ID: 1073339580

View in Genome Browser
Species Human (GRCh38)
Location 10:102734913-102734935
Sequence AAAATGCCAGGTGCCAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339580_1073339583 13 Left 1073339580 10:102734913-102734935 CCTCAGTTGGCACCTGGCATTTT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339580 Original CRISPR AAAATGCCAGGTGCCAACTG AGG (reversed) Intronic
901044091 1:6385301-6385323 AACATGCCAGGTCTCCACTGAGG + Intronic
902196816 1:14804161-14804183 GAATTGCCAGGAGCCAAGTGTGG - Intronic
902210153 1:14899223-14899245 GAAAGGCAAGTTGCCAACTGAGG + Intronic
902520825 1:17014931-17014953 AACATGCCAGCTGTCAACTCAGG + Intergenic
903141198 1:21340139-21340161 AAAATGCTATGTGCCAACCTGGG - Intronic
903801384 1:25971059-25971081 GAACTGCCAGGTGCCGTCTGAGG + Intronic
904630472 1:31838226-31838248 GAAATGCCAGATGCCTCCTGTGG - Intergenic
905940759 1:41861451-41861473 AAAATGCCAGCTGCCCTCTTGGG - Intronic
906518720 1:46454824-46454846 AACATGGCAGGTGCCATCTCTGG - Intergenic
908254155 1:62288844-62288866 AAACTGCCAATTGCCAAATGAGG + Intronic
908698176 1:66868685-66868707 AATCTGCCATGTGCAAACTGGGG - Intronic
910093763 1:83496276-83496298 TATATGCCAGGTGCCAACTGTGG - Intergenic
915008148 1:152659660-152659682 AAAATGGCAGGTCCCAGATGAGG + Intergenic
916744767 1:167676685-167676707 AAATTCCCAGGTGCCAGCAGGGG - Intronic
917549445 1:176008666-176008688 AAAATACTATGTGGCAACTGTGG + Intronic
917828130 1:178845718-178845740 TAAATACTAGGTGCCAGCTGAGG - Intronic
918720205 1:187842729-187842751 AAAGTGTCAGGTTCTAACTGAGG + Intergenic
918797561 1:188922391-188922413 ACAATTCCAGGTGCCTACTTTGG - Intergenic
919146695 1:193644784-193644806 CACCTGCCAGATGCCAACTGGGG + Intergenic
919985944 1:202675013-202675035 AAAATGCCAGGTGCTCAGAGAGG + Intronic
920076964 1:203344291-203344313 AAAATTCCAGATCCCAGCTGTGG + Intronic
920812034 1:209295232-209295254 AAAATGGCAGGTGGCAAGTATGG + Intergenic
921186111 1:212670905-212670927 AGACTGCAAGGTGCCATCTGTGG - Intergenic
921519038 1:216136764-216136786 AAAATGCCATGTGACAACGAAGG + Intronic
923077571 1:230623654-230623676 ACAATGCCCTGTGCCACCTGAGG + Intergenic
924647557 1:245892932-245892954 AAAAGACCAGCTGCAAACTGAGG + Intronic
1063917316 10:10896597-10896619 AAAAGGACAGGTGACAACAGAGG + Intergenic
1064997207 10:21306706-21306728 AAAATGTCAGGGGCCAGATGCGG - Intergenic
1065935240 10:30515304-30515326 AAAATGCCATGGGCTTACTGTGG + Intergenic
1067186027 10:44028981-44029003 AAAATGCCAGGTTCACACAGCGG + Intergenic
1068116236 10:52740404-52740426 CAAATGCCAGATGCCAAGCGAGG + Intergenic
1068911349 10:62381619-62381641 AAAATGTCAGCTGGCATCTGAGG + Intronic
1073339580 10:102734913-102734935 AAAATGCCAGGTGCCAACTGAGG - Intronic
1075047712 10:119159350-119159372 ACAATGCCAGGTCCCAGGTGAGG + Intronic
