ID: 1073339574

View in Genome Browser
Species Human (GRCh38)
Location 10:102734904-102734926
Sequence GGTGCCAACTGAGGGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339574_1073339583 22 Left 1073339574 10:102734904-102734926 CCCAGACCCCCTCAGTTGGCACC 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339574 Original CRISPR GGTGCCAACTGAGGGGGTCT GGG (reversed) Intronic
901492436 1:9603311-9603333 GGTGCCAGCTCAGTGGGTGTGGG + Intronic
904285606 1:29451645-29451667 GGTGCCAGACGAGGGGGTGTGGG - Intergenic
904969806 1:34410600-34410622 GGAGCCAACTGAGGGAGCATGGG - Intergenic
905586957 1:39127688-39127710 GGTGCCAACTTAAGGGGTCAGGG + Intronic
905905995 1:41618920-41618942 GGTGGCAACTGCGGGGGCCATGG - Intronic
910596986 1:88991812-88991834 GCGGCCACCTGAGGGGGACTGGG - Intronic
915103362 1:153516250-153516272 GGAGCCTAGAGAGGGGGTCTAGG - Intergenic
916488936 1:165284558-165284580 GTTCCCAGCGGAGGGGGTCTGGG - Intronic
917664785 1:177214569-177214591 GGTGCCAAATGAAGGGTACTTGG - Intronic
923506101 1:234608415-234608437 GCTGTGAAGTGAGGGGGTCTAGG - Intronic
923715239 1:236419610-236419632 GATTCCAACTAAGGCGGTCTGGG + Intronic
924694049 1:246381867-246381889 GGTGTCAGCTGGAGGGGTCTGGG - Intronic
924694112 1:246382092-246382114 GGTGTCAGCTGGAGGGGTCTGGG - Intronic
1062787880 10:280377-280399 GGTGCTAACTGAGGGGCACCTGG - Intronic
1068145986 10:53071355-53071377 CATGCTAACTGAGGGGGTCTGGG + Intergenic
1068657657 10:59591646-59591668 GGTGCCCACTGTGGTGGTCGTGG - Intergenic
1070328082 10:75400831-75400853 GGTGCCGAGTGAAGGGGCCTGGG + Intronic
1073339574 10:102734904-102734926 GGTGCCAACTGAGGGGGTCTGGG - Intronic
1074118668 10:110477021-110477043 GGTGACAGGTGATGGGGTCTTGG - Intergenic
1075661413 10:124199554-124199576 GGTGGCATCAGAGAGGGTCTGGG + Intergenic
1076197601 10:128531089-128531111 GGTGCCAAAGGATGGGGTTTGGG - Intergenic
1076735753 10:132458211-132458233 GGCACCCGCTGAGGGGGTCTAGG + Intergenic
1076758079 10:132585545-132585567 GGCGTCCACTGGGGGGGTCTTGG + Intronic
1077191996 11:1259470-1259492 GAGGATAACTGAGGGGGTCTGGG + Intronic
1077295730 11:1825465-1825487 GGAGCCAACTCAGGGGAGCTGGG + Intergenic
1078492357 11:11781255-11781277 GGTGTCTACTGAGTGGGTCTGGG + Intergenic
1081912463 11:46708559-46708581 GGGGTCAACAAAGGGGGTCTTGG + Intergenic
1082924656 11:58532219-58532241 GGAGCCCACTGTGGGGGTCTCGG - Intronic
1083137625 11:60693668-60693690 GATGCCAACTGATGTGGTTTTGG - Intergenic
1084111466 11:67016709-67016731 GGTCTCAGCTGAGGGTGTCTGGG + Intronic
1084604690 11:70165629-70165651 GGTGGCTCCTGCGGGGGTCTGGG + Intronic
1087871145 11:103294633-103294655 GGTGCCAGCTGCGGTGGTCAAGG - Intronic
1090911942 11:131129027-131129049 GGTGCCAATTGTGGTGGACTAGG + Intergenic
