ID: 1073339571

View in Genome Browser
Species Human (GRCh38)
Location 10:102734899-102734921
Sequence CAACTGAGGGGGTCTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 389}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339571_1073339583 27 Left 1073339571 10:102734899-102734921 CCTTCCCCAGACCCCCTCAGTTG 0: 1
1: 0
2: 4
3: 19
4: 389
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339571 Original CRISPR CAACTGAGGGGGTCTGGGGA AGG (reversed) Intronic
901075470 1:6552137-6552159 AGCCTGTGGGGGTCTGGGGAAGG + Intronic
901116649 1:6850915-6850937 GAACTGAGAGGGTCTGGAGCTGG - Intronic
903256656 1:22106762-22106784 AAACTGAGAGGGTCTTGGGCAGG + Intergenic
903992350 1:27282303-27282325 CACCTGAAGGGTGCTGGGGAAGG + Intronic
904264384 1:29310041-29310063 CAGCTTGGGGGCTCTGGGGATGG + Intronic
904682840 1:32240914-32240936 GAAGTCAGGGGCTCTGGGGAGGG + Intergenic
904807522 1:33142308-33142330 CAGCTCAAGGGTTCTGGGGATGG - Intergenic
905905993 1:41618915-41618937 CAACTGCGGGGGCCATGGGAAGG - Intronic
906706692 1:47900149-47900171 AGACTGAGGGGGTGTGGGGGAGG + Intronic
907491627 1:54812296-54812318 GAAGTGAGGGGGTGTGGGAAAGG - Intronic
907663846 1:56417171-56417193 CTACTGAGTGGGGCTGGGGTGGG + Intergenic
908813808 1:68011336-68011358 CAACATAGGGGATCAGGGGAAGG - Intergenic
911011878 1:93289131-93289153 CAACTGAGGGTTTCTGGCCAGGG - Intergenic
911192315 1:94960303-94960325 CTACTGAGGGGATCTGGGACAGG + Intergenic
913098100 1:115538791-115538813 TAATTGAGTGGGTCTGGGGAAGG + Intergenic
913283900 1:117210293-117210315 GAGCTGGGGGGGCCTGGGGAGGG + Intronic
922070265 1:222185433-222185455 AAGCTGAGGGGGTCTGCTGAAGG - Intergenic
922331638 1:224582055-224582077 GGACAGAGGGGGTGTGGGGAGGG + Intronic
922492673 1:226030942-226030964 AAACTGAGGGGGTGTCAGGAGGG + Intergenic
923097662 1:230788389-230788411 CACCTGCTGGGGTCAGGGGAGGG + Intronic
1063390214 10:5645461-5645483 CAAAGGAGGAGGGCTGGGGAGGG - Intronic
1064207761 10:13338553-13338575 CAACTGCAGGAGTCTGGGCAGGG + Intronic
1064324157 10:14333212-14333234 CAAGAGTGGGGGTGTGGGGAAGG + Intronic
1065542115 10:26780834-26780856 CAACTGCTGAGGTCTGGGTAGGG + Intronic
1066504758 10:36029513-36029535 AAAATGATGGGGTCTGGGCATGG - Intergenic
1067296653 10:44978621-44978643 GAGCTGAGGAGGTCTGGGGGTGG + Exonic
1068959216 10:62849873-62849895 CCACAGATGGGGGCTGGGGATGG - Intronic
1068985025 10:63099823-63099845 CAACAGATGGGTTTTGGGGATGG - Intergenic
1069622807 10:69848129-69848151 AGACTGAGGGGCTCTGGGGGAGG + Intronic
1069676865 10:70254941-70254963 TATCTGAGGGGGTCCAGGGAGGG - Exonic
1069741893 10:70690180-70690202 GAAGGGAGGGGGTCTGGAGAGGG + Intronic
1071672678 10:87624143-87624165 CAAATGAGAGGCTCAGGGGAAGG + Intergenic
1072490449 10:95900391-95900413 TAACTTGGAGGGTCTGGGGAGGG - Intronic
1073095193 10:100975246-100975268 AAACTTAGTAGGTCTGGGGAAGG + Intronic
1073188160 10:101629891-101629913 CAACTGAGTGGCTCTGAGGCAGG + Intronic
1073339571 10:102734899-102734921 CAACTGAGGGGGTCTGGGGAAGG - Intronic
1073459357 10:103657719-103657741 CAGCTGAGAGGGTCTGAGGAAGG - Intronic
1073564914 10:104526698-104526720 CAACTGAGAGAGGCTAGGGAAGG + Intergenic
1074381467 10:112984241-112984263 CTTCTGAAGGGGGCTGGGGAAGG - Intronic
1074610590 10:115017386-115017408 GAGCTGAGGGGGGCTGGGCATGG + Intergenic
1075287984 10:121203631-121203653 CAGCTGAGGGGGCCTGGAAAGGG - Intergenic
1075453541 10:122569930-122569952 CAGCAGAGGAGGTGTGGGGAGGG + Intronic
1076988115 11:253877-253899 CAGCTGAGAGGGGCTGCGGAAGG - Intergenic
1077191999 11:1259475-1259497 TAACTGAGGGGGTCTGGGGGTGG + Intronic
1078064826 11:8071623-8071645 CAACTGAAGCGGTTTGGTGAAGG - Intronic
1078149599 11:8747588-8747610 CCACTCTGGGGGTCTGGGGTGGG - Intronic