1075252857 10:120897244-120897266 AGAATGCCAGCTGACAAATGCGG + Intronic
1075765946 10:124892997-124893019 AGAAGGCCAGGTGACAACGGAGG - Intergenic
1077479114 11:2804867-2804889 CAAATCCCAGCTGGCAACTGTGG - Intronic
1080232987 11:30038803-30038825 AAAAAAGCAGGTGCCAACAGAGG + Intergenic
1084274987 11:68046764-68046786 AACTTGCCATGTGCCAGCTGGGG + Intronic
1085144526 11:74181733-74181755 AAAATGACAGGTGCCACCAAAGG - Intronic
1087081173 11:94172411-94172433 AGACTGCCAGGTGATAACTGAGG + Intronic
1087169976 11:95040714-95040736 AGCATTCCAGGTGCCAACTATGG - Intergenic
1088973880 11:114797491-114797513 AAAATGCCTGCTGTGAACTGAGG - Intergenic
1089779264 11:120861676-120861698 AAAAAGCCATGTGCCTAGTGGGG - Intronic
1090219181 11:125001245-125001267 AATATGCATGTTGCCAACTGAGG - Intronic
1096549492 12:52362848-52362870 AGAATGCCAAGTGCCAGGTGGGG - Exonic
1098023441 12:66178440-66178462 AAAAGGCCATGTAACAACTGAGG - Intergenic
1100448645 12:94684389-94684411 GAACTGCCAGGGGCCACCTGTGG + Intergenic
1100703621 12:97176962-97176984 AAGATGCCATGTGACAACGGAGG - Intergenic
1101425116 12:104581799-104581821 AAAATGCCCTGTGCCTTCTGAGG - Intronic
1102084258 12:110123439-110123461 AAAATACCATTTGCCAACTAAGG + Intergenic
1102340471 12:112117538-112117560 AAAAAGCCAGGGGCCAGGTGCGG + Intergenic
1102672758 12:114633918-114633940 ACAATGCCAGGTGTCTGCTGGGG - Intergenic
1102923234 12:116808501-116808523 GAAATCCCAGGTGCCTGCTGGGG - Intronic
1103974609 12:124694339-124694361 AAAATGACAGGTGGCCAGTGAGG + Intergenic
1105540841 13:21315119-21315141 AGAATGCCATGTGACAACAGAGG + Intergenic
1106577655 13:30990811-30990833 AGAATGCCATGTGACAACAGAGG - Intergenic
1107427203 13:40306106-40306128 AAGATGACAGGGGCCAACAGGGG - Intergenic
1108432467 13:50367924-50367946 AGAATGCCACGTGACAACTAAGG + Intronic
1108444756 13:50496892-50496914 ATAGTGCCAGGTGCCAAATTAGG + Intronic
1108684835 13:52809831-52809853 ATAATGACAGGTGCCAACTCAGG - Intergenic
1111209424 13:85057755-85057777 AAAATGTGAGGTGCCATGTGTGG + Intergenic
1111996299 13:95169019-95169041 ACAATGCCATGTGACAACAGAGG + Intronic
1112976204 13:105321422-105321444 AAAATGCCAGGGGCCATTTCAGG + Intergenic
1113159360 13:107362496-107362518 AGAATGCCAAGTGACAACAGTGG - Intronic
1114399392 14:22395574-22395596 AGAATGCCAGGTACCAATAGAGG + Intergenic
1115894380 14:38069041-38069063 AAAAAGCAAGCTGCCAAGTGGGG - Intergenic
1118847062 14:69555433-69555455 AAAAAGCAAAGTGCCAACTCAGG + Intergenic
1119432943 14:74580119-74580141 AAAATGCCAGGTGGGAGGTGGGG + Intronic
1119678837 14:76576654-76576676 AAAAGGACAGGTGGCCACTGAGG + Intergenic
1119923487 14:78469540-78469562 AAATTGCTGGGTGCCAACTGGGG + Intronic
1120044626 14:79792008-79792030 AAAGTGCCAGGTGAGAAGTGTGG - Intronic
