ID: 1073339578

View in Genome Browser
Species Human (GRCh38)
Location 10:102734911-102734933
Sequence AATGCCAGGTGCCAACTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339578_1073339583 15 Left 1073339578 10:102734911-102734933 CCCCTCAGTTGGCACCTGGCATT No data
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339578 Original CRISPR AATGCCAGGTGCCAACTGAG GGG (reversed) Intronic
No off target data available for this crispr