ID: 1073339581

View in Genome Browser
Species Human (GRCh38)
Location 10:102734925-102734947
Sequence CAGGAGCTTATTAAAATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339581_1073339583 1 Left 1073339581 10:102734925-102734947 CCTGGCATTTTAATAAGCTCCTG 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339581 Original CRISPR CAGGAGCTTATTAAAATGCC AGG (reversed) Intronic
900385836 1:2410273-2410295 CAGGAGCTTCTCACACTGCCTGG + Intronic
901450989 1:9337063-9337085 GAGGAGTTTCTTAGAATGCCAGG - Intronic
902418934 1:16262298-16262320 CAGGAGTATACCAAAATGCCTGG + Intronic
903781517 1:25823090-25823112 CAGGAGCTGGTTCAAATGTCAGG + Exonic
907317302 1:53580505-53580527 CAGGAACTAATTAAGAGGCCTGG + Intronic
909511861 1:76462314-76462336 CAGGGACTTATGAAAATGGCTGG - Intronic
911444060 1:97969066-97969088 CCAGAGCTTATTAGGATGCCAGG - Intergenic
915508624 1:156373281-156373303 CAGGAGCTTATTACCATACTGGG - Intronic
917932143 1:179829965-179829987 AAGGAGCTTATTAAATTCCAGGG + Intergenic
918885543 1:190188901-190188923 CAGGAGCTTCCCACAATGCCAGG + Intronic
919801065 1:201354941-201354963 CAGGAGCCTATTAGAGAGCCTGG + Intergenic
919844633 1:201634009-201634031 AAGGTGCTTATAACAATGCCTGG - Intronic
921889213 1:220336990-220337012 AAGGTGTTTATTCAAATGCCTGG + Intergenic
922087942 1:222369005-222369027 CAGCATTTTATTATAATGCCAGG + Intergenic
922383028 1:225052540-225052562 CAGGGGCCTAGTACAATGCCTGG - Intronic
924213127 1:241791141-241791163 CAGGCGCTTATCACCATGCCTGG - Intronic
924693115 1:246371119-246371141 AAGGAGCAAATTAAAACGCCAGG + Intronic
1067204310 10:44200268-44200290 CATGAGCTGAGTAAAAGGCCAGG - Intergenic
1068503818 10:57873699-57873721 CAGCAGATTATTGACATGCCTGG + Intergenic
1069399942 10:68033202-68033224 CAGGAGCCTACTTAAAAGCCTGG + Intronic
1070670152 10:78372129-78372151 CATGACCTTATAAAAATCCCAGG - Intergenic
1072096021 10:92180766-92180788 TGGGAGCTTATTAAAATCTCAGG - Intronic
1072994065 10:100227896-100227918 TAAGATCTTACTAAAATGCCTGG - Intronic
1072994630 10:100232042-100232064 CTGGAGCTTAGAAAAATGCCTGG + Intergenic
1073339581 10:102734925-102734947 CAGGAGCTTATTAAAATGCCAGG - Intronic
1074772076 10:116741401-116741423 GAGGATGATATTAAAATGCCGGG - Intronic
1075678091 10:124310617-124310639 CAGGTGCTTATCACCATGCCTGG - Intergenic
1078223076 11:9367584-9367606 CAGGACCTTACTATAGTGCCTGG - Intergenic
1078569014 11:12441497-12441519 CAGGATCTTGTTAAAATGAGTGG + Intronic
1080632626 11:34093058-34093080 CAGGAGCTCACTATGATGCCAGG + Intronic
1081184598 11:40026692-40026714 CATGAGCTTATTAAAAATCAGGG - Intergenic
1081353508 11:42085003-42085025 CAGGAGGATATTAAAACGTCTGG - Intergenic
1081908097 11:46681949-46681971 CAGGAGCTTATTCCAAGGCAGGG - Intronic
1082984225 11:59153632-59153654 CATGTGCTTAGAAAAATGCCTGG - Exonic
1085330017 11:75640500-75640522 CAGAAGCATATTGAAATTCCAGG + Intronic
1088069355 11:105762600-105762622 GAGGGGCTTATTAAAATTCAAGG - Intronic