1120453649 14:84703356-84703378 AAAATGCCAAGTTCTAACTGTGG + Intergenic
1121668963 14:95693530-95693552 AAAATGCCAAATGCCTCCTGAGG + Intergenic
1121967479 14:98324010-98324032 AAGATTCCAGAGGCCAACTGTGG + Intergenic
1122203899 14:100138806-100138828 AAAATGCCAGCTCCCGACAGAGG - Intronic
1125381483 15:39091787-39091809 AAATTCCCTGGTGCCAGCTGTGG - Intergenic
1125484944 15:40105359-40105381 AAAGTCCCATGTGGCAACTGGGG + Intronic
1127312306 15:57763332-57763354 AACATGGCAGGAGCCACCTGGGG - Intronic
1130146001 15:81273988-81274010 AAATTGCCAGGTTTCAACTCAGG + Intronic
1131175525 15:90206999-90207021 AAAAAGCCTGGTGCCCACAGCGG + Intronic
1131550487 15:93352868-93352890 TAAATGCCAAGTACCAGCTGAGG + Intergenic
1132241520 15:100261236-100261258 AAAATGCCATGTGACAATGGAGG + Intronic
1144582254 17:16465670-16465692 AAAATCCCAGTTGCCAACCCAGG + Intronic
1146747881 17:35347881-35347903 AGAATGCCAGGGGCCGGCTGGGG + Intergenic
1147147556 17:38494118-38494140 ACATTGCCAAGTGCCCACTGGGG + Intronic
1147455703 17:40536816-40536838 AGGCTGCCAGGTGACAACTGGGG - Intergenic
1148610934 17:48964184-48964206 AAAAAGAAAGGTGCCACCTGGGG + Intronic
1149238479 17:54620314-54620336 AAATTGCCAGGTGCTCACTGGGG + Intergenic
1150349310 17:64430484-64430506 AAGATGACAGGGGCCAACAGGGG - Intergenic
1150873409 17:68941569-68941591 AAAATGCCAGTTACCCATTGTGG + Intronic
1152127849 17:78458154-78458176 ATAATGCCAGGTGCCAGATGTGG - Intronic
1153393655 18:4592244-4592266 AAAATGGCAGATGCCCACTATGG - Intergenic
1153696294 18:7646240-7646262 AAGATCCCAGGTGCAAACTCTGG - Intronic
1157233445 18:45940819-45940841 AAAACACCTGGTGCCACCTGTGG - Intronic
1158719936 18:59915756-59915778 GAAATGCCATGTGGCAACAGAGG - Intergenic
1159049213 18:63402026-63402048 AAACTGCTAGGTGCAAACTATGG + Intronic
1161114933 19:2491321-2491343 AAAGTGCCAGGGGCCAGGTGGGG - Intergenic
1163410500 19:17150910-17150932 ATGATGCCAGGTGCCTCCTGAGG + Intronic
1164006243 19:21152136-21152158 ACAATGACAGGGCCCAACTGGGG - Intronic
1164380590 19:27734234-27734256 AAAATGCCTGGGGCTGACTGGGG + Intergenic
1165178455 19:33947372-33947394 GAAATGGCAGTTGCAAACTGTGG - Intergenic
1165186458 19:34026449-34026471 AATAGGCCATCTGCCAACTGAGG - Intergenic
1168504602 19:56922728-56922750 AAAAGTACAGGTCCCAACTGGGG + Intergenic
925623861 2:5822192-5822214 AAAATACCAGGTGAAAACTTGGG - Intergenic
926228913 2:10988073-10988095 AGAATGCCAGGTGACACCAGAGG - Intergenic
926304478 2:11628080-11628102 AAAATGCCTGGTGGGCACTGTGG + Intronic
927644274 2:24866323-24866345 AAAATGCCAGGTGGCTAAAGTGG + Intronic
929887512 2:45892038-45892060 CAGAAGCCAGGTGTCAACTGTGG - Intronic
932894703 2:75627920-75627942 AAAATTCCTAGTGCCAACTAAGG + Intergenic
934072044 2:88393286-88393308 ATGATGCCAGGTGCCAGGTGTGG - Intergenic
