ID: 1073339573

View in Genome Browser
Species Human (GRCh38)
Location 10:102734903-102734925
Sequence GTGCCAACTGAGGGGGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339573_1073339583 23 Left 1073339573 10:102734903-102734925 CCCCAGACCCCCTCAGTTGGCAC 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339573 Original CRISPR GTGCCAACTGAGGGGGTCTG GGG (reversed) Intronic
900498981 1:2990415-2990437 GTGGCAAGTGAGAGGGACTGGGG + Intergenic
901492437 1:9603312-9603334 GTGCCAGCTCAGTGGGTGTGGGG + Intronic
901625421 1:10621992-10622014 GTGCCCACTGAAGGGGGCAGCGG + Intronic
901786369 1:11627487-11627509 ATGCCAGATGAGGGGGTTTGAGG - Intergenic
901932448 1:12604155-12604177 GTGGCAACTGAGGGGGTTGCAGG - Intronic
902407095 1:16190342-16190364 GTGCAAACTGTGGGGCTGTGGGG - Intergenic
904688379 1:32276110-32276132 GGGACACCTGAGGGGGACTGAGG - Intronic
906671794 1:47661207-47661229 GGGCCTCCTGAGGGGGGCTGTGG + Intergenic
907419492 1:54337260-54337282 GTGCCACCTGAGTGTGTGTGAGG - Intronic
910596985 1:88991811-88991833 CGGCCACCTGAGGGGGACTGGGG - Intronic
913987130 1:143575330-143575352 GAGCCCACTGTGGGGGACTGAGG - Intergenic
916453744 1:164949040-164949062 GGGCCAACTGGTGGGATCTGTGG + Intergenic
919089613 1:192962144-192962166 GGGCCTAGTGAGGGGATCTGTGG - Intergenic
920642282 1:207764113-207764135 GCGCCACCTGAGGGGATCTGAGG - Intronic
921174654 1:212583603-212583625 GGGCCAACTGACAGGGGCTGTGG + Intronic
923110321 1:230885005-230885027 GTGCCATCTGAGGGTCTCTCTGG - Intergenic
923667921 1:236015075-236015097 CTGCCAACTGTGAGGGGCTGGGG - Intronic
923715240 1:236419611-236419633 ATTCCAACTAAGGCGGTCTGGGG + Intronic
924694048 1:246381866-246381888 GTGTCAGCTGGAGGGGTCTGGGG - Intronic
924694111 1:246382091-246382113 GTGTCAGCTGGAGGGGTCTGGGG - Intronic
1066993819 10:42543503-42543525 CTGTCAATTGAGAGGGTCTGAGG + Intergenic
1067239114 10:44475315-44475337 GTGCCACCTGAGGAGGTAGGAGG - Intergenic
1067443453 10:46326317-46326339 GTGCCAGCTGTGGGGCTCAGGGG - Intronic
1068145987 10:53071356-53071378 ATGCTAACTGAGGGGGTCTGGGG + Intergenic
1073339573 10:102734903-102734925 GTGCCAACTGAGGGGGTCTGGGG - Intronic
1076340493 10:129741991-129742013 GGGCTCACTGAGGGGCTCTGGGG + Intronic
1077191997 11:1259471-1259493 AGGATAACTGAGGGGGTCTGGGG + Intronic
1077225695 11:1438177-1438199 GTGCCAGCTGTGGGGGTCGCAGG - Intronic
1077225705 11:1438208-1438230 GTGCCAGCTGTGGGGGTCGCAGG - Intronic
1077420346 11:2447050-2447072 GTGAGAATTGAGGGGGTCTGCGG - Intronic
1077466712 11:2736926-2736948 GTGCCAGCCGAGGGTGGCTGAGG + Intronic
1078662167 11:13296345-13296367 TTGCCTCCTGAAGGGGTCTGGGG + Intronic
1081678882 11:44988009-44988031 GTACAAACTGAGGGTGTGTGTGG - Intergenic
1082924655 11:58532218-58532240 GAGCCCACTGTGGGGGTCTCGGG - Intronic