1088127540 11:106447065-106447087 CTGGAGCTTATTCATATCCCTGG - Intergenic
1088501520 11:110488000-110488022 CAGGAGTGTATCAACATGCCTGG - Intergenic
1088586417 11:111363759-111363781 CGGGAGCTTATTAAAATCTCTGG - Intronic
1090507986 11:127340033-127340055 GAGGATCTTATTAAAAAGGCAGG - Intergenic
1092312823 12:7376505-7376527 CAGGAGTTTGGAAAAATGCCTGG - Intronic
1096174277 12:49501997-49502019 AAGGACCATATTAAAATGACAGG + Intronic
1099965328 12:89439461-89439483 GGGGATCTTATTAAAATGCAGGG + Intronic
1103090424 12:118094337-118094359 TAAAAGCTTATTAATATGCCAGG + Intronic
1103193654 12:119023906-119023928 AAGGAGTTAATTAAAATGCGGGG - Intronic
1104146506 12:126038927-126038949 CAGAAGCATTTTAAAGTGCCTGG + Intergenic
1104317915 12:127721377-127721399 CAGGAGGCTTTTAAAATTCCAGG + Intergenic
1105008988 12:132742115-132742137 CAAATGCTTTTTAAAATGCCAGG + Intronic
1105543154 13:21332242-21332264 GAGGAGAATATTAAAATACCAGG + Intergenic
1105562201 13:21503819-21503841 CTGCAGCATATTAAAATGCATGG - Intronic
1107571916 13:41670531-41670553 CAGCAGATTATTACAAGGCCAGG - Intronic
1107918990 13:45183793-45183815 CAGGAGATCATAAAAATGTCTGG - Intronic
1108774353 13:53746107-53746129 CAGGTGCTTAATAAGATCCCTGG + Intergenic
1109344378 13:61097409-61097431 CAGAAGTGTATTAAAATGGCCGG + Intergenic
1113984714 13:114304329-114304351 CAGGAGTTTAATAAAATGATGGG + Intronic
1116222803 14:42110878-42110900 GAGAAGCTTCTTCAAATGCCTGG + Intergenic
1116744774 14:48804029-48804051 GAGGAGCTTATTAAAAATACAGG - Intergenic
1117656249 14:57959771-57959793 TAAGAGCTTAGTAAAATGCCTGG + Intronic
1117855559 14:60028474-60028496 CAGGAGTTGATTCAAATGCCGGG - Intronic
1119196346 14:72719416-72719438 TGGGAGCTTATTAAAAAGGCAGG + Intronic
1120308985 14:82806391-82806413 CAGGAGAATTTTAAAATGCTAGG + Intergenic
1122052514 14:99069751-99069773 CAGGAGGCAATTAAAATGACAGG + Intergenic
1127530068 15:59835096-59835118 TAGAAGCTTAATAAAATGCTTGG + Intergenic
1128656155 15:69463376-69463398 GAAGAGCTTATGAAAATTCCCGG - Intergenic
1130244672 15:82234677-82234699 CAGGAGCTGACTAGAATGCAAGG - Intronic
1130455963 15:84108460-84108482 CAGGAGCTGACTAGAATGCAAGG + Intergenic
1130916289 15:88307544-88307566 TTGGAGCTTATTGAAATACCCGG - Intergenic
1130954228 15:88615595-88615617 CATCAGCTTGTTAAAATGCTGGG + Intergenic
1131890576 15:96967727-96967749 CAGGTGCATAGTATAATGCCTGG - Intergenic
1132842624 16:1985575-1985597 TAGGAGCTTATAAAATTGCCAGG + Intronic
1133152711 16:3848820-3848842 CAGACTCTTCTTAAAATGCCAGG + Intronic
1133246366 16:4451408-4451430 CAGGAGCTCAGTGAAATTCCAGG - Intronic
1133862641 16:9610638-9610660 CAGTAGTTTATCACAATGCCTGG + Intergenic
1134888411 16:17816196-17816218 CAAGATGTTATCAAAATGCCAGG + Intergenic
1135435078 16:22421173-22421195 GAGGAGCTAAGGAAAATGCCGGG + Intronic
1136532318 16:30877864-30877886 GAGGAGCTTGTAAAAATCCCAGG + Intronic
1136702576 16:32157477-32157499 TGGGAGCTTATTTAAATGGCAGG + Intergenic
