ID: 1073339575

View in Genome Browser
Species Human (GRCh38)
Location 10:102734905-102734927
Sequence AGGTGCCAACTGAGGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339575_1073339583 21 Left 1073339575 10:102734905-102734927 CCAGACCCCCTCAGTTGGCACCT 0: 1
1: 0
2: 1
3: 23
4: 149
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339575 Original CRISPR AGGTGCCAACTGAGGGGGTC TGG (reversed) Intronic
900416232 1:2535976-2535998 AGCTGCCCACTGAGGGGGGCTGG - Intergenic
903603246 1:24556854-24556876 AGGTGGCATCTGAGTGGGGCAGG + Intronic
903657474 1:24958151-24958173 AGGTGCCACATGCGGGGCTCAGG + Intronic
904285607 1:29451646-29451668 AGGTGCCAGACGAGGGGGTGTGG - Intergenic
904969807 1:34410601-34410623 AGGAGCCAACTGAGGGAGCATGG - Intergenic
905014742 1:34770082-34770104 AGGAGCTAAGTGAGGGGGTCGGG - Intronic
905586956 1:39127687-39127709 TGGTGCCAACTTAAGGGGTCAGG + Intronic
905875872 1:41431869-41431891 AGGTGCCCCCTGCCGGGGTCTGG + Intergenic
910465029 1:87490024-87490046 AGCTGCCAAATGAGCTGGTCTGG + Intergenic
911360049 1:96864754-96864776 AAGTGCCAAAAGAGGGGCTCAGG - Intergenic
913655921 1:120959506-120959528 AGGTGCAAATTGTGGGGGCCTGG + Intergenic
914203847 1:145509775-145509797 AGATGTCAACTCAGGGGGTCAGG - Intergenic
914359860 1:146925104-146925126 AGCTGCCAAATGAGCTGGTCTGG + Intergenic
914482970 1:148082929-148082951 AGATGTCAACTCAGGGGGTCAGG - Intergenic
914493891 1:148174790-148174812 AGCTGCCAAATGAGCTGGTCTGG - Intergenic
914520475 1:148410738-148410760 AGGTGCAAATTGTGGGGGCCTGG + Intergenic
915311093 1:155006136-155006158 AGATGGCAACTCAGGGGGCCAGG - Intronic
915657943 1:157377059-157377081 AGGGAACTACTGAGGGGGTCAGG + Intergenic
919493800 1:198238477-198238499 AGGTGGCAAGAGAGTGGGTCAGG - Intronic
919829697 1:201531730-201531752 TGGTGCCCAGGGAGGGGGTCAGG + Intergenic
922748828 1:228061442-228061464 AGATGCCCACTCAGGGGCTCAGG + Intergenic
923715238 1:236419609-236419631 AGATTCCAACTAAGGCGGTCTGG + Intronic
924694050 1:246381868-246381890 AGGTGTCAGCTGGAGGGGTCTGG - Intronic
924694113 1:246382093-246382115 AGGTGTCAGCTGGAGGGGTCTGG - Intronic
1062968313 10:1626986-1627008 AGGTGGGACCTGAGTGGGTCAGG - Intronic
1063540399 10:6927929-6927951 AGGTGCCAACTGATAGAGACAGG - Intergenic
1064025913 10:11848700-11848722 AGGTGCAAACTGGGGGGATGAGG - Intronic
1064721786 10:18236498-18236520 GGGGGCCTACTGAGGGGCTCTGG - Intronic
1065758786 10:28962113-28962135 AGGTGCCAGCAGATGGAGTCTGG - Intergenic
1067443455 10:46326319-46326341 AAGTGCCAGCTGTGGGGCTCAGG - Intronic
1068145985 10:53071354-53071376 GCATGCTAACTGAGGGGGTCTGG + Intergenic
1068523847 10:58106099-58106121 TGGTGCCCACTCAGGGGGACCGG - Intergenic
1072392001 10:94996913-94996935 AATTGCCAAATGAGGGGGTTGGG + Intergenic
1073339575 10:102734905-102734927 AGGTGCCAACTGAGGGGGTCTGG - Intronic
1073560934 10:104496251-104496273 GGGTGCCAACTGACTGGGGCTGG - Intergenic
1073634155 10:105180250-105180272 AGGTGACAACTGAGTTGGTCTGG + Intronic
1075661412 10:124199553-124199575 AGGTGGCATCAGAGAGGGTCTGG + Intergenic
1076459659 10:130632908-130632930 AGGTGGGAGCTGAGTGGGTCTGG + Intergenic
1078492356 11:11781254-11781276 AGGTGTCTACTGAGTGGGTCTGG + Intergenic
