ID: 1073339577

View in Genome Browser
Species Human (GRCh38)
Location 10:102734910-102734932
Sequence ATGCCAGGTGCCAACTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339577_1073339583 16 Left 1073339577 10:102734910-102734932 CCCCCTCAGTTGGCACCTGGCAT 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339577 Original CRISPR ATGCCAGGTGCCAACTGAGG GGG (reversed) Intronic
901219227 1:7573595-7573617 TTGCCAGGAGCCAGCGGAGGCGG - Intronic
901470589 1:9453837-9453859 ATGCCAAGTGCCGCCAGAGGTGG + Intergenic
902196815 1:14804158-14804180 TTGCCAGGAGCCAAGTGTGGAGG - Intronic
902737015 1:18407958-18407980 ATGCCAGGTGCTGCCTGGGGAGG + Intergenic
908140588 1:61180181-61180203 AAGCCAGGGGCTAACTGGGGTGG - Intronic
910695809 1:90014124-90014146 ATTCCAGGTGTCATATGAGGAGG - Intronic
912755875 1:112324620-112324642 AAGCCAAGTGCCCAGTGAGGAGG - Intergenic
913279277 1:117170490-117170512 ATGCCAGGTGCCACTTGAGAAGG + Intronic
920788132 1:209062435-209062457 ATGACAGATGACCACTGAGGGGG - Intergenic
921179190 1:212618372-212618394 ATGCCAGTTGCAGAATGAGGAGG + Intronic
922695144 1:227727603-227727625 GTCCCATGTGCAAACTGAGGGGG - Intergenic
922995132 1:229951245-229951267 ATGCCAGGTCCAAATTGAGATGG - Intergenic
1063917317 10:10896600-10896622 AGGACAGGTGACAACAGAGGCGG + Intergenic
1067271515 10:44795666-44795688 AAGCCATGTGCCAACTGAATGGG + Intergenic
1067478369 10:46580347-46580369 ATGCTAGGACCCAACTGAGCAGG + Exonic
1067616369 10:47761440-47761462 ATGCTAGGACCCAACTGAGCAGG - Intergenic
1067936120 10:50613529-50613551 TTGCCAGGGGCCGACTGAAGAGG - Intronic
1072770825 10:98135640-98135662 ATGCCAGGTTCCTAGTGAAGAGG + Intronic
1072930844 10:99660242-99660264 AGGCTAGGTGCCACTTGAGGAGG + Intronic
1073132711 10:101200612-101200634 ATGCCTGTTGCCAAATGAGGAGG - Intergenic
1073202418 10:101746445-101746467 ATTACAGGTGCCCACTGTGGAGG - Intergenic
1073339577 10:102734910-102734932 ATGCCAGGTGCCAACTGAGGGGG - Intronic
1074156843 10:110807240-110807262 ATCCCAGGTCCCCAGTGAGGGGG - Intronic
1076454218 10:130578287-130578309 CTGCCAGGAGCCAAGTGAGAGGG - Intergenic
1086983458 11:93223764-93223786 ATCCCAGGTATAAACTGAGGTGG + Intergenic
1087301601 11:96442741-96442763 GTGCCAGGTGGCAAGTGATGAGG + Intronic
1088536558 11:110867902-110867924 AGGCCAGGTGCCAAATGCGCAGG + Intergenic
1089660570 11:119982688-119982710 GTGCCAGGAGCCCACAGAGGGGG + Intergenic
1090903250 11:131050968-131050990 GTGCAAGTTCCCAACTGAGGTGG + Intergenic
1094490890 12:30959985-30960007 GAGCCGGGAGCCAACTGAGGTGG + Intronic
1095569232 12:43664182-43664204 TTGACAGGGGCAAACTGAGGTGG - Intergenic
1104187424 12:126446107-126446129 TTGCCAGATGCCAACTGTGATGG - Intergenic
1109685395 13:65813043-65813065 AGGCAAGGGGCCAACTGAGTTGG + Intergenic
1111456899 13:88496198-88496220 CTGCCTGGTTCCAACTGAGCTGG + Intergenic
1111842516 13:93467929-93467951 ATGCCAGGTGACACTTGTGGTGG + Intronic
1113752917 13:112788702-112788724 ATGCCAGGTGCGAATTAAGTAGG - Intronic
1114664451 14:24369634-24369656 CTCCCAGGTGCCAGGTGAGGGGG - Exonic
1118847065 14:69555436-69555458 AAGCAAAGTGCCAACTCAGGGGG + Intergenic
1120603038 14:86536449-86536471 ATGCCAGGTGAGAACTGTTGTGG - Intergenic
