTGAGAGAGGGAGAGCAGG - Intronic
961962246 3:130867322-130867344 GACCGTGAGGGAGAGGGAGAGGG - Intronic
962080713 3:132136512-132136534 CACTGTCAGTGACGGGGAAGAGG - Intronic
962209853 3:133468216-133468238 AAATGTGAGGGAGGGGCAGATGG + Intronic
962702606 3:138014042-138014064 AACAGTGGGTGAGGGAGAGAGGG + Intronic
962855317 3:139339879-139339901 CACTCTGAGTGAGAGGGAAGGGG + Intronic
964584465 3:158281444-158281466 TGCTGTGTGTGAGGGTGAGATGG + Intronic
964757145 3:160098563-160098585 CAGGGTGAGGGAGGAGGAGATGG - Intergenic
965672261 3:171158973-171158995 CAGAGTGAATGAGAGGGAGAAGG + Intronic
965933243 3:174072683-174072705 CACAGTGAGTGACAGAGAGAAGG + Intronic
966665924 3:182471058-182471080 CACTGGGAATGATGGTGAGAGGG - Intergenic
967099641 3:186205790-186205812 AATTCTGAGTGAGGGGGAGTTGG + Intronic
967100319 3:186210616-186210638 CCCTGTGAGTGAGGAGCACAGGG + Intronic
967123274 3:186402640-186402662 TATTGTGATTGATGGGGAGAGGG + Intergenic
967226008 3:187291812-187291834 CAGAGGGAGAGAGGGGGAGAGGG - Exonic
967450258 3:189615198-189615220 TAGAGTGAGTGAGAGGGAGATGG - Intergenic
968279754 3:197467596-197467618 GAGTGTGAGTGAGAGAGAGAAGG + Intergenic
968283866 3:197496827-197496849 CACTGTAAGAGATGGGGGGAGGG - Intergenic
970231288 4:13913718-13913740 CACTGAGAGAGCGGGGCAGAGGG - Intergenic
970246427 4:14069163-14069185 AACTGGGAGGGAGGGAGAGAGGG + Intergenic
970553562 4:17208773-17208795 GACTGTGAGAGAAGTGGAGAGGG - Intergenic
970769370 4:19592138-19592160 CACTGAGAGAGAGAGAGAGAGGG + Intergenic
971418590 4:26455587-26455609 GTCTGGGAGTGATGGGGAGAGGG + Intergenic
971489371 4:27194837-27194859 CAGAGTGGGTGAAGGGGAGATGG + Intergenic
971691473 4:29841896-29841918 CACCCTCAGTGAAGGGGAGATGG + Intergenic
972055330 4:34795301-34795323 CACTGTGGGAGAGGTGGGGATGG - Intergenic
972306687 4:37837459-37837481 GACTGTGAGTGATGGAAAGAAGG - Intronic
972770413 4:42192282-42192304 AACAGTGAGTGAGGGGCAGGGGG - Intergenic
972924021 4:43981566-43981588 CAGTGTGGGAGAGGGAGAGAAGG - Intergenic
973021038 4:45206880-45206902 GACCGTGAGGGAGAGGGAGAGGG - Intergenic
974505600 4:62767084-62767106 CACTGTGACTGAGTGGTACATGG + Intergenic
977216252 4:94287325-94287347 CACTGTGAGAGATGGAAAGAAGG - Intronic
978067594 4:104424737-104424759 CAGTGTCAGTGAGAGGGGGAGGG + Intergenic
978266522 4:106833061-106833083 CGCTGAGAGTGAGGAGGTGAAGG + Intergenic
978392678 4:108243438-108243460 CAGAGTGAGTGAGGGGTAAATGG + Intergenic
979385965 4:120066307-120066329 CACTTTGAGTGGGAGGGTGAGGG + Intronic
981024492 4:140063473-140063495 CACAGTGAGTGTGTGGGAGGAGG - Intronic
981650206 4:147048798-147048820 CATAGTGAGTGAGCAGGAGAGGG - Intergenic
983250980 4:165346169-165346191 AACTCTGAGTGAGGGAGAGTGGG - Intergenic