1079657013 11:22996979-22997001 AATTGCCAAATGAGGGGGTCTGG + Intergenic
1080204463 11:29712932-29712954 AGGAGCCCACTGTGGGGGTTGGG - Intergenic
1090277960 11:125432690-125432712 GGGTGCCAACCAAGGGGGTCTGG - Exonic
1091634447 12:2186421-2186443 AGGTGGCCGCTGAGGGGGTAAGG + Intronic
1091784258 12:3232790-3232812 AGGTGCCCACTGAGAGTGGCTGG - Intronic
1093063590 12:14632818-14632840 AGGTGCCAACAGTGGTGGACTGG - Intronic
1097757044 12:63418008-63418030 AATTGCCAAATGAGGGGGTTTGG - Intergenic
1098747892 12:74263988-74264010 AGGTGCCACCCCAGGGGGTCTGG - Intergenic
1100776451 12:97979711-97979733 AGGTGCCAACAGTGGTGGACAGG - Intergenic
1103678683 12:122676719-122676741 AGGAGCCCACGGAGGGGGTTGGG + Intergenic
1104675553 12:130709837-130709859 AGGGGCCTCCTGAGGGGGCCTGG - Intronic
1105564463 13:21530685-21530707 GGGTGGCCACTGAGGGGGTCGGG + Intronic
1107706974 13:43117619-43117641 CTGTGCCAACAGAGAGGGTCAGG - Intergenic
1108072945 13:46648117-46648139 AGGTCCCATCTGAGGGGGATGGG + Intronic
1114150205 14:20030144-20030166 AGGTGACTACTGTGGGGGACAGG + Intergenic
1116725650 14:48558645-48558667 AATTGCCAACTGAGGGAGTTTGG - Intergenic
1119972015 14:78981423-78981445 AGGTGGCAAGTGAGAGGGTGAGG - Intronic
1122736874 14:103848120-103848142 AGGTGCCAGCCAAGGGCGTCGGG - Intergenic
1124804237 15:32865120-32865142 AGGTGACAGCTAAGGGGGTAAGG + Intronic
1126423297 15:48498752-48498774 ACTTGGCCACTGAGGGGGTCAGG - Intronic
1127616553 15:60691574-60691596 AAGTGCTAACTGAGAAGGTCGGG + Intronic
1128767113 15:70257952-70257974 AGGGGCCATCTGAGGGGTTCAGG + Intergenic
1131398974 15:92109672-92109694 AGGTGCCAGCTGAGTGGGCAGGG + Intronic
1132511054 16:341541-341563 AGGAGCCCACGGAGGGGGTGGGG - Intronic
1132522467 16:397834-397856 AGGTGGCAGCTGGGGGGGCCGGG - Intronic
1133283134 16:4678236-4678258 AGGTCCCCACTGAGGGCGCCTGG - Intronic
1136242116 16:28951056-28951078 CGGTGCCGGCCGAGGGGGTCGGG + Exonic
1138036164 16:53608963-53608985 AGGTGCCAAGTGACTGGCTCAGG - Intronic
1139164813 16:64553416-64553438 AGGTGTCAAGTGAGGAGATCAGG - Intergenic
1141097417 16:81172752-81172774 AGGTGACAAACGATGGGGTCAGG - Intergenic
1141621799 16:85240345-85240367 CTGAGCCAACTGAGGGGCTCTGG - Intergenic
1148284313 17:46373976-46373998 AGGTGACAGCTGTGGGGGTGGGG - Intergenic
1148306534 17:46591897-46591919 AGGTGACAGCTGTGGGGGTGGGG - Intronic
1150296366 17:64010116-64010138 GGGTGCCAAATGAGGAGATCGGG - Intronic
1151686799 17:75652331-75652353 GGGTGCCAACTGAAGGGCTTGGG - Intronic
1151999953 17:77639014-77639036 AGCTGCCTGCTGAGGGGGTGTGG + Intergenic
1154387967 18:13912506-13912528 AGCTGGGAACTGAGGGGCTCAGG + Intronic
1158441624 18:57479842-57479864 ACCTGCTCACTGAGGGGGTCTGG - Exonic
1159992140 18:74921254-74921276 GGGTGGCAAGTGAGGGGCTCTGG + Intronic
1160717339 19:582333-582355 AAGTTCCAGCTGTGGGGGTCGGG + Intronic
1161261021 19:3337723-3337745 AGGTGGTAAAGGAGGGGGTCAGG - Intergenic
1162933047 19:13966681-13966703 AGGTGCTGCCTGAGGGCGTCGGG - Exonic
1163082465 19:14953940-14953962 AGTTGCCACCTGAGGCTGTCAGG - Intronic
1163786029 19:19275385-19275407 AGGTGCCAAGTGTGGGGACCAGG - Intergenic
1168628050 19:57934509-57934531 AAGAACCCACTGAGGGGGTCGGG - Intronic