1121668966 14:95693533-95693555 ATGCCAAATGCCTCCTGAGGGGG + Intergenic
1122237664 14:100341354-100341376 ATACCAGCTTCCAACTGAGTGGG + Intronic
1122879638 14:104684564-104684586 TTGGCAGGTGCCCACGGAGGGGG + Intergenic
1128318777 15:66678289-66678311 ATGCCAGCTGCCCAAAGAGGAGG + Intronic
1129581987 15:76821329-76821351 ATGGCAGGGGCCAAGTAAGGTGG + Intronic
1130103582 15:80912387-80912409 ATGCCAGCTGCAAACTGGGAGGG + Intronic
1130146002 15:81273991-81274013 TTGCCAGGTTTCAACTCAGGAGG + Intronic
1131398972 15:92109667-92109689 ATAGCAGGTGCCAGCTGAGTGGG + Intronic
1132241521 15:100261239-100261261 ATGCCATGTGACAATGGAGGAGG + Intronic
1132318097 15:100904966-100904988 ATTCACGGTGCCAACTGAGCAGG + Intronic
1133287287 16:4696581-4696603 CGCACAGGTGCCAACTGAGGTGG - Exonic
1135052882 16:19206712-19206734 ATGCCAGGTGAGGACAGAGGTGG - Intronic
1135359009 16:21795225-21795247 ATGCCAGGTCCCCACTTAGTGGG - Intergenic
1135457563 16:22611662-22611684 ATGCCAGGTCCCCACTTAGTGGG - Intergenic
1137024326 16:35457540-35457562 TTGCCATCTTCCAACTGAGGAGG + Intergenic
1141706612 16:85668648-85668670 ATGACAGGTGCCACCAGAGCTGG - Intronic
1142276952 16:89123795-89123817 AGGCCAGCTGCCACCTGGGGAGG - Intronic
1144582255 17:16465673-16465695 ATCCCAGTTGCCAACCCAGGAGG + Intronic
1144843520 17:18203567-18203589 ATTCCTGTTGCCACCTGAGGAGG + Intronic
1145277521 17:21442103-21442125 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1145294609 17:21578342-21578364 GTTCCAGGTGCCCACAGAGGTGG - Intergenic
1145315357 17:21727997-21728019 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1145369226 17:22294832-22294854 GTTCCAGGTGCCCACAGAGGTGG + Intergenic
1145713790 17:26999934-26999956 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1147147557 17:38494121-38494143 TTGCCAAGTGCCCACTGGGGTGG + Intronic
1147904317 17:43813068-43813090 ATGCCTGGTGGCTACTGAGAGGG - Intronic
1149478647 17:56984346-56984368 AATCCAGGGGCCAATTGAGGTGG - Intronic
1151216816 17:72582774-72582796 TTGTCAGGTACCAACTTAGGGGG - Intergenic
1151352886 17:73542211-73542233 ATCCCTGGTGCCTTCTGAGGTGG + Intronic
1155590741 18:27424479-27424501 ATGCTAAGTGCCAACAGAGAAGG - Intergenic
1155967845 18:32052621-32052643 ATGACAAGTGCCATTTGAGGAGG - Intronic
1156417912 18:36917736-36917758 ATGTCAGATGGAAACTGAGGTGG - Intronic
1156686744 18:39658320-39658342 ATGCTGTGTGCAAACTGAGGTGG - Intergenic
1157293846 18:46427815-46427837 CTGCCAGGTGCCAAAGGAGTGGG + Intronic
1160148883 18:76384611-76384633 ACGCCAGGTCCCAACTGTAGGGG - Intronic
1160329628 18:77979525-77979547 AGGACTGGTGCCCACTGAGGAGG - Intergenic
1162429054 19:10616026-10616048 GTGACATGTGCCAGCTGAGGTGG + Intronic
1166307435 19:41942739-41942761 ATTCCAGGTGCCAAGTTGGGGGG - Intergenic
925801615 2:7607650-7607672 CTCCCAGGAGCCAAATGAGGAGG + Intergenic
925885855 2:8393191-8393213 GTCCCAGTTACCAACTGAGGAGG + Intergenic
927152164 2:20202512-20202534 ATGCCAGGTGCTGGCTGTGGTGG + Exonic
927200371 2:20574672-20574694 AAGCCAGGTGCCCACTGAGTGGG - Intronic
927672687 2:25082279-25082301 AAGCCAGGAGCCAGCTAAGGGGG + Intronic
929397020 2:41534646-41534668 ATGCCAGGTTGCAACTGAAGTGG + Intergenic
929490068 2:42388194-42388216 ATGCCAGGTGCTCAGGGAGGGGG - Intronic