983867439 4:172785665-172785687 CACAGAGAGTGATGGGGAGATGG + Intronic
984067946 4:175072913-175072935 CACAGTGTGTGAGGGGGTGTGGG + Intergenic
984199379 4:176698580-176698602 TACTGTGTGTGTGGGGGAGTTGG + Intronic
984275953 4:177609586-177609608 AATTGTGAGTGAAGGGGAGTAGG + Intergenic
985361384 4:189179301-189179323 CACATTGATTGAGGGGGAGATGG + Intergenic
985910240 5:2873842-2873864 GACAGAGAGTGAAGGGGAGAAGG + Intergenic
985949368 5:3211458-3211480 AGCTTTGAGTGAGGGAGAGAAGG + Intergenic
986571276 5:9168519-9168541 CCATGTGGGTGAGGGGGAGGAGG + Intronic
986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG + Intronic
987066816 5:14297854-14297876 CACTGTGGCTGAGGAGGAGCTGG - Intronic
987171516 5:15263959-15263981 CACTCTGAGTGAGGGAGACAGGG - Intergenic
988760869 5:34307751-34307773 GACTGAGAGGGAGAGGGAGAGGG + Intergenic
989017157 5:36951102-36951124 CACTGGGAGTAAAGGGGAAAGGG - Intronic
989765295 5:45075783-45075805 AACTGTGAGTGAGGATGAGAGGG + Intergenic
990796289 5:59544688-59544710 CACAGTGAGTAGTGGGGAGAAGG + Intronic
990891197 5:60652054-60652076 CACTTTGAGGGAGGGGTAAAGGG + Intronic
991375271 5:65958652-65958674 GACCGTGAGGGAGGGGGAGGGGG + Intronic
992084918 5:73269826-73269848 CTTTAAGAGTGAGGGGGAGAGGG - Intergenic
992115409 5:73534342-73534364 CACTTTGAGGGAGGGGCAAAGGG + Intergenic
992244516 5:74806153-74806175 GACTGGGAGTGGGAGGGAGAAGG + Intronic
992728941 5:79638591-79638613 TTTGGTGAGTGAGGGGGAGAAGG + Intronic
992792759 5:80228216-80228238 CAGAGTGAGTGAGGGAGGGAGGG + Intronic
993177255 5:84502726-84502748 CAATTTGACTGAGGGGCAGAAGG + Intergenic
993353281 5:86876156-86876178 CACTTTGAGGGAGGGGCAAAAGG + Intergenic
994109368 5:95983215-95983237 CTCTGAGAGAGAGGGTGAGAGGG + Intergenic
994353737 5:98773471-98773493 CACTGAGCGGGCGGGGGAGAGGG + Intronic
995557214 5:113341979-113342001 AAGTGTGAGTGGGGGGGTGAGGG - Intronic
995716675 5:115087491-115087513 CACTGGAAGTGATGGTGAGAGGG - Intergenic
995759773 5:115551010-115551032 CACTTTGAGTGAGGGGAGTAGGG - Intergenic
996387722 5:122926290-122926312 CAGGGTGAGTGAGAGGGAGTAGG + Intronic
997137090 5:131337937-131337959 CACTGTGCGTGAGCGGAAGCAGG - Intronic
997523094 5:134535682-134535704 CTCTGTGGGTGGGTGGGAGAGGG + Intronic
997737483 5:136224739-136224761 CACTGTCAGGATGGGGGAGAGGG - Intronic
997943903 5:138182525-138182547 GACTCTGAGTTAGGGGGAGAAGG + Intronic
997989976 5:138536534-138536556 CTATCTTAGTGAGGGGGAGAAGG - Intronic
998417405 5:141955832-141955854 CATTGGGAGTGAGTGGGAGCTGG - Exonic
998693027 5:144608617-144608639 CAATGTGTGTGAAGGCGAGAAGG - Intergenic
999652093 5:153777681-153777703 CAGTGTGTGTGAGGGGGATGAGG - Intronic
999949978 5:156638249-156638271 ACCTGGGAGTGAGGGTGAGATGG - Intronic
1000046482 5:157525831-157525853 TTCTGTGAGAGAGGGAGAGAGGG - Intronic