1136765091 16:32770011-32770033 TGGGAGCTTATTTAAATGGCAGG - Intergenic
1136803008 16:33100373-33100395 TGGGAGCTTATTTAAATGGCAGG + Intergenic
1137235294 16:46611749-46611771 GAGGACTTTATTACAATGCCTGG + Intronic
1137607228 16:49795012-49795034 CAGGCGCTTATCACCATGCCCGG + Intronic
1138833923 16:60410333-60410355 GAGAAGGTTGTTAAAATGCCTGG + Intergenic
1141439949 16:84023749-84023771 CAGGTGCTCATTACCATGCCCGG - Intronic
1203067480 16_KI270728v1_random:1032244-1032266 TGGGAGCTTATTTAAATGGCAGG - Intergenic
1148881435 17:50730795-50730817 CAGGAGCATACCACAATGCCTGG - Intronic
1149142331 17:53447351-53447373 CAGGAGCTTAGTGTAATCCCAGG - Intergenic
1149784015 17:59420647-59420669 CAGGAGCATATCATCATGCCTGG - Intergenic
1150590014 17:66553995-66554017 CATGAGGTTATTAAAATGATGGG + Intronic
1152412328 17:80133799-80133821 CAGGAACTCATTAAGCTGCCTGG + Intergenic
1152627673 17:81395421-81395443 CACGAGCTTATTAGTATGCAGGG + Intergenic
1153001948 18:463868-463890 CTTGAGTTGATTAAAATGCCTGG - Intronic
1155063219 18:22247014-22247036 CAGTAGCTTATTAAGGAGCCAGG + Intergenic
1155865913 18:30964508-30964530 CAGGAGTTGATAAAAATGCCTGG - Intergenic
1159154964 18:64571736-64571758 ATGGAGATTATTAAAAAGCCAGG - Intergenic
1159805681 18:72956084-72956106 CAAAAGCTTATTCAAATGCCAGG - Intergenic
1161467194 19:4437602-4437624 CAGCAGCTTTATTAAATGCCAGG - Intronic
1161739154 19:6009722-6009744 CAGGAGCTTGCTACTATGCCTGG + Intronic
1163734139 19:18968430-18968452 GAAGAGTTTATTAAAAAGCCTGG - Intergenic
1167372808 19:49093878-49093900 CAGGAGCCCACTACAATGCCTGG - Intronic
926426330 2:12741673-12741695 CAGGAGCTTGCTAAAATCTCAGG - Exonic
927828802 2:26330313-26330335 CAGGAGCTCATAAAACTGTCTGG + Intronic
928576275 2:32658263-32658285 CAGGAGCGTATTACCATGCTTGG + Intronic
928850486 2:35739631-35739653 ATGGAGATTATTAAAATGTCAGG + Intergenic
929494030 2:42423831-42423853 CAGTAACTTATTACAATGACAGG + Intronic
929849483 2:45571030-45571052 AAGGGGCTTTTTAAAATTCCTGG + Intronic
932502873 2:72199753-72199775 CAGGATGTTTTGAAAATGCCAGG - Intronic
937921934 2:127137146-127137168 CAGGAGATTATTAGTATGTCAGG - Intergenic
938820724 2:134956672-134956694 CAAAATCTTATTAAAATTCCTGG - Exonic
941907145 2:170727864-170727886 CTGGAGCCTAATATAATGCCTGG + Intergenic
943344239 2:186718717-186718739 CAGGAATTAAGTAAAATGCCAGG - Intronic
943729345 2:191285469-191285491 CAGGAGCTCATTCAGAGGCCAGG - Intronic
944991571 2:205243177-205243199 AAGGAGCTTAGTAACTTGCCTGG + Intronic
1169749169 20:8974174-8974196 CAGGATCTCACTACAATGCCAGG + Intergenic
1170750928 20:19144277-19144299 CAGGAGCTGATGACAATCCCAGG + Intergenic
1176940474 21:14917921-14917943 CTGCAGCTATTTAAAATGCCTGG - Intergenic
1177327435 21:19609730-19609752 CAGGAGCTTTTTGAAATACTAGG - Intergenic
1179142758 21:38741354-38741376 CAGCAGCTTCTTAAAGTCCCTGG + Intergenic
1183006163 22:34904435-34904457 AAGGAGCTTATAACAGTGCCTGG - Intergenic