1083766231 11:64842869-64842891 CTGCCAGCTGGGCGGGTCTGTGG + Intronic
1084163618 11:67364794-67364816 GTGCCACCTGAGGGGCTGGGTGG + Exonic
1084206921 11:67600473-67600495 GGGCCAACTGGCGGGGACTGTGG + Intergenic
1088590030 11:111395307-111395329 GTGCTGCCTGAGGGGGCCTGCGG - Intronic
1090570357 11:128038222-128038244 GAGCCAGCAGAGGGGCTCTGTGG + Intergenic
1090755158 11:129784124-129784146 GTCCCAACTGAGGAAGTCTCAGG - Intergenic
1091110818 11:132964714-132964736 GTGCCTGCTGAGGGGATCAGAGG - Intronic
1092039218 12:5368831-5368853 GTGGCTGCAGAGGGGGTCTGGGG - Intergenic
1103177432 12:118876941-118876963 GCCCCCACTGAGGTGGTCTGTGG + Intergenic
1104675551 12:130709835-130709857 GGGCCTCCTGAGGGGGCCTGGGG - Intronic
1105000856 12:132688487-132688509 GGGCCAAGGGAGCGGGTCTGCGG + Intronic
1105000868 12:132688526-132688548 GGGCCAAGGGAGCGGGTCTGCGG + Intronic
1105001039 12:132689072-132689094 GGGCCAAGGGAGCGGGTCTGCGG + Intronic
1105001051 12:132689111-132689133 GGGCCAAGGGAGCGGGTCTGCGG + Intronic
1105242545 13:18620869-18620891 GTGCCAGCCGAAGGGTTCTGTGG - Intergenic
1105723080 13:23135315-23135337 CTGCCACCTGAGGTGGGCTGGGG + Intergenic
1113367784 13:109692798-109692820 ATGCCCACTGAGGGTGTTTGGGG + Intergenic
1117551650 14:56843112-56843134 GTCCCAGCTGAGGGAGGCTGAGG - Intergenic
1118318783 14:64741487-64741509 CTGACAGCTGAGGGAGTCTGTGG - Exonic
1119328217 14:73774856-73774878 GGGCCACCTGAGGGGCTGTGAGG - Intronic
1121635273 14:95449896-95449918 CTGCCAACTGGGTGGGGCTGGGG - Intronic
1121719764 14:96101016-96101038 GTTCCATCAGAGGAGGTCTGAGG - Intergenic
1121993415 14:98583005-98583027 GAGCCAGAGGAGGGGGTCTGGGG - Intergenic
1122964811 14:105117892-105117914 GTCCCTAATGAGGGGGTCGGGGG - Intergenic
1123817710 15:23996571-23996593 GTGCCATATGAGGGGCTCAGTGG + Intergenic
1124254172 15:28127545-28127567 TTGTCCACTGAGGAGGTCTGGGG + Intronic
1124623649 15:31295524-31295546 GTGCTAACTGATGGGGACTATGG - Intergenic
1126473828 15:49046147-49046169 CTCCCAGGTGAGGGGGTCTGCGG + Intronic
1127071182 15:55289700-55289722 GAGCCAGGTGAGGGGGCCTGAGG - Intronic
1127293917 15:57593118-57593140 GGGCCAACTGATGGATTCTGGGG + Intronic
1127293923 15:57593215-57593237 GAGCCAACTGATGGATTCTGGGG - Intronic
1128407806 15:67361098-67361120 TTACCAACTGAGTGGGCCTGGGG - Intronic
1129559723 15:76553288-76553310 GTGCCAACTGAGTGTGTATATGG + Intronic
1131455638 15:92580459-92580481 GGCCCAGCAGAGGGGGTCTGTGG - Intergenic
1133221831 16:4322170-4322192 GTGCCAAAGGAGAGGGCCTGGGG + Intronic
1136629849 16:31483458-31483480 GTGCTAGCTGAAGGGGTCCGCGG + Intronic
1137701786 16:50502804-50502826 CTGCACACTGAGGGGCTCTGTGG - Intergenic
1141315730 16:82961098-82961120 GCGCCAGCTCAGGGGGTGTGGGG - Intronic