1093063589 12:14632817-14632839 GGTGCCAACAGTGGTGGACTGGG - Intronic
1096975792 12:55698670-55698692 CGTGCCACCTGAGGGAGGCTGGG - Intronic
1098010542 12:66046157-66046179 GGTTCCACCTCTGGGGGTCTGGG - Intergenic
1100915423 12:99415589-99415611 TGTGCCCACTGAGGGAATCTAGG - Intronic
1102073541 12:110041857-110041879 GGTGTCAGCTGTGGGGATCTTGG - Exonic
1104675552 12:130709836-130709858 GGGGCCTCCTGAGGGGGCCTGGG - Intronic
1105564464 13:21530686-21530708 GGTGGCCACTGAGGGGGTCGGGG + Intronic
1105723079 13:23135314-23135336 GCTGCCACCTGAGGTGGGCTGGG + Intergenic
1107706973 13:43117618-43117640 TGTGCCAACAGAGAGGGTCAGGG - Intergenic
1107871868 13:44754225-44754247 GGAGCTAACTGAGGGGGAGTTGG + Intergenic
1119470265 14:74892926-74892948 GGTGGCATCTGAGTGGGTATGGG - Exonic
1120688147 14:87562967-87562989 GGTCCAAGCTGAGGTGGTCTCGG + Intergenic
1121993416 14:98583006-98583028 GGAGCCAGAGGAGGGGGTCTGGG - Intergenic
1202902400 14_GL000194v1_random:51337-51359 GGTGCCAGGGGAGGGGGCCTGGG - Intergenic
1123706595 15:22955358-22955380 GGTGCCCACCCAGGGGGTCAAGG + Intronic
1124218457 15:27828771-27828793 GGTGGCAAGTGATAGGGTCTGGG + Intronic
1125831216 15:42718330-42718352 GGTGTCAAGTGATGGGGTGTTGG + Intronic
1126480265 15:49110999-49111021 GGTGCCAACTGTGGTGGTAGTGG - Intronic
1128525133 15:68407201-68407223 GGTGCCCAGTGAGGGGGTGGTGG + Intronic
1128534315 15:68479222-68479244 GGTGAGATCTGAGGGAGTCTGGG + Intergenic
1128878077 15:71218318-71218340 GGTGCCAACTGAAGGGATGGAGG + Intronic
1130239595 15:82174606-82174628 GGTGTCCACAGAGGGAGTCTTGG + Intronic
1131056032 15:89375717-89375739 GTTGCAAACTGAGGGGGGTTGGG - Intergenic
1133026904 16:2992500-2992522 GGTCCCAACAGATGGGCTCTTGG + Intergenic
1133221830 16:4322169-4322191 GGTGCCAAAGGAGAGGGCCTGGG + Intronic
1136242117 16:28951057-28951079 GGTGCCGGCCGAGGGGGTCGGGG + Exonic
1141315731 16:82961099-82961121 GGCGCCAGCTCAGGGGGTGTGGG - Intronic
1142233548 16:88910909-88910931 TGTGCCAAGTGTGGGGATCTGGG + Intronic
1142502238 17:339624-339646 GGTGCCAGCTTATGGGGCCTTGG - Intronic
1144843523 17:18203573-18203595 GTTGCCACCTGAGGAGGCCTGGG + Intronic
1146140495 17:30363781-30363803 GCTGCAAACTGAGGTGATCTAGG - Intergenic
1146922626 17:36723414-36723436 GGGGCCAGCAGAGGGGCTCTCGG + Intergenic
1147179312 17:38674510-38674532 GGTGCCCACTGAGCGGGTCCAGG + Exonic
1147189320 17:38729845-38729867 GGTGCCAACTGCGGGGGTGTAGG + Intergenic
1147311144 17:39596814-39596836 GGTGCCAGCTGCGGGGGTGGTGG - Intergenic
1148442327 17:47717818-47717840 TGTGCCCACTGTGGGGGACTAGG - Intergenic
1148740214 17:49888418-49888440 CTTGCAAACTGAGTGGGTCTTGG - Intergenic
1148858538 17:50592175-50592197 GTTGCCAACTTTGGGGGCCTGGG + Intronic
1150296365 17:64010115-64010137 GGTGCCAAATGAGGAGATCGGGG - Intronic
