ID: 1073338669

View in Genome Browser
Species Human (GRCh38)
Location 10:102729236-102729258
Sequence GCTTCAGGGAGAAAGTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073338669_1073338679 4 Left 1073338669 10:102729236-102729258 CCAGCCGACTTTCTCCCTGAAGC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1073338679 10:102729263-102729285 GGTTTGGCCCTCAGCCGGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 87
1073338669_1073338676 -1 Left 1073338669 10:102729236-102729258 CCAGCCGACTTTCTCCCTGAAGC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1073338676 10:102729258-102729280 CCCGTGGTTTGGCCCTCAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1073338669_1073338680 5 Left 1073338669 10:102729236-102729258 CCAGCCGACTTTCTCCCTGAAGC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1073338680 10:102729264-102729286 GTTTGGCCCTCAGCCGGCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 110
1073338669_1073338678 3 Left 1073338669 10:102729236-102729258 CCAGCCGACTTTCTCCCTGAAGC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1073338678 10:102729262-102729284 TGGTTTGGCCCTCAGCCGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073338669 Original CRISPR GCTTCAGGGAGAAAGTCGGC TGG (reversed) Intronic
901312022 1:8276672-8276694 GCTGCAGTGTGAAAGCCGGCAGG - Intergenic
901761599 1:11475299-11475321 GCTTCAGGGAGGAAGGCGCTGGG + Intergenic
902244558 1:15111944-15111966 GCTTCAGGCAGAAAGCCAGGTGG + Intronic
902747956 1:18485650-18485672 GCTTCAGGAAGAATGTGGTCAGG + Exonic
903830908 1:26173875-26173897 GGTTCAGGGAGAGAGGGGGCTGG + Intergenic
906048159 1:42848484-42848506 GCATAAAGGAGAAAGTAGGCAGG + Intronic
906109398 1:43312948-43312970 GCTTGAGGGTGAAAGTGGCCTGG + Intronic
907459654 1:54597844-54597866 GCTTTATGGAGGAAGTGGGCAGG - Intronic
910388068 1:86705458-86705480 CTTTCAGGGAGAAAGAGGGCCGG - Intronic
913110114 1:115649967-115649989 GCATCAGGGACAAAGGAGGCTGG + Intronic
917691358 1:177472769-177472791 GCTGGAGGGAGAAGGTGGGCAGG + Intergenic
918192802 1:182192273-182192295 GCTTCACGGAGGAAGTCAGGTGG + Intergenic
1070610114 10:77926948-77926970 ACTCCCGGGAGAAAGTCGCCTGG + Intergenic
1073338669 10:102729236-102729258 GCTTCAGGGAGAAAGTCGGCTGG - Intronic
1073385330 10:103122635-103122657 CCTTCAGGGAAGAAGTCGGGAGG - Intronic
1076589811 10:131575216-131575238 GGCTGAGGGAGAAAGCCGGCAGG + Intergenic
1080658038 11:34273412-34273434 GCTTCAGAGAGTAAGCTGGCAGG + Intronic
1083366725 11:62145768-62145790 GCCTCAGGGAGGAGGTGGGCGGG + Intronic
1085445510 11:76598286-76598308 GAGTCAGGGAGGAAGTGGGCAGG - Intergenic
1088053021 11:105541672-105541694 GCCTCAGGGAGGAAGTTGGCGGG - Intergenic