1142233549 16:88910910-88910932 GTGCCAAGTGTGGGGATCTGGGG + Intronic
1142821899 17:2475752-2475774 GAGCAAACTGATGGAGTCTGGGG + Intronic
1144039153 17:11392983-11393005 GTGCGAATTGAGAGGTTCTGGGG + Intronic
1148209414 17:45799212-45799234 GTGCCAAGTGGAGGGGTCAGTGG - Intronic
1148442326 17:47717817-47717839 GTGCCCACTGTGGGGGACTAGGG - Intergenic
1148959225 17:51379296-51379318 ATGCCTAGTCAGGGGGTCTGGGG + Intergenic
1150143119 17:62746595-62746617 CTGAGAACTGAGGGGGTCTGAGG - Intronic
1151344672 17:73494324-73494346 ATGCCAGCTGAGGTGTTCTGTGG + Intronic
1151559727 17:74863880-74863902 GTGCCAGGTGAGAGGGTGTGAGG - Exonic
1151675585 17:75595785-75595807 CTGCCAACTGAGAGAGACTGGGG - Intergenic
1152321757 17:79611723-79611745 GGGCCTAGTGAGGGGGTTTGGGG - Intergenic
1154446399 18:14439008-14439030 GTGCCAGCCGAAGGGTTCTGTGG + Intergenic
1157602748 18:48904180-48904202 GGGCCAGCTGAGGTGGCCTGTGG + Intergenic
1157763791 18:50282984-50283006 GTGCCAGCTGACGAGGTATGCGG - Exonic
1160329627 18:77979518-77979540 GTGCCCACTGAGGAGGTCTGAGG - Intergenic
1160717341 19:582335-582357 GTTCCAGCTGTGGGGGTCGGGGG + Intronic
1161614546 19:5262777-5262799 GTGCCAGCTGGGGAGGGCTGAGG + Intronic
1164194816 19:22947078-22947100 GCCCCAACTGAGGAGGTCTCAGG + Intergenic
1165819655 19:38666347-38666369 GTGACAACCGATGGGGGCTGGGG + Intronic
1166324361 19:42040200-42040222 GTGGCAGCTGAGAGTGTCTGTGG - Intronic
1167556176 19:50197391-50197413 GAGCCAAATGAGGGTGTCAGGGG + Intronic
925462622 2:4076584-4076606 GTGCCAACAGAGGGTGTATCTGG + Intergenic
927693520 2:25224538-25224560 CTGCCCACTGAGGCGGTCTCAGG + Intergenic
927705702 2:25295163-25295185 GTGACAAGTGTGGGTGTCTGAGG - Intronic
928658400 2:33476482-33476504 GAGCCAACTCAGGGGTTATGAGG + Exonic
935223920 2:101037363-101037385 GTGACCACTGAGGTGGTCAGAGG - Intronic
937096211 2:119236818-119236840 GTGCCAAGTGCTGGGGTCTGAGG - Intronic
941110635 2:161416318-161416340 CTGTCTAGTGAGGGGGTCTGTGG + Exonic
941309816 2:163913893-163913915 GAGCCCACGGAGGGGGTCGGGGG - Intergenic
943680305 2:190761039-190761061 GAGCCCACGGAGGGGGTCGGAGG + Intergenic
946522282 2:220479427-220479449 GTCCCAGCTGAGGGAGGCTGAGG + Intergenic
947473215 2:230416236-230416258 GGGCCGACTGAGGGGCTCAGAGG + Intronic
947722984 2:232380521-232380543 GTGCCATCTGAGGCCATCTGAGG - Intronic
947727334 2:232408602-232408624 GTGCCATCTGAGGCCATCTGAGG - Intronic
947932023 2:233972553-233972575 GAGCCCACTGAGGGGGTGGGAGG + Intronic
948099464 2:235361982-235362004 GTGTTAACTGAGGGCGTGTGCGG - Intergenic
948242064 2:236446359-236446381 GTGCAAACAGATGGGGTCCGAGG + Intronic
1169324064 20:4661147-4661169 GAGACAACTCAGGGGGACTGGGG + Intergenic
1171536711 20:25898936-25898958 GGGGAAGCTGAGGGGGTCTGAGG + Intergenic