1000563136 5:162814915-162814937 GACAGTGAGTGAGAGAGAGAGGG - Intergenic
1000723337 5:164736004-164736026 CACTGGTATTCAGGGGGAGAAGG + Intergenic
1000958725 5:167573522-167573544 CAGAGAGAGAGAGGGGGAGAGGG - Intronic
1001110689 5:168893708-168893730 TCTTGTGAGTGAGGGGGAGGTGG + Intronic
1001707579 5:173752753-173752775 CACTGTGAGTGAGGCAGACAAGG + Intergenic
1001948275 5:175797692-175797714 CCCGGGGAGTGAGGGAGAGAGGG - Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002341167 5:178517405-178517427 CACTGTTAGTGACAGGGACATGG - Intronic
1002376159 5:178790519-178790541 CACTGGCAGTGAGAGGGAGCCGG - Intergenic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003571421 6:7258744-7258766 GACTGTGAGTGAGGGCAGGAGGG + Intergenic
1003616680 6:7660771-7660793 CACAGTGAGTGAGGTAGAAATGG - Intergenic
1004057426 6:12154187-12154209 CACTGTGGGTGAAGAAGAGAAGG - Intronic
1004395727 6:15245377-15245399 CACGGCCAGTGAGGGGGAGGGGG + Intergenic
1004431961 6:15553271-15553293 CACTTTGAGGGAGGGGCAGAGGG + Intronic
1004432096 6:15554595-15554617 CACTTTGAGGGAGGGGCAGAGGG + Intronic
1005268556 6:24139117-24139139 AACTGGGAGGGAGTGGGAGAGGG - Intronic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1006084309 6:31585597-31585619 CACTGTGATGGAGAAGGAGATGG - Intergenic
1006286313 6:33097134-33097156 CACTGTGAGGGATGGGGCGGAGG - Intergenic
1006434361 6:34018581-34018603 TATTGCGAGTGAGGGGGGGAAGG - Intergenic
1006520863 6:34570360-34570382 CTATGTGAGTGAGGGAGCGAGGG - Intergenic
1006646715 6:35520005-35520027 CAGTGTGAGTGAGTGGGATTCGG + Intergenic
1007253870 6:40515185-40515207 CACTCTGAGTAAAGGGGGGAAGG + Intronic
1008726635 6:54429555-54429577 CACAGTGAGTGAGCAGGAGGAGG - Intergenic
1008813998 6:55540760-55540782 CAGTGAGATTGAGGTGGAGATGG + Intronic
1008869930 6:56261155-56261177 CAGAGTGAGGGAGAGGGAGAGGG - Intronic
1009760664 6:68001332-68001354 CAGTGGGAGTGAGGAGGAGGTGG - Intergenic
1009943568 6:70317722-70317744 CACTGTGCGTGAGCCGAAGAAGG + Intergenic
1010281772 6:74030638-74030660 CACTGTGAGTGAGCCGAAGTAGG - Intergenic
1011574774 6:88784276-88784298 CACTGTGAATGAGACAGAGATGG + Intronic
1012026695 6:94003658-94003680 AAATGTGAGTGTGAGGGAGATGG + Intergenic
1013976575 6:116085738-116085760 CACAGAGAGAGAGGGAGAGATGG + Intergenic
1015185118 6:130407153-130407175 CTATGTGAATGAGGGGGTGAGGG + Intronic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1015897022 6:138027341-138027363 CACTGAGAGGGATGGGGAGAAGG - Intergenic
1016540093 6:145154682-145154704 CTGTGTGAGTGAGGGTGGGAGGG + Intergenic
1016948792 6:149560540-149560562 TAAGGTGAGTGAGGGGGAAAGGG + Intergenic
1017274437 6:152549472-152549494 CAGAGTGAGGGAGGAGGAGAAGG - Intronic