1078213159 11:9288105-9288127 GAACTGGGGGGGTCGGGGGTAGG - Intronic
1078822681 11:14897800-14897822 CAACAGAGGCGGTCTGGAGCAGG - Intergenic
1079019379 11:16896537-16896559 CTACTGAGTGGCTGTGGGGATGG - Intronic
1080616299 11:33947563-33947585 TGACTGAAGGGGCCTGGGGAGGG - Intergenic
1081552221 11:44124283-44124305 CAACTGAAGGGCTCTGGAAAGGG - Intronic
1084273264 11:68039892-68039914 CAGCTCTGGGGATCTGGGGAGGG - Intronic
1084371997 11:68750889-68750911 CAGGTGAGGGGGTCAGGGGAGGG + Intronic
1084458828 11:69285009-69285031 CACCTGAGTGAGTCTTGGGAGGG + Intergenic
1087202930 11:95364326-95364348 CTTCAGAGGGTGTCTGGGGAAGG + Intergenic
1087677987 11:101184378-101184400 CAACTGTGTGGGTGTGTGGAGGG + Intergenic
1088018368 11:105087867-105087889 CCTATGAGGGGGTCAGGGGAAGG + Intronic
1088908600 11:114173331-114173353 CCACTGAGGGGCCCAGGGGAGGG + Intronic
1089384460 11:118058764-118058786 CAGCTCGGGGGGCCTGGGGAAGG + Intergenic
1090195686 11:124814826-124814848 CAACTCAGGGAGGCTGGGGTGGG - Intergenic
1090570359 11:128038226-128038248 CAGCAGAGGGGCTCTGTGGAAGG + Intergenic
1090634687 11:128683696-128683718 CAAGACAGGGGGCCTGGGGAGGG - Intergenic
1090755155 11:129784120-129784142 CAACTGAGGAAGTCTCAGGAAGG - Intergenic
1092039217 12:5368827-5368849 CTGCAGAGGGGGTCTGGGGCAGG - Intergenic
1092055656 12:5506188-5506210 CACCTAAGGGGGGCAGGGGAGGG + Intronic
1092203480 12:6601622-6601644 AAACAGAAGGGGTTTGGGGAAGG - Intronic
1092446984 12:8567200-8567222 CAACTGAGGGTATCTGGCCAAGG - Intergenic
1092613904 12:10198956-10198978 CAACTTTGGGAGTCTGGGAAGGG + Intergenic
1094491137 12:30961475-30961497 CACCAGAGGGGGTCACGGGAGGG - Intronic
1095170885 12:39034830-39034852 CAATAAAGTGGGTCTGGGGAGGG + Intergenic
1095200458 12:39378512-39378534 AAACTGAGGGAGTGAGGGGAGGG + Intronic
1095223127 12:39642488-39642510 CAACTGAGTGTGATTGGGGATGG - Intronic
1096781598 12:53995239-53995261 CAACTGAGAGGGGCTGGTTAAGG + Intronic
1096789577 12:54036377-54036399 GAGCAGAGGGGCTCTGGGGAGGG + Intronic
1096817405 12:54210302-54210324 CACCTGATGGGCACTGGGGAGGG - Intergenic
1100192646 12:92209317-92209339 CAATTCAGGAGGTCTGGGGTGGG + Intergenic
1100202114 12:92310260-92310282 TCACTGAGGGGGTTGGGGGAAGG - Intergenic
1100321040 12:93493233-93493255 AAAGAGAGGGGGTCGGGGGAGGG - Intronic
1100321634 12:93498765-93498787 AAAGAGAGGGGGTCGGGGGAGGG + Intronic
1100335059 12:93621301-93621323 CACCTGAGGGGATGTTGGGAAGG + Intergenic
1100619230 12:96255548-96255570 CAAGTAAGAGGGTTTGGGGAGGG + Intronic
1101205092 12:102478817-102478839 CAAGTGAGTGAGTCGGGGGAAGG - Intronic
1101603692 12:106232318-106232340 CAAGTCAGGATGTCTGGGGAGGG - Intergenic
1102072708 12:110035057-110035079 AAACTGAATGGGTCTGGGAATGG - Intronic
1103599634 12:122046257-122046279 TGGCTGAGCGGGTCTGGGGAGGG + Intronic
1104711327 12:130988913-130988935 CATTTCAGGGGGGCTGGGGATGG - Intronic
1104895785 12:132163036-132163058 CAAATGGGAGGGTTTGGGGAAGG - Intergenic
1105631127 13:22169616-22169638 CAACTGAGGGGTTCAGAAGAGGG + Intergenic
1106620399 13:31366143-31366165 CAACTGAGGGTATCTGGCCAAGG + Intergenic
1107143413 13:37030244-37030266 AAACTGAGGGAGACTAGGGAAGG + Intronic
1109170861 13:59095754-59095776 GAACTGCGGGGTTGTGGGGATGG + Intergenic
1112267333 13:97936851-97936873 TAACTGAGAGGGACTAGGGATGG - Intergenic
1112312531 13:98331983-98332005 AAACTGGGTGGGTGTGGGGAGGG - Intronic
1113202639 13:107883969-107883991 CAACTGTGGGAGTGAGGGGAAGG + Intergenic
1116514199 14:45786204-45786226 CAACTGAGGGCATCTGGCTAAGG + Intergenic
1119748532 14:77061664-77061686 CAATTCAGTGGGTCTGGGGTGGG - Intergenic
1119892165 14:78191164-78191186 CAACTGGTGGGGTGTGGGGCTGG + Intergenic