1172304051 20:33869097-33869119 GTGCCAAGGGTGGGGGACTGGGG + Intergenic
1175479606 20:59301803-59301825 GGGCTAACTGAGCGGGGCTGGGG - Intronic
1175938107 20:62524465-62524487 GGGCCACCTGAGGGGGGCTGAGG - Intergenic
1176020341 20:62959431-62959453 GAGCCTACTCTGGGGGTCTGGGG + Intronic
1176078816 20:63261429-63261451 GTTCCCACAGAGAGGGTCTGGGG - Intronic
1176412238 21:6455300-6455322 GTTCCAACTGGGGGCCTCTGAGG - Intergenic
1179687732 21:43063622-43063644 GTTCCAACTGGGGGCCTCTGAGG - Intronic
1182121677 22:27791231-27791253 GAGCCAAATGAAGTGGTCTGGGG - Intronic
1182449352 22:30409570-30409592 GAGCCAAAAGAGGGGGTCTGAGG + Intronic
1182761236 22:32723865-32723887 GTGCCACGTGAGGGGGCCTCAGG + Intronic
1183547268 22:38461146-38461168 GTGGCAACTGTGATGGTCTGTGG + Intergenic
1183998990 22:41658465-41658487 TTCCAAACAGAGGGGGTCTGGGG - Intronic
1184899212 22:47433822-47433844 GTGCCAAGCGAGCGGGTGTGTGG + Intergenic
1184982063 22:48101922-48101944 GTGCCCACTGATGGGCTCCGGGG + Intergenic
949259009 3:2083903-2083925 GAGCCCACGGAGGGGGTGTGAGG - Intergenic
953571822 3:44077199-44077221 GTGCCAATTCAGCAGGTCTGGGG + Intergenic
954216138 3:49125510-49125532 GAGCCAGGGGAGGGGGTCTGAGG + Intronic
954219354 3:49143576-49143598 GTGCCCACTGTGGGGGTCACAGG + Intergenic
955038976 3:55296534-55296556 GTGCCTGCTCAGGGGGTCAGAGG - Intergenic
955227908 3:57076293-57076315 GTCTCACCAGAGGGGGTCTGAGG - Intronic
958902952 3:99909396-99909418 GGGTCAGGTGAGGGGGTCTGGGG + Intronic
961066375 3:123880619-123880641 GTACCAACAGAGGGGGGATGGGG + Intronic
968964104 4:3760775-3760797 GTGGCAACCGAGAGGGTCGGGGG + Intergenic
971208625 4:24594283-24594305 GTGCAAACTGAGTGGGTTTCTGG - Intergenic
971310092 4:25518261-25518283 GTGCCAACTGATGGGGTTCCTGG + Intergenic
972392589 4:38627179-38627201 GTGCCCACGGAGGGGGTGGGAGG - Intergenic
983387705 4:167086510-167086532 CTGCTAACTGACGGGCTCTGTGG + Intronic
987896323 5:23951573-23951595 GAGCCAACGGAGGGGGTGGGAGG - Exonic
988366081 5:30301931-30301953 GTAACCAATGAGGGGGTCTGAGG - Intergenic
988831574 5:34992651-34992673 GTGCCAACTAAGGGAGTTTCTGG + Intergenic
993404560 5:87495096-87495118 GTTCCAACTGTGGTGGTATGTGG + Intergenic
994809942 5:104503213-104503235 GTGTCACCTGAGGGTGTCTCAGG + Intergenic
997978075 5:138451925-138451947 GTGCTAACTGAGGTGATCTCTGG - Intergenic
998430431 5:142065501-142065523 ATGGCAACTCAGGGGCTCTGTGG + Intergenic
1001333151 5:170776585-170776607 CTGCTAGATGAGGGGGTCTGAGG - Intronic
1004971029 6:20910589-20910611 GGGCACACAGAGGGGGTCTGAGG - Intronic
1005889668 6:30126970-30126992 TTGCCAACTGAATTGGTCTGTGG + Intergenic
1006431605 6:34000607-34000629 GTGCCCACTGAGGGGCTCTCTGG + Intergenic
1014454278 6:121619335-121619357 GTGCCAACTTGGGTGGGCTGTGG - Intergenic