1092223207 12:6729503-6729525 GCTTCAGGGTGAGAGAGGGCAGG + Intronic
1093965472 12:25320188-25320210 TCCTCAGGGGGAAAGTTGGCTGG - Intergenic
1097468632 12:59959551-59959573 GCTTCAGGGAGAAAGAGGTTAGG - Intergenic
1103284631 12:119790251-119790273 TCTTCAAGCAGCAAGTCGGCTGG + Intronic
1105891508 13:24685612-24685634 GCCTCAAGGAGAAAGTGGCCGGG + Intronic
1106895408 13:34294968-34294990 TGTGCAGGGAGCAAGTCGGCAGG - Intergenic
1108495997 13:51025999-51026021 GCATCTGGGAGAAGGTCTGCAGG - Intergenic
1110177576 13:72575248-72575270 GCTTCAGGGACACTTTCGGCTGG - Intergenic
1113580646 13:111426246-111426268 CCTTCAGGGAGAAAGCCCTCTGG - Intergenic
1114616080 14:24069153-24069175 GCTTCAGGGGGGCAGTCCGCCGG - Exonic
1118154770 14:63228876-63228898 GCTTCTGGAAGAAACTCGGAAGG - Intronic
1118397071 14:65346895-65346917 GCTTCACAGAGAAAGTTGACGGG + Intergenic
1123058680 14:105584539-105584561 ACTTCAGGGAGAGACTTGGCAGG + Intergenic
1123083007 14:105704765-105704787 ACTTCAGGGAGAGACTTGGCAGG + Intergenic
1128156247 15:65393753-65393775 GCTGCAGGGAGAATGATGGCAGG + Intronic
1128737620 15:70062107-70062129 GCTTCGGGCAGAAACTTGGCCGG - Intronic
1128834487 15:70798161-70798183 CCTCCAGGGAGAATGGCGGCTGG + Intergenic
1132655555 16:1040483-1040505 ACTTCGGGGAGAACCTCGGCGGG - Intergenic
1132892394 16:2210690-2210712 ACATCAGGGAGCAAGTGGGCTGG + Intronic
1134683921 16:16145712-16145734 GATGCAGGGAGAAAGTGGGGTGG - Intergenic
1134825693 16:17282376-17282398 GCTTCAGGGAGCAAGTGAGCAGG + Intronic
1137547517 16:49414773-49414795 GCTTCAAGGAGGAAGCCGCCAGG - Intergenic
1138157138 16:54716263-54716285 GCTTCAGGGAGGAAGGAAGCTGG - Intergenic
1140658203 16:77162187-77162209 GCCTCAGGGAGAAACCTGGCAGG - Intergenic
1143528496 17:7486037-7486059 CCTACAGGGTGAAAGGCGGCCGG + Intronic
1144948808 17:18983148-18983170 GCTACTGGGAGACAGTGGGCAGG - Intronic
1153601423 18:6784358-6784380 GCTTTAGGGAGCAAGTAGCCAGG + Intronic
1156068394 18:33174163-33174185 GCAACAGAGAGAGAGTCGGCAGG + Intronic
1156409556 18:36814914-36814936 GTTTCAGGGATAGAGTCTGCAGG + Intronic
1156409721 18:36816320-36816342 GTTTCAGGGATAGAGTCTGCAGG - Intronic
1157559609 18:48637218-48637240 GCAGCAGGGAGAAAGGTGGCAGG - Intronic
1160546457 18:79659869-79659891 GCTTCAGGGAGTATCACGGCTGG + Intergenic
1161242222 19:3228758-3228780 GCTCCAGGGAGAAGGCGGGCTGG + Intronic
1161942952 19:7417245-7417267 GCTTCACTGAGAAGGTGGGCAGG + Intronic
1163404200 19:17112425-17112447 GCTTCAGGGAGCAGGGCGGACGG + Intronic
1164734732 19:30532457-30532479 GCTTCAGGATGAAGGTAGGCAGG - Intronic
1165039529 19:33059230-33059252 GATTCAGGGAGAAGGTGAGCTGG - Intronic
1167521388 19:49958237-49958259 GGTTCAGGGAGAAAGGAGACAGG - Intronic
