ID: 1073339583

View in Genome Browser
Species Human (GRCh38)
Location 10:102734949-102734971
Sequence AGTTATATGCACAGTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073339579_1073339583 14 Left 1073339579 10:102734912-102734934 CCCTCAGTTGGCACCTGGCATTT 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data
1073339578_1073339583 15 Left 1073339578 10:102734911-102734933 CCCCTCAGTTGGCACCTGGCATT No data
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data
1073339574_1073339583 22 Left 1073339574 10:102734904-102734926 CCCAGACCCCCTCAGTTGGCACC 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data
1073339575_1073339583 21 Left 1073339575 10:102734905-102734927 CCAGACCCCCTCAGTTGGCACCT 0: 1
1: 0
2: 1
3: 23
4: 149
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data
1073339573_1073339583 23 Left 1073339573 10:102734903-102734925 CCCCAGACCCCCTCAGTTGGCAC 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data
1073339580_1073339583 13 Left 1073339580 10:102734913-102734935 CCTCAGTTGGCACCTGGCATTTT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data
1073339571_1073339583 27 Left 1073339571 10:102734899-102734921 CCTTCCCCAGACCCCCTCAGTTG 0: 1
1: 0
2: 4
3: 19
4: 389
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data
1073339581_1073339583 1 Left 1073339581 10:102734925-102734947 CCTGGCATTTTAATAAGCTCCTG 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data
1073339577_1073339583 16 Left 1073339577 10:102734910-102734932 CCCCCTCAGTTGGCACCTGGCAT 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1073339583 10:102734949-102734971 AGTTATATGCACAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073339583 Original CRISPR AGTTATATGCACAGTGAAGC TGG Intronic
No off target data available for this crispr