1184111798 22:42399810-42399832 CAGAAGCTAATTAAAAACCCTGG + Intronic
1185213400 22:49584903-49584925 CTGGAGCTTCTTAAAATGCAAGG + Intronic
950675755 3:14553415-14553437 GAGCAGCTCATGAAAATGCCTGG - Intergenic
951725321 3:25751635-25751657 CAGGAACTTCTCAAAATTCCTGG - Intronic
952251414 3:31659589-31659611 CAGTATATTTTTAAAATGCCAGG + Exonic
952324026 3:32304650-32304672 GATGAGGTTATTAAAATGCCTGG + Intronic
953458635 3:43063610-43063632 CCAGAGTTTATGAAAATGCCAGG + Intergenic
953461083 3:43081580-43081602 CAGGAGCTTGTAATGATGCCAGG - Intronic
955119888 3:56047404-56047426 CAAAAGCATATTAAAATGCAAGG + Intronic
955855686 3:63270747-63270769 AAGGAGCTTATCACAGTGCCTGG + Intronic
956084653 3:65597133-65597155 CTGGAGCCTATTAATATGCACGG + Intronic
956428537 3:69161500-69161522 CAGGAGCTTAGCACAGTGCCTGG - Intergenic
958983188 3:100748812-100748834 CCGGAGGATATTAAAATGCTAGG + Exonic
960513325 3:118576310-118576332 CAGGAGCACATTAAAATCTCTGG - Intergenic
965609274 3:170527446-170527468 AAGGAGCTTAAGAAAATGCCTGG + Intronic
966888685 3:184390636-184390658 CTAGAGCTTGTCAAAATGCCTGG - Intronic
967093194 3:186152804-186152826 CAGGTGCTTATCACCATGCCTGG + Intronic
967716138 3:192763857-192763879 AAGGCGATTATTAAAATGTCAGG + Intronic
970193394 4:13535062-13535084 AATGAGCTTATTAAAATGAGCGG + Intergenic
972208813 4:36812288-36812310 CAGGTGCCTATTAAGATGTCTGG + Intergenic
972738868 4:41872222-41872244 CAAGAGCCTTTTAAAATACCTGG + Intergenic
976786624 4:88828281-88828303 CAGGCGCATGCTAAAATGCCTGG + Intronic
978647033 4:110946646-110946668 CTGCAGCTTATTTAAATGGCAGG - Intergenic
978754835 4:112290921-112290943 CAGGAGCATACTACCATGCCCGG + Intronic
980794260 4:137660624-137660646 CAGCAGACTTTTAAAATGCCAGG + Intergenic
981761824 4:148202834-148202856 CTGGAGCTCATTAAAAGGCAGGG + Intronic
982230205 4:153201781-153201803 CTGAAGCTTTTTAAAATGACAGG + Intronic
984641445 4:182168507-182168529 CAGGAGCTTAACACAAAGCCTGG - Intronic
985167163 4:187109051-187109073 CTGCAGCTTATTCAAATGCTTGG - Intergenic
986846304 5:11759741-11759763 GAGGAGCTTAGAATAATGCCTGG - Intronic
989599812 5:43191207-43191229 AAAGAGTTTATTACAATGCCTGG + Intronic
992275028 5:75106625-75106647 CAGGAACTTTTGAAAATTCCAGG + Intronic
993002125 5:82391792-82391814 GAGGTGCTTATGAGAATGCCAGG - Intergenic
994208525 5:97062283-97062305 CAGGAGCCCTTTGAAATGCCAGG + Intergenic
996929962 5:128874523-128874545 GAGGAACTGACTAAAATGCCTGG - Intronic
998397815 5:141830603-141830625 CTGGAGCTTCTTAAACTGCTTGG - Intergenic
998419114 5:141967713-141967735 CAGGAGCTTATTAGATTGTGAGG + Intronic
1002249919 5:177921805-177921827 AAGGAGGTTATTAAAAAGTCAGG + Intergenic
1004160944 6:13212404-13212426 CAAGACATTATTAAAATACCAGG + Intronic
1006729764 6:36228278-36228300 CAGGTGCTCAGCAAAATGCCTGG - Intronic
1007440434 6:41854913-41854935 CAGGTGCATACTAACATGCCTGG + Intronic
1007972590 6:46067721-46067743 CAGGCACTCATTAGAATGCCTGG - Intronic