1017712813 6:157185113-157185135 CTCTGTCAGTGGGGAGGAGAGGG - Intronic
1017757094 6:157538935-157538957 CAGTGAGAGAGAGGGAGAGAAGG + Intronic
1017963019 6:159238734-159238756 CATTATAAATGAGGGGGAGAAGG - Intronic
1018298605 6:162376697-162376719 CACGGAGAGAGAGGGGGAAAGGG + Intronic
1018764794 6:166925008-166925030 CACTGTGGGTGAGGGCTGGATGG - Intronic
1019106472 6:169671657-169671679 CGCTGAGGGTGAGGGTGAGAAGG - Intronic
1019128580 6:169857682-169857704 GACTGAGAGGGAGAGGGAGAGGG + Intergenic
1019133255 6:169892590-169892612 CACTGTGAGCCTGGTGGAGAGGG + Intergenic
1019133262 6:169892650-169892672 CACTGTGAGCGTCGTGGAGAAGG + Intergenic
1019486207 7:1290578-1290600 CACTGTGAAGTAGGGGGAGGGGG - Intergenic
1019711765 7:2521176-2521198 CACTGTGGGTGGGTGGGAGCAGG + Intronic
1020090112 7:5333988-5334010 GAGTGTGAGTGAGGCGTAGATGG + Intronic
1022937504 7:35194077-35194099 GACTGCCAGTGTGGGGGAGAGGG - Intergenic
1022939468 7:35219207-35219229 CACTGTGGGTCAGTGGGAGCAGG + Intronic
1022950082 7:35330300-35330322 CACTGGGAGAGAGGGGGAAATGG - Intergenic
1023219403 7:37903499-37903521 CACCCTGAGTGAAGGAGAGAGGG - Intronic
1023885369 7:44350071-44350093 CATTGTGAGGGGTGGGGAGAAGG - Intergenic
1024449726 7:49525393-49525415 CACTGTGAGAGAAGAGGAGAAGG + Intergenic
1024695031 7:51847101-51847123 CCATGTGAGTGAGCTGGAGAGGG - Intergenic
1026246330 7:68623220-68623242 GTCTGTGACAGAGGGGGAGAAGG - Intergenic
1026374247 7:69734477-69734499 CACTGGGATTGAGGGGGATGAGG + Intronic
1027219149 7:76202795-76202817 CCCTGGGAGGGAGGGGGAGGCGG - Intronic
1028372626 7:90111524-90111546 GACTGCCAGTGTGGGGGAGAGGG + Intergenic
1029833667 7:103286720-103286742 GACTGCCAGTGTGGGGGAGAGGG - Intergenic
1030082819 7:105792091-105792113 GACTGTGGGGGTGGGGGAGACGG - Intronic
1030105366 7:105982556-105982578 CACAGGGACTGAGGGGGAGAAGG - Intronic
1030139250 7:106287899-106287921 CACTCTGAGGGAGGGAGACAAGG - Intergenic
1030164583 7:106540974-106540996 CAGTGTGAGTGAGTGTGGGATGG - Intergenic
1030654168 7:112147995-112148017 CAGTGGGAGTGTGGAGGAGAGGG - Intronic
1032655811 7:133928618-133928640 GACTGTGAGTGAGGGGAGGAGGG - Intronic
1033238321 7:139656107-139656129 CAGAGTGAGGGAGTGGGAGAAGG - Intronic
1033616245 7:143017176-143017198 CTCTGTGAGTGAGGATGAGTGGG - Intergenic
1034221684 7:149451267-149451289 CACTGTGGGTGTGGGGGTGTGGG + Intronic
1034268364 7:149791796-149791818 CACTGTGAGGCAGGGGGACAGGG - Intergenic
1034493835 7:151408847-151408869 CACAGCCAGTGAGGGGTAGATGG - Intronic
1034682373 7:152938981-152939003 CACTGGGAGGGAGGGAGGGAGGG - Intergenic
1035374703 7:158400323-158400345 CAGCCTGAGTGTGGGGGAGATGG - Intronic
1035650026 8:1257197-1257219 CTCTGTGGGTGAGCGGGAGAGGG - Intergenic
1036452969 8:8884572-8884594 CACTGTGAGGGGGAGGGAGTTGG + Intronic