929998909 2:46847742-46847764 AAGGCAGGAGCCAACCGAGGAGG - Intronic
933089724 2:78105733-78105755 GTGCCAGGTTCTAACTGAGTGGG + Intergenic
934072043 2:88393283-88393305 ATGCCAGGTGCCAGGTGTGGTGG - Intergenic
934765161 2:96876415-96876437 ATGCCAGGGGCCGAGTGAGCAGG + Intronic
934952062 2:98583411-98583433 ATGCCACGTGAGGACTGAGGGGG - Intronic
939009737 2:136831953-136831975 TTGCTAGGTGCCAAATGAGCAGG - Intronic
940861061 2:158771296-158771318 AGGCCCGGTGCCTTCTGAGGGGG - Intergenic
940868266 2:158838136-158838158 GTGGCAGGTGCAAGCTGAGGTGG + Intronic
942085134 2:172436526-172436548 ATGCCAGAAGCCAGCTGAGAAGG + Intronic
942985137 2:182131902-182131924 AAGCCAGGTGAGAACAGAGGAGG + Intergenic
943649583 2:190442506-190442528 AAGCCAGGAGCCCACTGAGAAGG + Intronic
944470809 2:200051773-200051795 GTGCCAGCTGCCATCTTAGGAGG - Intergenic
946184564 2:217972569-217972591 GTCCCAAGTACCAACTGAGGCGG - Intronic
947433731 2:230054066-230054088 ATCCCAGGTGCAGCCTGAGGTGG + Intronic
948316751 2:237033054-237033076 ACCCCAGGGGCCAACTGAGAGGG - Intergenic
1169981874 20:11393944-11393966 GTGACAGGTGCCTACTCAGGAGG - Intergenic
1170455404 20:16528226-16528248 AAGCCAGGTGCAAGCTGACGTGG + Intronic
1174695418 20:52551876-52551898 ATGCCATGTGGCCACTGTGGGGG + Intergenic
1174854614 20:54031501-54031523 ATGTCAGGTGCCCACCTAGGAGG - Intronic
1175530422 20:59671152-59671174 ATCACAGGAGCCAACTGAAGGGG + Intronic
1175831424 20:61967069-61967091 ATGCCACGTGATGACTGAGGGGG - Intronic
1179624296 21:42639790-42639812 ATGCCAGATTCCAAATGACGTGG + Intergenic
1179646208 21:42777900-42777922 ATGCCAGCTCCCAACTGCGAGGG - Intergenic
1181866106 22:25856737-25856759 ATGCCAAGTGCCAAGTAAAGGGG + Intronic
1184943114 22:47783051-47783073 GTGCCAGGTGCTCACTCAGGGGG + Intergenic
1185098282 22:48823313-48823335 AGGGCAGGTGACAGCTGAGGAGG - Intronic
954328362 3:49875942-49875964 AAGGAAGGTGCCAACTGAGGAGG - Intergenic
955572090 3:60318976-60318998 AGGCCATGTGACAACAGAGGCGG - Intronic
958906681 3:99949339-99949361 AAGCCAGTTGCCAACTATGGAGG - Intronic
962041581 3:131712984-131713006 ATGCCACCTGCCAACCCAGGTGG + Intronic
964449892 3:156801918-156801940 AGGCCTGCTGCCAACTGAGGAGG + Intergenic
965480709 3:169215875-169215897 CTGCTAGATGCCAGCTGAGGCGG - Intronic
967865617 3:194187562-194187584 CAGCAAGGTGCCAACTGAGAGGG + Intergenic
967904904 3:194491549-194491571 ATGCCAGGTGAGAGATGAGGGGG - Intronic
967904910 3:194491573-194491595 ATGCCAGGTGAGAGATGAGGAGG - Intronic
967904933 3:194491672-194491694 ATGCCAGGTGAGAGATGAGGGGG - Intronic
967904939 3:194491696-194491718 ATGCCAGGTGAGAGATGAGGAGG - Intronic
967904962 3:194491795-194491817 ATGCCAGGTGAGAGATGAGGGGG - Intronic
967904968 3:194491819-194491841 ATGCCAGGTGAGAGATGAGGGGG - Intronic
968185960 3:196633828-196633850 ATGCCAGGTCCCACCCCAGGAGG + Intergenic
975451796 4:74536842-74536864 TTGCAAGGTGACAACTGTGGTGG + Intergenic
976729477 4:88247545-88247567 ATGCCAGGTAATAACAGAGGTGG - Intergenic
976785032 4:88809763-88809785 ATGCCCCTTGCCAACTGGGGAGG + Intronic
977867676 4:102049439-102049461 ATGACACGTGGCAACTGATGAGG + Intronic
980601761 4:135036255-135036277 ATGCTATCTGCAAACTGAGGAGG - Intergenic
988457485 5:31399246-31399268 ATGCCAGGAGACAAGTGAGGAGG - Intergenic