935673302 2:105573480-105573502 AAATGGCCATGTGCAAACTGAGG + Intergenic
937331270 2:121031835-121031857 AACATGCATGGTGCCAACTCTGG - Intergenic
938596468 2:132792443-132792465 CACATTCCAGGTGCCAACAGTGG - Intronic
939473649 2:142657797-142657819 AAAATACCACATGCAAACTGGGG - Intergenic
940042653 2:149376831-149376853 AAAATGCCAGATTCCAAATTAGG - Intronic
942288407 2:174444820-174444842 AAAATGCCAGGTAGTAACTTTGG - Intronic
943126806 2:183804128-183804150 AAAGTGTCAGGTGGCATCTGAGG - Intergenic
944162983 2:196686121-196686143 TAAAGGACAGTTGCCAACTGTGG - Intronic
945437777 2:209839229-209839251 CAAATGCAAGGAGCCAACTTGGG + Exonic
945481417 2:210350144-210350166 AAAATGCCAGGGACCAACTTGGG - Intergenic
946161127 2:217836718-217836740 AATATCCCAGAGGCCAACTGGGG - Intronic
946813319 2:223550206-223550228 ACAACTCCAGGTGCCAACTCTGG + Intergenic
947773568 2:232689988-232690010 AGAATGGCAGGTGTCCACTGCGG + Intergenic
948295016 2:236854143-236854165 TAAATGCAAGGTGCCTCCTGAGG - Intergenic
1169535358 20:6533058-6533080 AAAATGTCAAATGCCAACAGAGG - Intergenic
1171344096 20:24452635-24452657 AAGCTGCCCGGTGCCACCTGTGG - Intergenic
1172420865 20:34816437-34816459 AAAACGCCATGTGACAACAGAGG + Intronic
1174091531 20:48052443-48052465 AAAATGTCAGGTTCCTATTGGGG + Intergenic
1174125142 20:48298856-48298878 AAAATGTCAGATTCCTACTGGGG - Intergenic
1174392064 20:50223816-50223838 AAACTGGCAGGAGACAACTGTGG - Intergenic
1184521523 22:44997251-44997273 AAGTTGCCAGGAGCCACCTGTGG - Intronic
1185121370 22:48973668-48973690 AATACACCAGCTGCCAACTGTGG - Intergenic
949269225 3:2194721-2194743 AAAATGCCATGTGAAAACAGAGG + Intronic
951646907 3:24902386-24902408 AAAAAACCTGGTGTCAACTGAGG - Intergenic
952468663 3:33619938-33619960 AAAATGCCAGATTTCAACTTTGG - Intronic
955208527 3:56919062-56919084 AAAAGGCCAGGTGGGCACTGGGG + Intronic
955470982 3:59286087-59286109 AGAATGCCAGGTGAGAAATGGGG - Intergenic
956929858 3:74030704-74030726 AAATTCCCAGATGCCAACTCTGG + Intergenic
957623618 3:82628567-82628589 AAGATGCCAGGTGTGAACTCAGG + Intergenic
958024717 3:88037424-88037446 AGAATGCCACGTGCCAACAGAGG + Intergenic
958148056 3:89653066-89653088 AAAATTCCAGGTGCCAACGCAGG - Intergenic
958906682 3:99949342-99949364 AAGAAGCCAGTTGCCAACTATGG - Intronic
959457360 3:106579362-106579384 AGAATACCATGTGACAACTGAGG + Intergenic
959575554 3:107929122-107929144 AAAATGCTATGTGGCAAGTGAGG - Intergenic
960162400 3:114364890-114364912 GAAATTACAGGTGCAAACTGAGG - Intronic
960980918 3:123225211-123225233 AAATTTCCATGTGCGAACTGGGG + Exonic
961595693 3:128014444-128014466 AAGATGACAGGGTCCAACTGAGG + Intergenic
963618636 3:147575844-147575866 AAAATGTCATCTGCCAACTTAGG + Intergenic
964085896 3:152817775-152817797 GAAATGCCAGGTGCCAAAAGAGG - Intergenic
964433276 3:156626559-156626581 AAAATGTCAGGTTCTAACTGAGG - Intergenic