925440468 2:3880929-3880951 AGGTGCCAACAGAGTGTGTCTGG - Intergenic
927200368 2:20574667-20574689 AGGTGCCCACTGAGTGGGGCTGG - Intronic
927326635 2:21812755-21812777 AGGTGCCAACAGAGGGGAAATGG - Intergenic
927672690 2:25082284-25082306 AGGAGCCAGCTAAGGGGGTTGGG + Intronic
929153690 2:38771045-38771067 GGGTGCCAACTGAGGAGATGAGG + Intronic
929252054 2:39768974-39768996 AAGGGCCAACTGATGAGGTCTGG + Intronic
929998907 2:46847737-46847759 AGGAGCCAACCGAGGAGGGCTGG - Intronic
930221342 2:48749628-48749650 AGAAGCCAACTGAGGGGCTTAGG + Intronic
932526500 2:72475501-72475523 AGGTGCCAACTGTGGAGGACAGG + Intronic
932949980 2:76281651-76281673 AGGTGCCACCTGCTGGGGACTGG - Intergenic
934968121 2:98740824-98740846 AGAAGCCAACTGAGGGGCTGAGG + Intergenic
935939179 2:108220809-108220831 AGGTCCCAGCTGTGCGGGTCAGG + Intergenic
941309818 2:163913895-163913917 AGGAGCCCACGGAGGGGGTCGGG - Intergenic
945563743 2:211370483-211370505 AAGTGCGGGCTGAGGGGGTCCGG + Intergenic
946477200 2:220018424-220018446 AGGTGCCCACAGGGGGAGTCTGG - Intergenic
947215218 2:227744027-227744049 AGGAACCAACTGAGGGAGTCTGG + Intergenic
948693816 2:239722763-239722785 AGGTACCACCTGAGTGGGGCCGG - Intergenic
1168749426 20:271680-271702 AAGTGCCAACTGAAGGAGTGAGG - Intronic
1169509706 20:6250253-6250275 AGGCGCTAACTGAGGGCCTCAGG + Intergenic
1171364347 20:24613571-24613593 AGGTGCCAAGGCAGGGGGTGCGG - Intronic
1171470868 20:25370252-25370274 GGGTGCCAGCTGAGGGAGTAGGG - Intronic
1173230494 20:41192366-41192388 AGGTGCCAACCAAGGTGGGCAGG + Intronic
1174444368 20:50580520-50580542 AGGTGTCCGCTGAGGTGGTCAGG + Intronic
1175936531 20:62516792-62516814 CGGTGCCCACTGAGGGGCCCTGG + Intergenic
1176255427 20:64149551-64149573 AGATGGCAACTGATGGGGGCTGG + Intergenic
1177268273 21:18811662-18811684 AGGTGCCAACTGAGGAAGTGAGG + Intergenic
1180701577 22:17784235-17784257 AGCTGCCTGCTGAGGCGGTCTGG + Intergenic
1181018823 22:20087571-20087593 AGGGGACTTCTGAGGGGGTCAGG + Intronic
1181622551 22:24100979-24101001 GGGTGCAAACTGAGGGGGACTGG - Intronic
1182431531 22:30301808-30301830 AGGTGCCAAGTGAGAGCTTCTGG + Intronic
1184282594 22:43446660-43446682 AGGTGGCAAGTGAGGCGGCCTGG + Intronic
1184982061 22:48101920-48101942 TGGTGCCCACTGATGGGCTCCGG + Intergenic
949393529 3:3589870-3589892 AGCTGCAAACTGAGGGGGTTGGG + Intergenic
950228049 3:11252107-11252129 AATTGCCAAATGATGGGGTCTGG + Intronic
950594830 3:13970540-13970562 AATTGCCAAATGAGGGGGTTTGG + Intronic
951218007 3:20041665-20041687 GGGTGACAGCTGAGGGGGGCGGG + Intronic
954618055 3:51980356-51980378 AGGTACCAGCTGAGGGGCACTGG - Intronic
956539829 3:70324025-70324047 AGCTGCCAAAGAAGGGGGTCAGG - Intergenic
966096750 3:176213498-176213520 AGGAGCCCACTGCGGGGGCCGGG + Intergenic
966770792 3:183501610-183501632 AGGTGCCAGCCCTGGGGGTCAGG - Intronic
967913364 3:194559974-194559996 AGGTGGAGACTGAGGGGCTCTGG - Intergenic
968521330 4:1036009-1036031 GGGTCCCAACTGTGTGGGTCGGG + Intergenic
968964102 4:3760773-3760795 CGGTGGCAACCGAGAGGGTCGGG + Intergenic
976155833 4:82143933-82143955 TCTTGCTAACTGAGGGGGTCTGG - Intergenic
977846439 4:101773238-101773260 TGGTGCCAACTGAAGTGATCAGG + Intronic