1015882294 6:137881386-137881408 GTGGCAGCTGAGGGGTTCAGAGG - Exonic
1018722056 6:166580671-166580693 GGACCCACTGAGGGGGTCAGGGG - Intronic
1019217379 6:170452474-170452496 GTGCCTACTGAGGGGGTCCCAGG - Intergenic
1021130181 7:16902313-16902335 GTGCCAACTGAGGCCATTTGGGG - Intergenic
1021645711 7:22787494-22787516 TTGCCACCTGAGGGGGTCCTAGG - Intergenic
1022129680 7:27393598-27393620 GTGCCATCGGAGGGCCTCTGAGG - Intergenic
1023995598 7:45157532-45157554 GTGCCGGCTGATGGGCTCTGAGG - Intergenic
1024147800 7:46535048-46535070 ATGACAACAGAGGGTGTCTGTGG + Intergenic
1024342667 7:48283083-48283105 GAGCAAACTGTGGGGGCCTGGGG + Intronic
1026014510 7:66662489-66662511 ATGCCAGCTGAGGGTGTCTGAGG + Intronic
1027619868 7:80471127-80471149 GTACCAGCTGAGGGGAACTGAGG + Intronic
1029506939 7:100968461-100968483 GGGACAAAGGAGGGGGTCTGTGG + Intergenic
1034207441 7:149330149-149330171 GGGCCAACAGAGGGAGTCTACGG + Intergenic
1036745926 8:11409578-11409600 GTGCCAGCAGAGGGGGCCAGTGG + Intronic
1038419550 8:27423675-27423697 GAGCCAGCTGAGGGGCACTGGGG + Intronic
1040833589 8:51706915-51706937 CTGCCCACTGAAGGGGTCTCTGG + Intronic
1047283621 8:123467152-123467174 GTTCCAGCTGAGGGAGGCTGAGG - Intronic
1049330724 8:142049079-142049101 GTGCCCAGTGAGGGGGTGTGTGG - Intergenic
1049775219 8:144400897-144400919 GTGCCAGCTGAGGCAGGCTGTGG - Intronic
1049812520 8:144581835-144581857 GTGCCCCCAGCGGGGGTCTGAGG - Intronic
1053167322 9:35853830-35853852 GTGCCAGCTGAGAGGGGCTTTGG + Exonic
1053310751 9:37017755-37017777 GTGCCAACTGTGGAAGACTGCGG + Intronic
1053518711 9:38754701-38754723 GTGCAGACTGAGAGGGACTGTGG + Intergenic
1057453054 9:95182748-95182770 GTTCCAACTGCTGGGTTCTGGGG + Intronic
1058716231 9:107724335-107724357 TTGCCAATGGAGGGGGACTGTGG + Intergenic
1061212988 9:129204123-129204145 GTGCCAGATGTTGGGGTCTGCGG + Intergenic
1061408160 9:130403906-130403928 CTGGCAACTGAGGGGCTTTGAGG + Intronic
1061847233 9:133394569-133394591 CTGCAAGCTGAGGGGTTCTGAGG - Intronic
1062000448 9:134213292-134213314 GTGGCATCTGAGGGCGTCAGTGG + Intergenic
1062221376 9:135417884-135417906 GTGGCCCCTGAGAGGGTCTGCGG - Intergenic
1062245132 9:135562278-135562300 CTGCCAACTGAGGGGGCCTTGGG - Exonic
1062361755 9:136191590-136191612 GTGCCATCTCAGGAGGGCTGGGG - Intergenic
1062625063 9:137438821-137438843 GTCCCATCCGAGGGGGTCCGAGG - Intronic
1188060018 X:25590142-25590164 GTGCCAGCTGAGGTGGTCATAGG + Intergenic
1190569905 X:51770361-51770383 GGGCCAACTGGGAGTGTCTGGGG + Intergenic
1192164816 X:68821411-68821433 GAGCCCACTGTGGGGGTCTGAGG - Intergenic
1199610426 X:149607745-149607767 GTGCTAAATCATGGGGTCTGAGG + Intronic
1199741478 X:150740130-150740152 GTGACAGCTGAGGAGGGCTGTGG - Intronic
1200415866 Y:2909162-2909184 GTACCACCTGAGAGGGTGTGGGG + Intronic