1119892804 14:78195647-78195669 CAACTGCGGGCGTCTTGGGTGGG + Intergenic
1120506117 14:85355055-85355077 CAATTTAGTGGGTCTGGGGTGGG + Intergenic
1121635270 14:95449892-95449914 CAACTGGGTGGGGCTGGGGTGGG - Intronic
1122130425 14:99601991-99602013 AGGCTGAGGGGTTCTGGGGAGGG + Intronic
1122623738 14:103073904-103073926 CACCTGCGGGGGTTTGGGGTAGG - Intergenic
1123178755 14:106447161-106447183 CAAGTGAGGCAGTGTGGGGAGGG + Intergenic
1123198969 14:106643397-106643419 CAGCTGGTGGAGTCTGGGGAAGG - Intergenic
1123200411 14:106657990-106658012 CAGCTGGTGGAGTCTGGGGAAGG - Intergenic
1123706799 15:22956600-22956622 CAAGTCAGGGGCTCTGGAGACGG + Intronic
1124933529 15:34147613-34147635 CAACTGTGGGGGTTGGGGGGTGG + Intronic
1125570183 15:40710945-40710967 AAACTGAAGGGGTCCAGGGAAGG - Intronic
1125852952 15:42921414-42921436 CATCTTTGGGGGACTGGGGAAGG + Intergenic
1125978422 15:43977184-43977206 GAACTGCAGGGGGCTGGGGAAGG + Intronic
1126077253 15:44923360-44923382 ACAGTGAGGGGGTCTGGGTATGG - Intergenic
1126081462 15:44967505-44967527 ACAGTGAGGGGGTCTGGGTATGG + Intronic
1128237628 15:66078697-66078719 CACCTGTGTGGGGCTGGGGAGGG + Intronic
1128699550 15:69794288-69794310 GACCTGAGGGGGCCTGGGGCCGG + Intergenic
1129452839 15:75660245-75660267 CCACAGATGGGGGCTGGGGATGG + Exonic
1129465453 15:75722077-75722099 CACATGAGGAGGTCTGGGAACGG + Intergenic
1129788953 15:78328010-78328032 TAACTCAGGCTGTCTGGGGAAGG - Intergenic
1130932118 15:88436998-88437020 TCACTGAGGTTGTCTGGGGAAGG - Intergenic
1131400386 15:92120648-92120670 CTCCTGAGAGGGTCGGGGGAGGG + Intronic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1131459372 15:92607602-92607624 TAAGTCAGGGGGTATGGGGATGG - Intergenic
1131526972 15:93160216-93160238 CAGCTGTGGGGAGCTGGGGAAGG - Intergenic
1133156780 16:3881145-3881167 CACCTAGGAGGGTCTGGGGAAGG - Intergenic
1133161612 16:3915737-3915759 CAGCAGAGAGGGGCTGGGGAAGG - Intergenic
1134058699 16:11186085-11186107 TAACTGAGGGGGCCTGGGCCTGG - Intergenic
1134509003 16:14831346-14831368 CAGCTGAAGGGGGCAGGGGAGGG - Intronic
1134696704 16:16230180-16230202 CAGCTGAAGGGGGCAGGGGAGGG - Intergenic
1134748715 16:16608431-16608453 TAACTGAGTAGGTCTGGGGTGGG - Intergenic
1134975129 16:18564525-18564547 CAGCTGAAGGGGGCAGGGGAGGG + Intergenic
1134996751 16:18745187-18745209 TAACTGAGTAGGTCTGGGGTGGG + Intergenic
1135323695 16:21512932-21512954 CAGCTGTGGGGGGTTGGGGATGG + Intergenic
1135341963 16:21656175-21656197 TAACTGGGGGGGTGGGGGGAGGG - Exonic
1136299674 16:29325446-29325468 CATCTCGGGGGGACTGGGGAGGG - Intergenic
1136598140 16:31265856-31265878 CAGCTGAGGGGGGCTGGTGGTGG - Exonic
1137530382 16:49275565-49275587 GAACTGACGGGGTGTGGGGAGGG + Intergenic
1141621797 16:85240339-85240361 CAACTGAGGGGCTCTGGCTGTGG - Intergenic
1141866196 16:86751771-86751793 CAACAGAGGGTGCCGGGGGAGGG - Intergenic
1141899939 16:86984582-86984604 CATCTGATGGGGGCAGGGGAAGG + Intergenic
1142233552 16:88910914-88910936 CAAGTGTGGGGATCTGGGGTGGG + Intronic
1142597520 17:1036692-1036714 CAGCTGTGGGGGAGTGGGGACGG + Intronic
1142606412 17:1083839-1083861 TTAATGAGGGGGTCTGGGGTTGG + Intronic
1143582115 17:7833761-7833783 CAATGGTGAGGGTCTGGGGAGGG + Intergenic
1143707493 17:8709062-8709084 CAACTCAGGGTGTATGTGGAAGG + Intergenic
1144145445 17:12393434-12393456 CAGCTGAGGAGGTCTGAGTAGGG - Intergenic
1144427593 17:15158298-15158320 CAACAGAGGGGGTGTAAGGAGGG + Intergenic
1144682633 17:17205764-17205786 TAGGGGAGGGGGTCTGGGGACGG - Intronic
1144714711 17:17425868-17425890 CAACTGAGGGTATCTGGCCAAGG + Intergenic
1145014578 17:19387858-19387880 AGAGTGAGGGGGGCTGGGGAGGG - Intergenic
1145053608 17:19683221-19683243 CAACTGTGGGGGTGTGGTGGGGG + Intronic
1145882976 17:28365211-28365233 CAAATGGGGGGGTCTGGTGTGGG - Exonic