988879824 5:35489329-35489351 ATTCCAGGTGGGAACAGAGGTGG + Intergenic
990202973 5:53398356-53398378 ATGCCATGTGGCAACTGTTGAGG + Intergenic
991667228 5:69011397-69011419 ATGGCAGGTGCCTACCCAGGAGG + Intergenic
992653877 5:78889034-78889056 CGGCCAGGTGCCATCTGTGGGGG - Intronic
995769399 5:115652861-115652883 AAGCCATGTGCCAACTGTGCAGG + Intergenic
997353709 5:133248871-133248893 ATGCCAGGTGCCAGATGAGAAGG - Intronic
1000380725 5:160627016-160627038 ATGAAAGGTGCAATCTGAGGAGG - Intronic
1001902505 5:175443872-175443894 AGGCCAGGTCCCAAGAGAGGCGG + Exonic
1002389112 5:178895797-178895819 GTGCCAGTGGCCAGCTGAGGTGG - Intergenic
1002908360 6:1469168-1469190 ATGCCAGGTGTTACCTGTGGTGG - Intergenic
1004250629 6:14020400-14020422 ATGCCAGCTGCCATTTGAAGAGG - Intergenic
1004321747 6:14636879-14636901 ATGCCGAGTACCAGCTGAGGAGG - Intergenic
1005023898 6:21444754-21444776 ATGCCAGCTCCCATCTGAGATGG - Intergenic
1005804558 6:29462177-29462199 ATGCCAGCTGCCAGCACAGGCGG - Exonic
1005819786 6:29588352-29588374 ATGCCAGCTGCCAGCACAGGCGG - Exonic
1010977194 6:82329298-82329320 ATGCCATGTAACAACAGAGGTGG + Intergenic
1013410080 6:109876238-109876260 CAGCCAGGTGCCCACTGAGGTGG + Intergenic
1014136008 6:117890764-117890786 ATGCCAGGTGCCACAGCAGGAGG + Intergenic
1019217382 6:170452481-170452503 GGCCCAGGTGCCTACTGAGGGGG - Intergenic
1023042087 7:36180892-36180914 AGGCCAGGAGCCGACTGAGGGGG - Intronic
1027126255 7:75558729-75558751 AAGCCAGGGGCCAAGCGAGGTGG + Intronic
1035382359 7:158448001-158448023 AGGCCAGGTGCCGACTCAGCAGG + Intronic
1035438650 7:158878387-158878409 ATGCCGGGTGCCATGTGGGGAGG + Intronic
1035438718 7:158878610-158878632 ATGCCGGGTGCCATGTGGGGAGG + Intronic
1035438730 7:158878652-158878674 GTGCCAGGTGCCATGTGGGGTGG + Intronic
1035438769 7:158878791-158878813 GTGCCAGGTGCCATGTGGGGAGG + Intronic
1035443604 7:158924164-158924186 ATGCCAGGTGCCTACTGTGGTGG - Intronic
1037029135 8:14080523-14080545 AAGGAAGGTGGCAACTGAGGTGG - Intergenic
1038439519 8:27561635-27561657 ATCCCAGGAGCCACTTGAGGAGG - Intergenic
1043489039 8:80729513-80729535 ATGCCAGGTTTCAGCTGTGGTGG - Intronic
1044699585 8:94953632-94953654 ATGCCAGAGGCAACCTGAGGTGG + Intronic
1048137095 8:131757051-131757073 ATGGTAGGTGCAAACTGTGGTGG - Intergenic
1055300590 9:74878013-74878035 AGCTCAGGTGCCAACTGTGGTGG - Intronic
1056296311 9:85196520-85196542 CTGCCTGGTGCCAACTGCAGTGG - Intergenic
1056692226 9:88817489-88817511 TTGCCAGGTGCCAAGTGTGGTGG + Intergenic
1057085863 9:92209442-92209464 CTTCCAGATGCCAACTGTGGGGG + Intergenic
1058594531 9:106601320-106601342 CTGCCTGGTGCCAAGGGAGGGGG - Intergenic
1060819102 9:126651371-126651393 CTGCCAGCTGCCTGCTGAGGAGG - Intronic
1061927130 9:133811430-133811452 ATGCCACTTGCCAACCGTGGAGG - Intronic
1190753494 X:53381529-53381551 ATGACAGGTGCCACTTGAGCAGG - Intronic
1194979774 X:100428424-100428446 AGGCCATGTGACAACAGAGGTGG - Intergenic
1198041335 X:132855743-132855765 ATTCCAAATGGCAACTGAGGTGG - Intronic
1198623015 X:138534555-138534577 CAGGCAGGTGCCAGCTGAGGTGG - Intergenic
1199881671 X:151978429-151978451 ATCACAGGTGCCACGTGAGGTGG - Intergenic
1201672818 Y:16543310-16543332 ATGCCAGTTGACAACAGAGAAGG + Intergenic