1036502743 8:9328690-9328712 CAGTGAGAGTGAGAGAGAGAGGG + Intergenic
1036562333 8:9907291-9907313 GAGAGTGAGTGAGGGAGAGAGGG + Intergenic
1036571309 8:9982097-9982119 CACTGAGAGAGAGGGAGATACGG - Intergenic
1037506668 8:19537531-19537553 CACTTTGAGTGAGGGGTAAAGGG - Intronic
1037833768 8:22204336-22204358 CACTATGACTGGTGGGGAGAAGG - Intronic
1037921736 8:22811489-22811511 GACTGTGAGTGATAAGGAGATGG + Intronic
1037930653 8:22878208-22878230 CATGGAGAGGGAGGGGGAGAGGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038117073 8:24569057-24569079 CACTGTCAGTGAAGGGGAATAGG - Intergenic
1038406600 8:27326711-27326733 CACTCTGGGGGAGGGGGAGGAGG + Intronic
1038605779 8:29002301-29002323 CAGTGGGAGAGAGGGAGAGAGGG + Intronic
1038669281 8:29569425-29569447 TTCTGAGAGTGAGGGGGAAAGGG - Intergenic
1039868987 8:41529446-41529468 CACTGAGAGGGAGGAGGGGAGGG + Intronic
1040493556 8:47946857-47946879 GACTGTGAGTGAGGGACTGAGGG - Intronic
1040640264 8:49325775-49325797 AATTGAGAGTGAGGGAGAGAGGG + Intergenic
1041123378 8:54609661-54609683 GGGTGTGAGTGAGGGGGAGGAGG - Intergenic
1041191621 8:55361248-55361270 CACTAGGAGAGAGGCGGAGAGGG + Intronic
1041729312 8:61048822-61048844 AACAGTGAGGGAGGGGAAGAGGG - Intergenic
1041821095 8:62033634-62033656 CAGTGTGAGTGAGTGGGATGTGG + Intergenic
1042216844 8:66436430-66436452 CAGAGTGAATAAGGGGGAGATGG + Intronic
1042961545 8:74308879-74308901 CACTCTGAGTATGGGGGAGGAGG + Intronic
1044857616 8:96493051-96493073 AACTGTGTGTGAGGGAGAAATGG + Intergenic
1045443864 8:102239895-102239917 GCGGGTGAGTGAGGGGGAGAGGG + Intergenic
1045777732 8:105825439-105825461 CAGAATGAGTGAGTGGGAGAAGG - Intergenic
1046081624 8:109376468-109376490 CACTGTGAGTGAGCCGAAGCAGG - Intronic
1046666111 8:117005178-117005200 AACTGGGAGTCAGAGGGAGAGGG - Intronic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1048196911 8:132338900-132338922 CAACGTGGGTCAGGGGGAGAGGG + Intronic
1048391859 8:133974508-133974530 CACTGTGAGGGAAGAGGGGAGGG - Intergenic
1048534775 8:135283120-135283142 TACTGTGAGTAAGGGGAAAATGG + Intergenic
1048570025 8:135644637-135644659 CACTGTGGGAGTGGGGGAGGAGG - Intronic
1048987570 8:139743002-139743024 CACTCTGAGTGAGGCAGACATGG - Intronic
1049201040 8:141340804-141340826 CAATGGGAGTGGGGGAGAGATGG + Intergenic
1049321297 8:141997940-141997962 ACCTCTGAGTGAGGAGGAGAAGG + Intergenic
1050571268 9:6941614-6941636 AACTGAGAGTGAGAGGGAAATGG + Intronic
1053350411 9:37410321-37410343 CAGAGTGAGGGAGGGGGAGAAGG + Intergenic
1053646613 9:40123687-40123709 CACAGTGAGAAAGGGGAAGAGGG + Intergenic
1054537958 9:66252286-66252308 CACAGTGAGAAAGGGGAAGAGGG - Intergenic
1054858188 9:69923712-69923734 CACTGGGAGCTAGAGGGAGAGGG - Intergenic
1055463213 9:76538590-76538612 CACAGTGAGAGAGGGAGAGATGG - Intergenic