1145981243 17:29012971-29012993 AAACTGAGGGAGGCTGGGCACGG + Intronic
1146066488 17:29639729-29639751 CAAGTGAGTGGCTGTGGGGAGGG + Intronic
1146162059 17:30565367-30565389 CAGCTTAGGGGGGCTGAGGAGGG + Intergenic
1146562688 17:33884716-33884738 TAGCTTAGGGGGTGTGGGGATGG - Intronic
1146756336 17:35434742-35434764 CTACTGTGGTGGACTGGGGAGGG + Intergenic
1147163416 17:38580465-38580487 CACCTGATGGGGTGTAGGGAAGG - Intronic
1148715240 17:49711179-49711201 CATCTCAGGGGACCTGGGGAGGG + Exonic
1148938027 17:51180543-51180565 AAACTGAGGGCGGGTGGGGAAGG - Exonic
1150132773 17:62678338-62678360 CATCTGCAGAGGTCTGGGGAGGG - Intronic
1150824203 17:68460279-68460301 CAACTGATGGGGAAGGGGGAGGG + Intergenic
1151746189 17:76013190-76013212 CAACTTATTTGGTCTGGGGAGGG + Intronic
1151816588 17:76474244-76474266 CATCTATGGGGGTCTGGGAAAGG + Intronic
1152945071 17:83193689-83193711 CAGCTGAGAGGGCCAGGGGAGGG - Intergenic
1156960872 18:43028662-43028684 TTACTGAAGGGGTCTGGAGAAGG - Intronic
1157223811 18:45845455-45845477 CAGCCCAGAGGGTCTGGGGAGGG - Intergenic
1158602141 18:58864154-58864176 AAACTGGGGCTGTCTGGGGAGGG - Intronic
1158943433 18:62427310-62427332 CTACTGAGTGGTTCTGGGAAAGG + Intergenic
1160245750 18:77158276-77158298 CAACTGAAGGGATCTGAGTAAGG - Intergenic
1160512676 18:79461239-79461261 CACGTGGGGGTGTCTGGGGAGGG + Intronic
1160770380 19:828384-828406 CCAGTGAGGGGTCCTGGGGAGGG + Exonic
1161648514 19:5469573-5469595 TGCCTGAGGGGGTCTGGGGAAGG + Intergenic
1161865021 19:6827175-6827197 CTGCTGAGGGGGGCTGGAGATGG - Intronic
1162013364 19:7830829-7830851 GAAGTGAGGGGGTGCGGGGAGGG - Intronic
1162097452 19:8319099-8319121 CAACTAGGGGGGTCGGGGGTTGG + Intronic
1162111409 19:8401878-8401900 GAAATGTGGGGGTCTGAGGAGGG - Intronic
1162311010 19:9907157-9907179 CAAGAGAGGTGGTCTGGGGCCGG + Intronic
1164090707 19:21949264-21949286 CAACTGAAGAGGTCTCAGGAAGG + Intronic
1164109848 19:22145952-22145974 CAACTGAAGAGGTCTCAGGAAGG + Intergenic
1164400697 19:27900231-27900253 CAACTGCGGTGGAGTGGGGAGGG + Intergenic
1164666863 19:30045397-30045419 CAACTGATGAGGGCTTGGGATGG + Intergenic
1164802786 19:31091560-31091582 AAAGTGTGGGGGTCTGGGCAGGG - Intergenic
1165695644 19:37898956-37898978 CAATTGAGTAGGTCTGGGGTGGG - Intronic
1165819657 19:38666351-38666373 CAACCGATGGGGGCTGGGGGTGG + Intronic
1166851698 19:45764411-45764433 CAACCGAGTGGCTCTGGGGTGGG - Exonic
1167262536 19:48467278-48467300 CAGCTCAGGGTGTCTGGGGTAGG + Intronic
1167278765 19:48554270-48554292 TATCTGAGGGGGTCTGGGAGGGG - Intronic
1167419572 19:49395069-49395091 GCAGTGAGGGGGTCTGGGGCAGG - Intronic
1167622177 19:50566526-50566548 GAGGTGAGGAGGTCTGGGGAAGG + Intronic
1168373062 19:55852358-55852380 CAGGTGAGGGAGTCTGGGAAGGG + Exonic
925075372 2:1012480-1012502 CGACTTGGGGGGTCTGGAGAGGG + Intronic
925440465 2:3880923-3880945 CAACAGAGTGTGTCTGGTGAGGG - Intergenic
927506111 2:23615919-23615941 AAGCAGAGGGGGTCTGGGGAGGG - Intronic
927554245 2:24021442-24021464 CAGCAGAGGGGGTGTGTGGAAGG + Intronic
928406454 2:31018699-31018721 AAAGTGAGGGCTTCTGGGGATGG + Intronic
929252056 2:39768980-39769002 CAACTGATGAGGTCTGGTGATGG + Intronic
929783987 2:44976016-44976038 CTACTGAAGGGGACTGGAGAAGG - Intergenic
930706693 2:54511481-54511503 CCACTGACGGGTTGTGGGGATGG + Intronic
930766521 2:55090838-55090860 CAACTGAGTGGATGTGGGGCTGG - Intronic
931196595 2:60057725-60057747 AAACTGAGCAAGTCTGGGGATGG + Intergenic
931801180 2:65759739-65759761 CAACAGAGTGGTTGTGGGGAGGG + Intergenic
932269968 2:70400701-70400723 GAACTGAGAGGGTCTGGGGAGGG - Intergenic
932485275 2:72080848-72080870 AAGCTGAGGGGGGCTGAGGAGGG + Intergenic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