1151538212 17:74750337-74750359 GGTGCAAGCTGAAGGGGTCCTGG - Intronic
1152724095 17:81936835-81936857 GGTGCCATCTGTGGGGGCTTTGG - Exonic
1157991321 18:52499828-52499850 GGTGCAAACAGATGGGGACTCGG + Intronic
1162427269 19:10603846-10603868 GGCAGCATCTGAGGGGGTCTTGG + Intronic
1165101502 19:33441206-33441228 GGTGCCATCTCAGGAGGCCTTGG - Intronic
929998906 2:46847736-46847758 GGAGCCAACCGAGGAGGGCTGGG - Intronic
932526501 2:72475502-72475524 GGTGCCAACTGTGGAGGACAGGG + Intronic
932949979 2:76281650-76281672 GGTGCCACCTGCTGGGGACTGGG - Intergenic
934127814 2:88915615-88915637 GGCTCCAAGTGAGGGGGTATAGG - Intergenic
934504271 2:94879063-94879085 GGTGCCAGGGGAGGGGGCCTGGG + Intergenic
934818228 2:97348676-97348698 GGTGTCAAATGAGGGGGACATGG + Intergenic
934980375 2:98834317-98834339 GATGCCTACTGAGGGGCACTAGG - Intronic
935446172 2:103159008-103159030 GGCCCCCACTGAGGAGGTCTTGG - Intergenic
938381249 2:130837578-130837600 CGTCCCAACTGAGTGGGTCCCGG - Intronic
941309817 2:163913894-163913916 GGAGCCCACGGAGGGGGTCGGGG - Intergenic
1169029557 20:2396952-2396974 GCTGCCGACTGAGTAGGTCTTGG + Intronic
1172143726 20:32742537-32742559 GGTGCCAACCAAGGCAGTCTTGG - Intronic
1172193850 20:33078521-33078543 GATGCCAAGTGAAGTGGTCTGGG + Intergenic
1172304050 20:33869096-33869118 GGTGCCAAGGGTGGGGGACTGGG + Intergenic
1175886616 20:62295411-62295433 GGTGCCACCTGCGTGTGTCTTGG + Exonic
1175936532 20:62516793-62516815 GGTGCCCACTGAGGGGCCCTGGG + Intergenic
1176078817 20:63261430-63261452 GGTTCCCACAGAGAGGGTCTGGG - Intronic
1176111887 20:63414609-63414631 GGTGACTACTGATGGGGTCATGG + Intronic
1176621768 21:9066104-9066126 GGTGCCAGGGGAGGGGGCCTGGG - Intergenic
1179510640 21:41870968-41870990 TGTGCCAACTGAAAGGGACTTGG - Intronic
1181698700 22:24608037-24608059 GGTCCCAAGGAAGGGGGTCTGGG + Intronic
1182121678 22:27791232-27791254 GGAGCCAAATGAAGTGGTCTGGG - Intronic
1182422671 22:30256173-30256195 GGGCACCACTGAGGGGGTCTTGG + Intergenic
1182431532 22:30301809-30301831 GGTGCCAAGTGAGAGCTTCTGGG + Intronic
1184282595 22:43446661-43446683 GGTGGCAAGTGAGGCGGCCTGGG + Intronic
1184294537 22:43515347-43515369 GGTCCCATTTGAAGGGGTCTGGG - Intergenic
1184982062 22:48101921-48101943 GGTGCCCACTGATGGGCTCCGGG + Intergenic
951218008 3:20041666-20041688 GGTGACAGCTGAGGGGGGCGGGG + Intronic
952816967 3:37454046-37454068 GGTGCCTAGTGTGGGGATCTGGG - Intronic
954618054 3:51980355-51980377 GGTACCAGCTGAGGGGCACTGGG - Intronic
962566269 3:136663477-136663499 GGTGCTAACTGATTGGGTCATGG - Intronic
962994392 3:140611146-140611168 AGTGCTAAGTGAGGGGGACTGGG + Intergenic
965252471 3:166359959-166359981 TGGGCAAACTGAGGAGGTCTAGG + Intergenic
968964103 4:3760774-3760796 GGTGGCAACCGAGAGGGTCGGGG + Intergenic