1167779667 19:51590869-51590891 GTTTCAGGGAGGAAGGTGGCAGG + Exonic
1168260557 19:55191667-55191689 TCTTCAGGAAGAAAATCAGCAGG + Exonic
926698201 2:15785158-15785180 GCTTCAGGGAGGAAGGCTGCGGG + Intergenic
929613917 2:43293176-43293198 GCTTCTGGGAGGAAGTCAGAGGG - Exonic
930527260 2:52545600-52545622 ACTTCAGGGAAAAATCCGGCCGG + Intergenic
931868407 2:66434852-66434874 GCTTTGGGGAGAGAGTCTGCAGG + Intronic
935466847 2:103408802-103408824 GAATCACAGAGAAAGTCGGCAGG - Intergenic
935804645 2:106733611-106733633 ACTTCAGGCAAAAAGTAGGCTGG - Intergenic
938796219 2:134719579-134719601 GCTCCAGGGAGAAACTGGGAGGG - Intergenic
939048318 2:137276719-137276741 CCTTCAGTGAGAAAGTGGTCAGG - Intronic
941543857 2:166820644-166820666 GCTTCTGGGAGGAAATAGGCTGG + Intergenic
946273431 2:218612834-218612856 CCTTCAGGGAGAATGTGGGGGGG - Intronic
946400576 2:219466345-219466367 CCTTCAGGGAGAGACTCGGGGGG - Intronic
1168874892 20:1164622-1164644 GCTCCAGGGAGAAATCAGGCAGG - Intronic
1169861377 20:10156405-10156427 GATTCAGGGAGAACATGGGCAGG + Intergenic
1171414501 20:24968475-24968497 TCCTCAGGGAAAGAGTCGGCAGG - Intronic
1171983444 20:31643168-31643190 GCTTCAGGCAAACAGTTGGCTGG - Intronic
1174062815 20:47844502-47844524 GCTACAGGGAGACATTCAGCAGG - Intergenic
1174072904 20:47911168-47911190 GCTACAGGGAGACATTCAGCAGG + Intergenic
1174151170 20:48487498-48487520 GCTACAGGGAGACATTCAGCAGG - Intergenic
1174656835 20:52178717-52178739 GCTTTTGGGAGAAAGACGGTGGG - Intronic
1175916130 20:62426919-62426941 GCCTCAGGGAGCCAGCCGGCAGG - Intronic
1183499912 22:38172756-38172778 GATTGAGGGAGAAAGTCACCAGG + Intronic
1184187047 22:42871856-42871878 GCTGCTGGGAGCAAGGCGGCCGG - Intronic
1184555475 22:45230407-45230429 GCTTCAGGGAGAAGGGCAGAGGG - Intronic
949310521 3:2692377-2692399 TCATCAAGGAGAAAGTAGGCTGG - Intronic
953497439 3:43400388-43400410 GCTACATAGAGAAAGTCGACTGG + Intronic
954159677 3:48712019-48712041 GCATCAGAGTGAAAGTGGGCAGG + Intronic
959594753 3:108117659-108117681 GCTTCAGTGAGAAAATTGGCTGG + Intergenic
962087287 3:132205042-132205064 GCTTCAGGCTGAAAGTTGGCTGG + Intronic
964011346 3:151895619-151895641 GCTTAAAGGAGAAACTCAGCAGG - Intergenic
968548225 4:1209418-1209440 GCTTGGGGGAGACAGTTGGCAGG + Intergenic
969946340 4:10787155-10787177 GCTTCAGGGAGAGCCTTGGCAGG + Intergenic
973792937 4:54395023-54395045 GCTTGAGGAAGAAAGACGGAGGG - Intergenic
978577718 4:110202797-110202819 GCTTCAGGCTGAGAGTGGGCAGG + Intergenic
978729532 4:112009275-112009297 GGTTCAGGGAGAGAGTCTGAAGG + Intergenic
981403257 4:144338920-144338942 GCTTCAGGGAGAAAGGAGAGAGG - Intergenic
990116940 5:52401270-52401292 TCTTCTGGGAGAAAATTGGCAGG - Intergenic