1055580732 9:77703834-77703856 CAAAGTGAGGGAGAGGGAGAGGG + Intergenic
1056144113 9:83712250-83712272 GACTGGGGGTCAGGGGGAGATGG - Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1056814387 9:89791177-89791199 CCCGGTGAGTGAGGTGGAGTGGG + Intergenic
1056840419 9:89994375-89994397 CACTGTCGGGGAGGGGCAGAGGG + Intergenic
1057826424 9:98375749-98375771 CATTCTGATGGAGGGGGAGAAGG - Intronic
1058660131 9:107258509-107258531 GACGGAGAGTGAGAGGGAGACGG + Intergenic
1058687400 9:107490274-107490296 CGCAGAGAGGGAGGGGGAGATGG - Intronic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059660334 9:116393834-116393856 CACTGAGAGTGAGGAGGAGAAGG + Intronic
1059870527 9:118568842-118568864 CACTGTGACTGAGTGGGAGGAGG - Intergenic
1060275287 9:122177881-122177903 CTCTGTGGGAGAAGGGGAGAGGG - Intronic
1060280411 9:122212317-122212339 CACTGTAAGTTAGTGGGAGCCGG - Intronic
1060559796 9:124533563-124533585 AACTGGGTGGGAGGGGGAGATGG + Intronic
1061044969 9:128160110-128160132 GACTGTGAGGGAGGTGGAGGCGG + Intergenic
1061068332 9:128293211-128293233 CACAGTGAGTCAGGGGCAGCTGG + Intergenic
1061196056 9:129107915-129107937 CATCGTGAGTGAGGAGGAGTGGG - Exonic
1187029368 X:15469918-15469940 CACAGTAAGTGAGTGGCAGAAGG + Intronic
1188947723 X:36327943-36327965 CACTGTGAGGGTGGGAGGGAAGG + Intronic
1189622957 X:42863123-42863145 AACTGTGAGGGAGGGGGTCAAGG - Intergenic
1190214558 X:48470794-48470816 CTCTGTGAGTGATGGCGAGTTGG - Intergenic
1190366070 X:49695850-49695872 AAGTGTGAGTGAGGGTGAGGAGG - Exonic
1190545180 X:51518169-51518191 CACTGTGAGCGAGCCGAAGAGGG - Intergenic
1190630428 X:52380745-52380767 CAGTGTGAGTGAGTGTGAGGAGG + Intergenic
1190681425 X:52830102-52830124 AAGTGTGAGTGAGGGTGAGGAGG - Intergenic
1190998517 X:55636142-55636164 AAGTGTGAGTGAGGGTGAGGAGG - Intergenic
1192210793 X:69126572-69126594 CACTGTGGGTGGGGGGCAGGGGG - Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1193954657 X:87844686-87844708 CACTGTGAGGGATGGGGGGTGGG + Intergenic
1194475952 X:94360268-94360290 GACTGGAAGTGTGGGGGAGAAGG - Intergenic
1194761150 X:97797567-97797589 CACTTTGAGAGAGGGGCAAAGGG - Intergenic
1195274974 X:103273186-103273208 TACTGTTAGTGCAGGGGAGAGGG + Intergenic
1196155399 X:112423102-112423124 CATTGTGTGTGGGGGGGGGATGG + Intergenic
1196741851 X:119032102-119032124 GCTTTTGAGTGAGGGGGAGAGGG + Intergenic
1198153436 X:133933684-133933706 GAGAGAGAGTGAGGGGGAGAAGG - Intronic
1199234172 X:145471726-145471748 CACGGTACGTGAGGGAGAGAGGG - Intergenic
1199570408 X:149261840-149261862 CACTGTGAGTGACAGAGAGAAGG - Intergenic
1200001244 X:153060867-153060889 CTCTGTGAGTGTGTGTGAGATGG + Intergenic
1201739974 Y:17313151-17313173 AACTGAAAGTGACGGGGAGAAGG + Intergenic