965480710 3:169215878-169215900 AAACTGCTAGATGCCAGCTGAGG - Intronic
968376732 4:50153-50175 AAAATGTGAGCTGCCAGCTGTGG + Intergenic
969252446 4:5977017-5977039 AGAATTCCAGGTGCCCTCTGGGG + Intronic
973346758 4:49064342-49064364 AATAACCCATGTGCCAACTGGGG + Intergenic
973947853 4:55978238-55978260 AAAAGACCAGGTTCCTACTGTGG + Intronic
977151955 4:93523663-93523685 ATATTGCCAGGTGCTTACTGAGG + Intronic
979360517 4:119758713-119758735 TAAATACCAGGTGAAAACTGAGG - Intergenic
981315166 4:143334774-143334796 AAAAAGCCTGGTTCCCACTGGGG - Intergenic
982470151 4:155779126-155779148 AAAATGAGATGTGCAAACTGGGG + Intronic
983076051 4:163328839-163328861 AAAATGAGAGGAGCCAACTAAGG - Intronic
987596472 5:20006621-20006643 AAAATGCCATGTGCTAATTTAGG - Intronic
987830115 5:23085050-23085072 GAAATGACAGGTGGCAAGTGTGG - Intergenic
988536870 5:32076811-32076833 AAAATGTCAGTTACCAGCTGAGG - Intronic
992978608 5:82142154-82142176 TATATGCCAGGTGCCAGGTGTGG + Intronic
994068438 5:95570272-95570294 AAAAGACCAGGTGCATACTGAGG - Intronic
994876622 5:105431324-105431346 AGAATGCCATGTGACAACAGAGG + Intergenic
995074831 5:107970409-107970431 AAAAGGACAGGTGCCCACTGAGG + Intronic
996604221 5:125302384-125302406 AAAAATCCATGTGCCAACAGAGG + Intergenic
999728938 5:154461104-154461126 ACACTGCCAGGGGCCAAATGTGG - Intergenic
1000320113 5:160127761-160127783 AAACTGCCATGTGCAAGCTGGGG - Intergenic
1000411535 5:160938475-160938497 CAAATGTCAGGTTCTAACTGAGG + Intergenic
1001657419 5:173362630-173362652 AAAATGCCAGCTTCTTACTGTGG + Intergenic
1003412051 6:5874217-5874239 AGAATGCCATGTGACAACAGAGG - Intergenic
1003544332 6:7045799-7045821 AAAATGCCAGGTGCAGAATAAGG + Intergenic
1006469408 6:34218540-34218562 AGAACGCCAGGTGACAACTGAGG + Intergenic
1006838258 6:37012117-37012139 AAAATAGCCAGTGCCAACTGAGG + Intronic
1006858153 6:37150654-37150676 TAAATGCCAGGTGCCATATTAGG + Intergenic
1007358126 6:41335526-41335548 AAAAGGCCAGGAGGAAACTGTGG - Intergenic
1008125513 6:47663968-47663990 CTAGAGCCAGGTGCCAACTGAGG + Intronic
1008260406 6:49359425-49359447 AAAATGCCATCTGCAAGCTGAGG + Intergenic
1009201158 6:60748094-60748116 AATATGCCAGGTGCTAACATAGG - Intergenic
1011552027 6:88538738-88538760 AAGCTGCCATGTGCAAACTGGGG + Intergenic
1014536885 6:122624853-122624875 AAAATGCAAGGTGTCTACTAAGG + Intronic
1015605866 6:134954227-134954249 AAAATGCTAGGTGTCCCCTGTGG + Intergenic
1016088623 6:139946858-139946880 ATAATGCCAGGTGGAAACTTGGG + Intergenic
1021834227 7:24652089-24652111 AAATTGAAAGTTGCCAACTGAGG - Intronic
1021996223 7:26180329-26180351 CAAATGCCAGGTTGCAATTGAGG - Intronic
1022337394 7:29434538-29434560 AAAATGCCATGTGACAATGGAGG - Intronic
1023588706 7:41758662-41758684 AAAATGACAGGGCCCATCTGGGG - Intergenic