992136723 5:73753296-73753318 GGTTCAGGTAAAAAGTGGGCAGG - Intronic
993733293 5:91447262-91447284 TCTTCAGGGAGGAAGGTGGCTGG + Intergenic
994010597 5:94897659-94897681 GTTTGGGGGAAAAAGTCGGCTGG - Intronic
997582597 5:135027188-135027210 GCATTAGGGAGAAAGGCAGCGGG + Intergenic
998098529 5:139412555-139412577 GTTTCTGGTAGAGAGTCGGCCGG - Exonic
999775335 5:154808386-154808408 GCTTCAGGGAGAAAGGATCCTGG - Intronic
1000275808 5:159733723-159733745 GCTTCAGGGTGAAAGGTGGGAGG - Intergenic
1000674392 5:164103566-164103588 GGTTCAGGGACAATGTCGGCAGG - Intergenic
1006305023 6:33213611-33213633 GCTTTAGGGGGAAACACGGCCGG - Intergenic
1006390443 6:33755132-33755154 GTGTGAGGGAGAAAGTCTGCAGG - Intergenic
1006928428 6:37672502-37672524 CCTTCAGGGAAAGAGTCTGCAGG + Intronic
1007341127 6:41192183-41192205 GCATCAGGGAGAAAGTCCCGAGG - Exonic
1011403374 6:86989189-86989211 GCTTCAGGGAGAAGGACATCTGG - Intronic
1013463243 6:110395531-110395553 GTTTCAGGGAGAAACTGGGAAGG + Intronic
1014187011 6:118446074-118446096 GTTACAGGGAGAAAGTAGGGAGG + Intergenic
1014971711 6:127824421-127824443 GCTGCAGTGAAAAAGTTGGCAGG + Intronic
1018449169 6:163890614-163890636 GCTCCCGAGGGAAAGTCGGCTGG + Intergenic
1019281087 7:200580-200602 GCATCAGAAGGAAAGTCGGCAGG - Intronic
1021850593 7:24804358-24804380 ACTGCAGAGAGAAAGGCGGCGGG - Exonic
1023543869 7:41296661-41296683 GTATCAGGGAGAAAATGGGCTGG - Intergenic
1025839715 7:65134415-65134437 GCCTCAGGGAGAGACTAGGCTGG + Intergenic
1025883350 7:65561550-65561572 GCCTCAGGGAGAGACTAGGCTGG - Intergenic
1025890095 7:65641056-65641078 GCCTCAGGGAGAGACTAGGCTGG + Intergenic
1028675397 7:93454571-93454593 GCTTCATGTAGAAAGTCAGGAGG - Intronic
1029108424 7:98196833-98196855 GTGTCAAGGAGAAAGTCGGAAGG + Intronic
1032098135 7:128949912-128949934 GCTGAAGGCAGAAAGTGGGCTGG - Intronic
1032467673 7:132156593-132156615 GGTGCGGGGAGAAAGTCGGGGGG + Intronic
1033705116 7:143879060-143879082 GCTGCAGGGAGAAAGGCAGCAGG - Intronic
1034254324 7:149716013-149716035 GCTTCATGGAGAAGGTGGCCAGG + Intronic
1035172941 7:157030058-157030080 GCTTAAGAGAGAGAGTTGGCTGG + Intergenic
1036164307 8:6418193-6418215 TCTTCAGCGAGAAAGGAGGCCGG + Intronic
1040481473 8:47831490-47831512 GCTTCAGGGACCAATGCGGCGGG - Intronic
1043388602 8:79769989-79770011 CTTCCAGAGAGAAAGTCGGCTGG - Intergenic
1048196886 8:132338759-132338781 GCTTCTGGCAGAAAATAGGCAGG + Intronic
1052982933 9:34461967-34461989 GCTTCAGGGAGGAGGTAGGTAGG + Intronic
1061443805 9:130626061-130626083 GCTCCAGGGAGAAAGGCCGCTGG + Intronic
1188543371 X:31274447-31274469 GCTTGATGGAGAAAGTCTCCTGG + Intronic
1192452097 X:71251065-71251087 GCTTCATGGAGCAGGACGGCAGG + Intronic