934857375 2:97737747-97737769 CTGCTGAGCGGGCCTGGGGAGGG - Exonic
934973941 2:98787172-98787194 CAACTGAAGGGCTCAGGGGTGGG + Intergenic
935819067 2:106875573-106875595 CAACTGATGGGGTACGGGAAAGG + Intronic
936058825 2:109281315-109281337 TAACGGAGGGGGCCCGGGGAAGG - Intronic
936072154 2:109378281-109378303 AAGCTGAGGGGGTCTTTGGAAGG - Intronic
936263126 2:110979407-110979429 CAGCTGAAGGTTTCTGGGGAAGG - Intronic
936387251 2:112041363-112041385 GGACTGAGGGGGCCTGGGGCAGG - Intergenic
937257703 2:120566589-120566611 AAACTGAGGTGGGGTGGGGAGGG - Intergenic
937821168 2:126312776-126312798 GAGCTGAGTGGGTCTGTGGATGG - Intergenic
938071002 2:128308339-128308361 CAGCTGGTGGGGTCTAGGGAAGG + Intronic
938255647 2:129858155-129858177 CAACTGACAGGGTCTGGGGTAGG + Intergenic
939211606 2:139182423-139182445 CAAGTGAGGGGTTCAGGGTACGG + Intergenic
939242526 2:139579519-139579541 CTGCTGGGGGGTTCTGGGGAGGG + Intergenic
944413355 2:199462649-199462671 CAGCTCAGGGGGTCTGGGCGGGG + Intronic
946163132 2:217848054-217848076 GAACTCAGGGAGACTGGGGATGG + Exonic
946301575 2:218827506-218827528 GAGCTGAGTGGGACTGGGGAAGG + Intronic
946452768 2:219795102-219795124 CATCTGAGGGGATCTGGGTGAGG + Intergenic
946974967 2:225138635-225138657 CGACTGAGGTGGTCTCGGCAAGG - Intergenic
946986308 2:225277732-225277754 CAACTGAGAGAGAGTGGGGAGGG + Intergenic
948370040 2:237483106-237483128 CACCTGAGAGGGTCAGTGGATGG + Intergenic
948403943 2:237703619-237703641 CAACCCCGGGGGGCTGGGGAAGG - Intronic
948757015 2:240165773-240165795 CCAGTGAGGGGGTAAGGGGAGGG + Intergenic
948798680 2:240420327-240420349 CCACTGAGGGGGTCAGGAAAGGG - Intergenic
949076365 2:242061345-242061367 CACCTGGGTGTGTCTGGGGAGGG - Intergenic
1168793394 20:595451-595473 CATCTGAGGGGGTCAGGGCCTGG + Intergenic
1169021620 20:2335070-2335092 CGAGTGAGGGGGAGTGGGGATGG - Intronic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169324066 20:4661151-4661173 CAACTCAGGGGGACTGGGGAGGG + Intergenic
1170000402 20:11608205-11608227 CAAGTGAGGGCTTCTGGGGGCGG - Intergenic
1170625385 20:18026347-18026369 CAACTCAGTGGGTCTGGGGTAGG + Intronic
1171536713 20:25898940-25898962 AAGCTGAGGGGGTCTGAGGGTGG + Intergenic
1172186599 20:33034910-33034932 CAAGTGAGGGGCTCTGTGGCTGG + Exonic
1172426521 20:34859793-34859815 CAAACGAGGGGGTCTGGGAAGGG - Intronic
1172645411 20:36466075-36466097 CAAATGAGAGTGTCTAGGGATGG - Intronic
1172799560 20:37566450-37566472 CAACTGCTGGGCTCTGGGGCAGG - Intergenic
1173577218 20:44120283-44120305 CAACTGTGGGGCTGTGGGAAGGG - Intronic
1173691373 20:44963735-44963757 CAGATGAGAGGGTCAGGGGAGGG + Intergenic
1174354274 20:49987936-49987958 CATCTGAGTGGGTCTGGAGGTGG - Exonic
1174489831 20:50885050-50885072 CAACTGGCTGTGTCTGGGGAGGG - Intergenic
1174719019 20:52791011-52791033 CAACTGAAGGGGCAAGGGGAAGG + Intergenic
1175938105 20:62524461-62524483 CACCTGAGGGGGGCTGAGGCAGG - Intergenic
1177630002 21:23714546-23714568 CCACTTAGGTGGTCTGTGGATGG - Intergenic
1177785914 21:25671354-25671376 CAAGTGAGGGTGGGTGGGGAAGG - Intronic
1178358833 21:31931616-31931638 CAAGCAAGGGGGCCTGGGGAAGG - Intronic
1178722044 21:35018788-35018810 CCACTGAGGGGGACTGTGGGAGG - Intronic
1179960590 21:44765214-44765236 CAGCTGCTGGGGTCTGAGGAAGG + Intergenic
1181327280 22:22059476-22059498 CAGCTGAGCTGATCTGGGGAGGG + Intergenic
1181493992 22:23277741-23277763 CCACAGTGGGGGTCTGGGGCTGG - Intronic
1181887256 22:26031233-26031255 CACCAGAGGGGTCCTGGGGATGG - Intergenic
1182992774 22:34783725-34783747 CCAGTGAGGGGGGCTGGCGAGGG - Intergenic
1183463240 22:37965808-37965830 CTATTCCGGGGGTCTGGGGAAGG + Intronic
1183659190 22:39208356-39208378 CAGCTGTGGGGGTCCGAGGAGGG + Intergenic