1026630275 7:72032035-72032057 AAAAAGCCAGGAGCCAGGTGTGG - Intronic
1028596136 7:92547565-92547587 ACATTCCCTGGTGCCAACTGTGG + Intergenic
1029602029 7:101571899-101571921 AGAATGCCATGTGCCAATGGAGG + Intergenic
1030246014 7:107385133-107385155 AAAAGGCCATGTGACAACAGAGG + Intronic
1034863941 7:154624570-154624592 CAAATGCCTGGTGACAACTTCGG - Intronic
1035443605 7:158924167-158924189 CTTATGCCAGGTGCCTACTGTGG - Intronic
1037000932 8:13717980-13718002 GGAATGCCAGGTGCCCAGTGGGG + Intergenic
1038833922 8:31097367-31097389 CCAATGCCAGGTGCCAACCCAGG - Intronic
1042869817 8:73388012-73388034 AAAATGCAAGGTGTCAACCTGGG + Intergenic
1043161162 8:76849970-76849992 GAAATGCAAGGTGCCCACTGGGG - Intronic
1043984432 8:86677029-86677051 AGAATGCCATGTGACAACAGTGG + Intronic
1044036742 8:87313904-87313926 AAAATGCAAGGTACAAAATGGGG - Intronic
1046578925 8:116067689-116067711 AAGATGACAGGGCCCAACTGGGG + Intergenic
1046579084 8:116069224-116069246 AAGATGACAGGGCCCAACTGGGG - Intergenic
1046782570 8:118231275-118231297 AAGATGGCAGGTGCTAACTCTGG + Intronic
1046817058 8:118596646-118596668 AAAGTGCCAGATGCCAAGGGAGG - Intronic
1046876547 8:119260901-119260923 AGAGTGCCAGGTGACAATTGAGG - Intergenic
1047674410 8:127184488-127184510 AAAAAGACATGTGCCACCTGAGG - Intergenic
1048137096 8:131757054-131757076 AAGATGGTAGGTGCAAACTGTGG - Intergenic
1049167636 8:141136605-141136627 CAAATGGCCGGTGCCAACTGCGG + Exonic
1050327998 9:4516275-4516297 AATCTGCCAGGAGCCAGCTGGGG - Intronic
1056111564 9:83401244-83401266 AAAATGCCAGGTTTGAACTCAGG + Intronic
1056377040 9:86024815-86024837 AAACTGGGAGGTGCCATCTGGGG + Intergenic
1058395799 9:104552541-104552563 AAAATGCCATGTGACAATGGAGG - Intergenic
1203572498 Un_KI270744v1:144093-144115 AAAATGTGAGCTGCCAGCTGTGG - Intergenic
1186116538 X:6310032-6310054 AAAAGGCCAGCTGCAAGCTGAGG - Intergenic
1186592618 X:10947109-10947131 CAATTACCATGTGCCAACTGTGG - Intergenic
1187134927 X:16538933-16538955 GAAATGCCAGGTGTCAATTGTGG + Intergenic
1187928866 X:24275796-24275818 AAAATGCCACGTGACGACAGAGG + Intergenic
1188335326 X:28924958-28924980 AGAATGGCAGGTGTAAACTGTGG - Intronic
1189647347 X:43147921-43147943 AAAAGTCCAGGAGCCAACTGAGG + Intergenic
1191880277 X:65838480-65838502 ACCATCCCAGGTGCAAACTGAGG - Intergenic
1193212133 X:78819770-78819792 AAAATGCCATGTGACAATTAAGG - Intergenic
1194043031 X:88965779-88965801 AAAATGTCACGTGTCATCTGAGG + Intergenic
1194170156 X:90571277-90571299 AAGATGGCAGGGCCCAACTGGGG - Intergenic
1196100837 X:111845473-111845495 AAAATGTCAGTTGGCAACAGGGG + Intronic
1200516400 Y:4149044-4149066 AAGATGGCAGGGCCCAACTGGGG - Intergenic
1201790325 Y:17832625-17832647 ACAATGCCAGGTCCACACTGTGG + Intergenic
1201811229 Y:18073364-18073386 ACAATGCCAGGTCCACACTGTGG - Intergenic