969443757 4:7232733-7232755 GCTGCCTACTGAGGGGGCCCAGG - Intronic
977760980 4:100736559-100736581 GTTGCCAACTTATTGGGTCTTGG - Intronic
983369727 4:166842892-166842914 GGTGCCCATCGAGGGGGTTTGGG + Intronic
985514665 5:335390-335412 GGTGCCAGCTGAGGTGGTAGTGG + Intronic
985816187 5:2130054-2130076 GGTTCCAAGTGATGGGGTCAAGG - Intergenic
985821859 5:2166065-2166087 GTAGCCAGCTGAGGGGCTCTGGG + Intergenic
986270888 5:6229830-6229852 GGTGCCAACTGAGTGTCCCTTGG + Intergenic
989446108 5:41530705-41530727 GGGGAGAACTGAGGGGGTGTTGG + Intergenic
990713869 5:58614605-58614627 GGGGGCAAAAGAGGGGGTCTAGG - Intronic
992960075 5:81949358-81949380 GGTGCCACATCAGGGGGTTTAGG - Intergenic
994986509 5:106940511-106940533 GGTGACATCTGTGGCGGTCTGGG + Intergenic
996505882 5:124267144-124267166 GGCTCCACCTGAGAGGGTCTAGG + Intergenic
1001599488 5:172919754-172919776 GGTGCCAGCTGATGAGGTCATGG - Intronic
1004461777 6:15843302-15843324 GGATCTCACTGAGGGGGTCTAGG + Intergenic
1007156839 6:39753182-39753204 GTTACCGACTGAGGGTGTCTAGG - Intergenic
1011612931 6:89171022-89171044 GGTTCTAATTGAGTGGGTCTGGG + Intergenic
1016469707 6:144362240-144362262 GGAGCCAACTGAGGGAGGATAGG + Intronic
1018722057 6:166580672-166580694 GGGACCCACTGAGGGGGTCAGGG - Intronic
1021130182 7:16902314-16902336 GGTGCCAACTGAGGCCATTTGGG - Intergenic
1024914269 7:54481678-54481700 AGTGACAAATGAGGGGTTCTTGG + Intergenic
1027159386 7:75791348-75791370 GGTCCTGACTGAGGGGGCCTCGG - Intergenic
1029971986 7:104798933-104798955 GGTGTAAACTGAGGAGGACTTGG + Intronic
1034672773 7:152870641-152870663 GGTGAGAAGTGAGGTGGTCTTGG + Intergenic
1038419549 8:27423674-27423696 GGAGCCAGCTGAGGGGCACTGGG + Intronic
1042114427 8:65415269-65415291 GGTACCATCTGAGGGGAGCTGGG + Intergenic
1044913525 8:97087395-97087417 GGTGCCGACTTGGGGGGTCAAGG + Intronic
1049167638 8:141136614-141136636 GGTGCCAACTGCGGCACTCTCGG + Exonic
1053445570 9:38150569-38150591 GGTGTGAGCTGAGGGGGTTTTGG + Intergenic
1055714757 9:79104995-79105017 GGTGCCAAATAAGGTTGTCTGGG - Intergenic
1056243678 9:84672398-84672420 GGCCCCAACTGTGGTGGTCTTGG + Intronic
1057553164 9:96066852-96066874 GGGGACAGCTGAGGGGGGCTGGG + Intergenic
1062245133 9:135562279-135562301 CCTGCCAACTGAGGGGGCCTTGG - Exonic
1062361756 9:136191591-136191613 GGTGCCATCTCAGGAGGGCTGGG - Intergenic
1187978700 X:24731606-24731628 TGTCACAACTCAGGGGGTCTGGG + Intronic
1189554898 X:42132203-42132225 TGTGCCTATTGAGGGAGTCTTGG - Intergenic
1190445265 X:50517600-50517622 GGTGCCATCTGTGTGGGTCCAGG - Intergenic
1190569904 X:51770360-51770382 GGGGCCAACTGGGAGTGTCTGGG + Intergenic
1196986740 X:121282090-121282112 GTTGCCAACTGTGGTGGACTGGG + Intergenic
1201158288 Y:11151557-11151579 GGTGCCAGAGGAGGGGGCCTGGG - Intergenic