979755896 4:124339289-124339311 AGGAGCCCACCGAGGGGGTGGGG - Intergenic
983008107 4:162510368-162510390 AGCTGACACCTGAAGGGGTCAGG - Intergenic
985706614 5:1405285-1405307 AGTTGCCAGCAGAGGGGTTCCGG - Intronic
987100612 5:14588372-14588394 AGGAGGGAACTGAGGGAGTCAGG - Intronic
988006612 5:25419990-25420012 ATGTGACCACTGAGAGGGTCAGG + Intergenic
989043200 5:37249576-37249598 AGAAGTGAACTGAGGGGGTCCGG - Intergenic
990115326 5:52382674-52382696 AGTGGGAAACTGAGGGGGTCTGG - Intergenic
994092678 5:95822727-95822749 AGGAGCCAACTGGCTGGGTCGGG - Intronic
997209193 5:132067658-132067680 AGGGGCCAAGTCAGGGTGTCAGG + Intergenic
997373882 5:133383245-133383267 AGGTACCATCTGAAGGGGTGGGG + Intronic
998126771 5:139629190-139629212 AGGTGCCAATTGAAGGGGTTTGG + Intergenic
999493425 5:152073659-152073681 GGGGGCCAACCTAGGGGGTCTGG + Intergenic
1001931674 5:175677663-175677685 AGGTGCCTCCTGAGGGTATCAGG - Intronic
1006183196 6:32166265-32166287 AGGTGACAACAGAGGGGGTAGGG + Exonic
1010716090 6:79232375-79232397 AGGTACCAACTGAGGTCGTTAGG + Intronic
1011612930 6:89171021-89171043 AGGTTCTAATTGAGTGGGTCTGG + Intergenic
1014215862 6:118752124-118752146 AGGTGCCAATTGATTGGATCTGG + Intergenic
1015830009 6:137358525-137358547 AGATGCCAACTGAGAGGCCCTGG - Intergenic
1018722058 6:166580673-166580695 GGGGACCCACTGAGGGGGTCAGG - Intronic
1021130183 7:16902315-16902337 AGGTGCCAACTGAGGCCATTTGG - Intergenic
1023312579 7:38902862-38902884 AGGTGCTAGCTGAGGGGTACGGG - Intronic
1028445352 7:90915521-90915543 TGATTCCAACTGAGGGGCTCAGG - Intronic
1036651499 8:10646925-10646947 AGCTGACAACTGAGGGGGGGAGG - Intronic
1039711763 8:40062144-40062166 AGGTGCCAACAGTGGTGGACGGG - Intergenic
1048506952 8:135030371-135030393 AGGTGCTGGATGAGGGGGTCAGG + Intergenic
1048987490 8:139742548-139742570 AGGGGCCACCAGAGAGGGTCAGG + Intronic
1049004552 8:139846393-139846415 TGGTGCCAACTGGTGGGGCCTGG - Intronic
1053175406 9:35918819-35918841 AGGTGGCCTCTGAGGGGGTCAGG + Intergenic
1055300587 9:74878008-74878030 AGGTGCCAACTGTGGTGGGTGGG - Intronic
1055469896 9:76601007-76601029 AGGTGCCAGCCGAGGGGCACAGG - Intergenic
1055714758 9:79104996-79105018 AGGTGCCAAATAAGGTTGTCTGG - Intergenic
1056972287 9:91216279-91216301 AGCTCCCAAGTGAGGGAGTCAGG - Intronic
1059438394 9:114289594-114289616 AGAAGTCAATTGAGGGGGTCTGG + Intronic
1061382399 9:130266193-130266215 CGGGGCCAACTGAGGGGGTCAGG - Intergenic
1061862698 9:133476084-133476106 AGGTGCTGACTGAGTGGGGCCGG + Intronic
1062428864 9:136518112-136518134 AGGTGCCAGCACAGGGGGTGCGG - Intronic
1185550409 X:979515-979537 GCGTGCCAACTGAGGGGACCTGG - Intergenic
1191064205 X:56330584-56330606 AGGTGCCACCTGTGGGGGCAGGG - Intergenic
1192334196 X:70203976-70203998 TGGTGCAAACTGAGGAGCTCTGG + Intronic
1192347487 X:70322965-70322987 TGGTGCAAACTGAGGAGCTCTGG - Intronic
1195701054 X:107706028-107706050 AGGTGGGAAGTGAGGGGGTGGGG + Intergenic
1195784199 X:108500718-108500740 AGGTGACAACTTAGGGGTGCTGG + Intronic
1196986739 X:121282089-121282111 AGTTGCCAACTGTGGTGGACTGG + Intergenic
1197275850 X:124478109-124478131 AGTTGTAAACTGAAGGGGTCAGG - Intronic
1202109871 Y:21407479-21407501 AGGAGCCCACGGAGGGGGTGGGG - Intergenic