1184453359 22:44595848-44595870 CATCAGAGGGGCTTTGGGGATGG - Intergenic
1185105846 22:48869356-48869378 CACCTGCGGGGCCCTGGGGAGGG + Intergenic
1185331759 22:50255138-50255160 CAAGTGGGGGGCTCTGGGCAGGG - Intronic
951270088 3:20614380-20614402 CAACTGAGCTGGTCTTGGCAAGG - Intergenic
952388359 3:32859557-32859579 CAACTTTGGGGTTCTGGAGAGGG + Intronic
953056054 3:39387965-39387987 AAACTGGGGGGGCCTGCGGAGGG + Intronic
953614756 3:44479618-44479640 AAATTCAGGAGGTCTGGGGAGGG + Intergenic
953708022 3:45245752-45245774 CACCTGAGGGCATCTGGGCAGGG + Intergenic
953834204 3:46329054-46329076 CAACTGAAGGAGCCGGGGGAGGG + Intergenic
954618051 3:51980350-51980372 CAGCTGAGGGGCACTGGGAAGGG - Intronic
955403230 3:58608677-58608699 CCTCCAAGGGGGTCTGGGGAAGG - Intronic
956558039 3:70543036-70543058 CAACTGAAGGCATCTGGAGAAGG - Intergenic
957348084 3:78987357-78987379 CAACAGATGGGGTTTGGGGCAGG + Intronic
958415213 3:93865968-93865990 TAACTGTGGGGGTGTTGGGAAGG - Intergenic
958600699 3:96293243-96293265 TCATTGAGGGGTTCTGGGGAAGG + Intergenic
959672849 3:108998438-108998460 CACCTTTGGGGGTCAGGGGAGGG + Intronic
961405683 3:126678238-126678260 CAACTGAGGCTGTCAAGGGAAGG + Intergenic
963929047 3:150982846-150982868 GAACTGAAGGGGGCTGGGGAGGG + Intergenic
964138567 3:153371555-153371577 CAATTGTTGGTGTCTGGGGAAGG + Intergenic
966096755 3:176213504-176213526 CCACTGCGGGGGCCGGGGGAAGG + Intergenic
966874958 3:184316216-184316238 CAGGTGAGGGGCTGTGGGGAGGG + Exonic
967104999 3:186248568-186248590 CAACTCAGTAGGTCTGGGTAAGG - Intronic
967370327 3:188737562-188737584 CAACTGAGGGCGAGTGGGAAAGG - Intronic
967874631 3:194259212-194259234 TAACTTAGGAGGTCTGGGGTGGG + Intergenic
968474503 4:796938-796960 TGTCTGTGGGGGTCTGGGGATGG - Intronic
968651768 4:1763028-1763050 CACCCGAGGGGGCGTGGGGAAGG - Intergenic
969344921 4:6564292-6564314 CAGCAGGGCGGGTCTGGGGAAGG - Intergenic
970320213 4:14867910-14867932 CAACTGCAGGGCTGTGGGGAGGG - Intergenic
970613587 4:17747313-17747335 CAGTTGAGGGGGTGTGGGGTTGG + Intronic
972867028 4:43245295-43245317 GAACTGAGTGGGGCAGGGGAAGG - Intergenic
974121263 4:57641681-57641703 AAAGTGAGGAGGTCTGGAGAAGG + Intergenic
975465038 4:74699343-74699365 CAATTGAGGAGGTCAGGAGAGGG - Intergenic
975901902 4:79163395-79163417 GAACTGTGGGGCTGTGGGGAGGG + Intergenic
976487958 4:85630543-85630565 CAACTGTTGGGGTCTGTGAAGGG + Intronic
976727704 4:88230809-88230831 GAACTCAGGGGGCCTGGGGTGGG - Intronic
978360631 4:107927903-107927925 CAAAAGAGGGGGGCAGGGGAAGG - Intergenic
978470886 4:109066294-109066316 CATTTCAGGGGCTCTGGGGAAGG - Intronic
979244676 4:118488058-118488080 CACTTGAGGGGGTCTGGTAATGG - Intergenic
979908833 4:126333893-126333915 CAACCGAGGGGTTTTGAGGAAGG - Intergenic
980798928 4:137723157-137723179 GAAGTAAGGGGATCTGGGGAAGG + Intergenic
980956520 4:139434083-139434105 CCACTGCTGGGGGCTGGGGAAGG + Intergenic
982374782 4:154677782-154677804 ACACTGAGGGGCTTTGGGGAGGG + Intronic
984009611 4:174355259-174355281 CTACTGAGAAGGACTGGGGAGGG + Intergenic
984712508 4:182897709-182897731 GGGCTGAGGGGGTCTGGGGAAGG - Intronic
985636896 5:1040217-1040239 CCACGGACGGGGTGTGGGGATGG - Intergenic
987392279 5:17387269-17387291 GAAATGAGGGGGCCTGGGGTGGG + Intergenic
989595927 5:43156209-43156231 TAACTGATGGGGTTTGGGCATGG - Intronic
990350564 5:54911556-54911578 CAGGTGAGAGGGTCTGTGGAGGG - Intergenic
990379385 5:55207051-55207073 CAACTGAGGGTTTCTGGCGGGGG + Intergenic
990999319 5:61767105-61767127 CAATTGATGGGGTAGGGGGAGGG - Intergenic
992222591 5:74587516-74587538 AAACTGAGCAGGTTTGGGGAAGG - Intergenic
992773263 5:80068748-80068770 CCACGGAGCTGGTCTGGGGAGGG + Intronic
993544219 5:89191003-89191025 CATCTTGGGGGGTTTGGGGAAGG + Intergenic