1008683332 6:53897646-53897668 CAGCAGATTAGTAAATTGCCAGG + Intronic
1009489148 6:64265776-64265798 CAGGTGCTTAGTACAATGTCTGG + Intronic
1013687065 6:112597780-112597802 CTGGAGCTTCTTTAAATGCATGG + Intergenic
1014716631 6:124872595-124872617 TAGGAGCTTGTTAAAATGTATGG - Intergenic
1016180544 6:141142044-141142066 AAAGAGCCTATTAAAATGCCAGG + Intergenic
1016761745 6:147745718-147745740 CAGGAGCTTTTCACAATGCCTGG - Intergenic
1019432909 7:1007638-1007660 CAGGAGCTTCTTCCAAGGCCTGG - Intronic
1020790468 7:12621366-12621388 GAGAAGCTAATTAAGATGCCTGG + Intronic
1020845789 7:13281360-13281382 CAAGAGTTTATTATAGTGCCTGG - Intergenic
1022731961 7:33035334-33035356 CAGGAGCTTGTTACCATGCCCGG + Intronic
1022838087 7:34136001-34136023 CACAAGCTAATGAAAATGCCTGG + Intronic
1022988995 7:35688977-35688999 CAAATGCTTATTATAATGCCTGG + Intronic
1023809942 7:43904314-43904336 GAGGACCTTATGAATATGCCAGG - Intronic
1024407436 7:48998662-48998684 CAAGAGCTCATTCACATGCCAGG + Intergenic
1033017557 7:137687255-137687277 CAGGAGCTTATAAAAAAGGTAGG - Intronic
1033318339 7:140316886-140316908 CAGGTTCTTATTTAAATTCCTGG - Intronic
1033771927 7:144562071-144562093 AGAGAGGTTATTAAAATGCCAGG - Intronic
1035986160 8:4434193-4434215 CAGGTGCTCATTACCATGCCTGG - Intronic
1036530414 8:9580297-9580319 AAGGAGCTGATCCAAATGCCAGG + Exonic
1037213942 8:16425983-16426005 CAGAGGCGTATGAAAATGCCTGG + Intronic
1041588548 8:59548531-59548553 TAGGAGCTTAGTTCAATGCCAGG - Intergenic
1042350871 8:67776255-67776277 CAGGAGCTTATAACATTTCCTGG - Intergenic
1045507951 8:102791739-102791761 AAAGAGCTTAGAAAAATGCCTGG + Intergenic
1047122241 8:121918261-121918283 CAGTAGCTTAGCACAATGCCTGG + Intergenic
1050742120 9:8833926-8833948 AAGTAACTTCTTAAAATGCCCGG - Intronic
1050756083 9:9005163-9005185 GAGGAGCTTAATAATAAGCCAGG + Intronic
1051682678 9:19623803-19623825 CAAGAGCCTATAAAAATGCTTGG - Intronic
1052903531 9:33815911-33815933 CAGAAGCTGATTAAACAGCCGGG + Intergenic
1052987736 9:34500519-34500541 AAAGAGCTTAGAAAAATGCCTGG - Intronic
1053171957 9:35893983-35894005 CAGGAGCTTTTTCAAATTTCAGG + Intergenic
1055113979 9:72587655-72587677 CAGAAGCTTTTTAAAATTCAGGG - Intronic
1055495756 9:76853184-76853206 CAGAAGCTGATAAAAATGCTGGG - Intronic
1057270415 9:93647229-93647251 GAAGAGCTTAGAAAAATGCCTGG - Intronic
1058603587 9:106697279-106697301 CAGTAGCCTATTAAATTGCATGG + Intergenic
1186898150 X:14025965-14025987 AAGGAGCTAATAAGAATGCCTGG + Intronic
1187030543 X:15483626-15483648 CATCAGCTTATTAAAAGTCCAGG + Intronic
1187540191 X:20185527-20185549 CAGGTGCTTACCAACATGCCTGG + Intronic
1189268212 X:39732235-39732257 CAGGAGCTTATTACAACCTCAGG - Intergenic
1189638691 X:43043112-43043134 CAGGACATCATTAAAATGCTGGG + Intergenic
1196320223 X:114278767-114278789 CAGGTGCATGTTACAATGCCTGG + Intergenic
1200748716 Y:6925320-6925342 CAGGAGGTTATTACAATTCAAGG - Intronic
1200879587 Y:8198898-8198920 AAGGCGATTATTAAAATGTCAGG + Intergenic