994952000 5:106475427-106475449 CCACTGATGGGGTGTGGGGCAGG - Intergenic
995175257 5:109168589-109168611 CAAATGAAGAGGTATGGGGAAGG - Intronic
996671802 5:126126738-126126760 TAACTGAGGGGGTCAAGGCAGGG - Intergenic
997740110 5:136245730-136245752 GAACTGAGTGGGTCTGGGGCAGG + Intronic
998430432 5:142065505-142065527 CAACTCAGGGGCTCTGTGGTTGG + Intergenic
999124813 5:149239339-149239361 CACCTTCGGGGGGCTGGGGATGG - Intronic
1001247319 5:170114523-170114545 CCAGTGAGGGGCTCTGAGGAGGG - Intergenic
1002206950 5:177569384-177569406 CCACTCAGTGGCTCTGGGGAGGG + Intergenic
1004154685 6:13157221-13157243 GAGCTGAGGGGGGCTGGGTAGGG - Intronic
1004357761 6:14944953-14944975 TGACTGAGGAGGTCTGGGGTGGG - Intergenic
1004461780 6:15843307-15843329 TCACTGAGGGGGTCTAGGGTGGG + Intergenic
1005447005 6:25934291-25934313 CAACTGGGGGTATCAGGGGAAGG + Intergenic
1005640499 6:27791952-27791974 CAACTGAGGGGGCGAAGGGAAGG + Intergenic
1007788638 6:44296765-44296787 CTCCTGAGGGGATCTGGGGTGGG - Intronic
1011590289 6:88964869-88964891 CCTTGGAGGGGGTCTGGGGATGG - Intergenic
1012748347 6:103123354-103123376 CCACTGAGGGCATCAGGGGAGGG + Intergenic
1013312418 6:108908324-108908346 CAGCTGGAGGGGCCTGGGGAGGG - Intronic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1014825698 6:126046709-126046731 CAACTGATAGGGTTTGGGCAAGG + Intergenic
1016386434 6:143535488-143535510 AAACTGAGGGTGCTTGGGGAAGG + Intergenic
1017531611 6:155297887-155297909 CAACTGAAGGAGTCTGGTCATGG + Intronic
1018722053 6:166580667-166580689 CCACTGAGGGGGTCAGGGGTTGG - Intronic
1018976321 6:168570131-168570153 CCTCTGTGGGGGTCGGGGGAGGG + Intronic
1019142399 6:169956978-169957000 CATCTGAGGGGGTGTGGTGGGGG + Intergenic
1019142439 6:169957081-169957103 CATCTGAGGGGGTGTGGTGGGGG + Intergenic
1019142453 6:169957115-169957137 CATCTGAGGGGGTGTGGTGGGGG + Intergenic
1019142467 6:169957149-169957171 CATCTGAGGGGGTGTGGTGGGGG + Intergenic
1019142516 6:169957287-169957309 CATCTGAGGGGGTGTGGTGGGGG + Intergenic
1019555083 7:1625287-1625309 AAACTGAGGGGTGCTGGGGAAGG - Intergenic
1021133536 7:16939483-16939505 CATCTGAAGGCATCTGGGGAAGG + Intergenic
1021622009 7:22557835-22557857 CTATTGCTGGGGTCTGGGGATGG + Intronic
1022236551 7:28467149-28467171 CAACTGAGGGAATCTGGTGGTGG + Intronic
1022500030 7:30877005-30877027 CCAGAGAGGGGATCTGGGGAGGG - Intronic
1027244561 7:76358581-76358603 TCACTGAGGGGGGCTGGGGAGGG - Intronic
1027603451 7:80269445-80269467 CTCCTGAGTGGGACTGGGGAAGG - Intergenic
1029170230 7:98625189-98625211 CACATGATGGGTTCTGGGGAGGG - Intronic
1029687185 7:102156964-102156986 CTGCTGAGAGGGTCTGGGAAGGG + Intronic
1029742135 7:102496827-102496849 CAGGTGAGGGGGCCTGGGCAGGG - Exonic
1029760124 7:102595992-102596014 CAGGTGAGGGGGCCTGGGCAGGG - Exonic
1031608210 7:123794486-123794508 GAGCAGAGGGGGTCAGGGGATGG - Intergenic
1032848941 7:135775867-135775889 ACACTGAGGGGGACTGGGGGCGG - Intergenic
1032866735 7:135933321-135933343 AAATTGAGAAGGTCTGGGGAAGG - Intronic
1034137959 7:148788900-148788922 CACCTGTTGGGATCTGGGGAGGG + Intronic
1034285476 7:149880771-149880793 CCAGTGGGTGGGTCTGGGGAGGG + Intergenic
1034492869 7:151403490-151403512 AAACTCAGGGGGTCGGGGGAAGG - Intronic
1035052094 7:156004906-156004928 CAACTGAGGTAGCCGGGGGATGG + Intergenic
1036215206 8:6873763-6873785 CATCTGAGTGGGTCTGGGTTGGG + Intronic
1036908548 8:12731213-12731235 CAACTGAGTTGGTGTCGGGAGGG - Intronic
1037820637 8:22133243-22133265 CAGGTAAGGGGCTCTGGGGATGG - Intronic
1039884680 8:41648217-41648239 TCACTCAGGGGGTCTGGGGCTGG + Intronic
1040596992 8:48847980-48848002 CTACTCTGTGGGTCTGGGGAGGG + Intergenic
1041109680 8:54472695-54472717 TAACTGGGGGGGTAGGGGGATGG - Intergenic
1041491772 8:58440708-58440730 CAACTGAAGGGGGCTTGGAAGGG - Intronic
1042916252 8:73878652-73878674 CAGCTCAGGGCGTCGGGGGAGGG - Intronic
1044572385 8:93734380-93734402 CACCTGAGGAGGACTGGAGACGG - Exonic
1044714260 8:95086515-95086537 CCACTGAGGGATTCTGAGGAGGG - Intronic
1045994775 8:108350853-108350875 CAACTGCGGGGGAATGGGGTTGG - Intronic
1047461178 8:125066869-125066891 CTTCTGAAGGGGCCTGGGGAAGG - Intronic
1047469028 8:125149181-125149203 TAAGTTAGGGGGTCAGGGGAGGG - Intronic
1049644471 8:143729896-143729918 AAACTCGGGGGCTCTGGGGATGG - Intronic
1050340085 9:4628115-4628137 GAGCTGAGGGGGAGTGGGGATGG + Intronic
1050644363 9:7702949-7702971 CCACTGACTGGGACTGGGGAGGG + Intergenic
1052699685 9:31922569-31922591 CCACTGTGGAGGTCTGGGTATGG - Intergenic
1054903468 9:70393440-70393462 CAGCTCAGGGAGTCTGGGGAGGG - Intronic
1055763044 9:79630526-79630548 CAACTGAGGGAACTTGGGGAAGG - Intronic
1056398336 9:86202319-86202341 CTACTGATGGGGTTAGGGGATGG + Intergenic
1056875726 9:90328617-90328639 CAATTGAGAGACTCTGGGGATGG - Intergenic
1057941890 9:99292212-99292234 CATCTAAGGGGGTGGGGGGAAGG + Intergenic
1058651243 9:107177194-107177216 CAGGTGATGGGGGCTGGGGATGG + Intergenic
1059967475 9:119629457-119629479 CCACTGAGAGGGTCTGGAGCCGG + Intergenic
1060297026 9:122349902-122349924 CACCTGCGGGGGTCAGGGGAGGG - Intergenic
1060503307 9:124179563-124179585 CCACGGAGCGGGTCGGGGGACGG - Intergenic
1060552621 9:124492777-124492799 CAGCTCAGGGGGTGTGGGCATGG - Intronic
1061105761 9:128529213-128529235 CAACAGAGGGGAACTGGGAACGG - Intronic
1061231673 9:129319243-129319265 CAGCAGAGGGGGCCAGGGGAGGG - Intergenic
1061393910 9:130332970-130332992 AGACAGCGGGGGTCTGGGGAGGG + Intronic
1061847231 9:133394565-133394587 AAGCTGAGGGGTTCTGAGGAGGG - Intronic
1061950821 9:133934998-133935020 TAACCGAGGGGGTGTGGGGCTGG - Intronic
1061959084 9:133978954-133978976 GAGCTGAGGGGGTCAGGGCAGGG + Intronic
1062043223 9:134413704-134413726 GGAGGGAGGGGGTCTGGGGAAGG - Intronic
1062218206 9:135400362-135400384 AAACTGAGGCAGGCTGGGGATGG - Intergenic
1062307258 9:135915107-135915129 CTCCTGAGTGTGTCTGGGGAAGG - Intergenic
1062318129 9:135978182-135978204 CTGCTGAGGGGTTCTGGGGGGGG - Intergenic
1062345117 9:136110955-136110977 AATCAGAGGGGCTCTGGGGAGGG - Intergenic
1062624349 9:137436141-137436163 CAACTGTGAGGTTCTGGGGGAGG + Exonic
1185431397 X:13810-13832 GAAGCGTGGGGGTCTGGGGATGG - Intergenic
1186789568 X:12983762-12983784 CGAATGAGTGGGTCTGTGGAAGG + Intergenic
1186874506 X:13803794-13803816 CTCATGAGGGGGTTTGGGGAAGG - Intronic
1187978701 X:24731611-24731633 CAACTCAGGGGGTCTGGGAATGG + Intronic
1188571242 X:31588007-31588029 TAATTGGGGAGGTCTGGGGAGGG - Intronic
1188936767 X:36185378-36185400 GAATTGAGGGGGTCAGGGCAGGG + Intergenic
1190144363 X:47877164-47877186 CAACTGATGGGGTTTAGGCAGGG - Intronic
1191717732 X:64204971-64204993 CAACTGAGCTCCTCTGGGGAGGG + Intronic
1192342734 X:70277554-70277576 CATCAGAGGGGTTCTGGGGTGGG - Intronic
1192552600 X:72066128-72066150 TCATTGAAGGGGTCTGGGGAAGG + Intergenic
1192861068 X:75071039-75071061 TAACTGAGTGGGGGTGGGGAGGG + Intronic
1193490324 X:82142153-82142175 GAACTGTAGGGGGCTGGGGAAGG - Intergenic
1194436357 X:93872809-93872831 CAACTGAGGTGGTCTCAAGAAGG - Intergenic
1195869614 X:109472457-109472479 CAGCTGAGAAGGTCTGAGGAAGG - Intronic
1197116690 X:122842093-122842115 CAACTCAGTTGGTCTGGGGTGGG + Intergenic
1200699721 Y:6391769-6391791 CAACTAAGGGAATGTGGGGATGG + Intergenic
1201034390 Y:9772929-9772951 CAACTAAGGGAATGTGGGGATGG - Intergenic
1201372134 Y:13277528-13277550 TCACTGACGGGGTTTGGGGATGG - Intronic
1201437813 Y:13978455-13978477 TAACTGAGTGGGGCAGGGGACGG + Intergenic
1201562846 Y:15335920-15335942 CATCATAGGGGATCTGGGGATGG - Intergenic