ID: 1073347663

View in Genome Browser
Species Human (GRCh38)
Location 10:102796442-102796464
Sequence CTGTCTACAGGGCTAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073347663_1073347669 6 Left 1073347663 10:102796442-102796464 CCAGCCTCTAGCCCTGTAGACAG 0: 1
1: 0
2: 0
3: 17
4: 216
Right 1073347669 10:102796471-102796493 GAGTGCCTGGTGTATACCCTTGG No data
1073347663_1073347668 -7 Left 1073347663 10:102796442-102796464 CCAGCCTCTAGCCCTGTAGACAG 0: 1
1: 0
2: 0
3: 17
4: 216
Right 1073347668 10:102796458-102796480 TAGACAGTCACTGGAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073347663 Original CRISPR CTGTCTACAGGGCTAGAGGC TGG (reversed) Intronic
900155437 1:1201805-1201827 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155450 1:1201843-1201865 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155463 1:1201881-1201903 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155476 1:1201919-1201941 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155489 1:1201957-1201979 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155502 1:1201995-1202017 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155515 1:1202033-1202055 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155528 1:1202071-1202093 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155541 1:1202109-1202131 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155554 1:1202147-1202169 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155567 1:1202185-1202207 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155580 1:1202223-1202245 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155593 1:1202261-1202283 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155622 1:1202337-1202359 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155635 1:1202375-1202397 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155656 1:1202432-1202454 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155662 1:1202451-1202473 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155743 1:1202679-1202701 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155756 1:1202717-1202739 CTGGGTACTGGGCTAGAGGCTGG - Intergenic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
901424074 1:9170004-9170026 CTGTCTGCTGGGCTAGGTGCTGG - Intergenic
903158900 1:21470552-21470574 CTGCCTACAGGGCAGGAGCCAGG - Intronic
903230243 1:21917665-21917687 ATGACTAAAGGCCTAGAGGCAGG - Intronic
904848716 1:33440848-33440870 CTGTCTACAAAGCTAAACGCTGG + Intergenic
906697428 1:47832689-47832711 CTGTCTACAAGTCTTGACGCTGG + Intronic
908919626 1:69173515-69173537 CTGTTGACAGTTCTAGAGGCTGG - Intergenic
913543332 1:119842593-119842615 CTGCCTACAGGGCAGGAGCCAGG + Intergenic
913602821 1:120438464-120438486 CTGCCTACAGGGCAGGAGCCAGG - Intergenic
913603569 1:120444817-120444839 CTGCCTACAGGGCAGGAGCCAGG - Intergenic
913656597 1:120966336-120966358 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914007734 1:143747592-143747614 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914278051 1:146142810-146142832 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914363995 1:146962080-146962102 CTGCCTACAGGGCAGGAGCCAGG - Intronic
914381584 1:147121233-147121255 CTGCCTACAGGGCAGGAGCCAGG + Intergenic
914487684 1:148125059-148125081 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914539098 1:148593758-148593780 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914587260 1:149073928-149073950 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914588035 1:149080213-149080235 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914627580 1:149477865-149477887 CTGCCTACAGGGCAGGAGCCAGG - Intergenic
914646560 1:149658073-149658095 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
915717348 1:157957018-157957040 GTGCCTACAGGAATAGAGGCTGG + Intergenic
919240954 1:194915024-194915046 CAGTCTTCAGGGCTGTAGGCTGG + Intergenic
919685975 1:200483975-200483997 CTGCCTACAGTGCTAAGGGCAGG - Intergenic
920049265 1:203153545-203153567 CAGTCTGCAGGGCTACAGGGAGG - Intronic
920123848 1:203677996-203678018 CTGGCTTCTGGGCTACAGGCAGG - Intronic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
920844798 1:209584671-209584693 CTGACTCCAGAGCAAGAGGCTGG - Intronic
920848135 1:209610616-209610638 CTACATACAGGGCAAGAGGCAGG - Intronic
923016858 1:230133481-230133503 CTGTCGACCAGGCTGGAGGCTGG + Intronic
923134660 1:231107401-231107423 CTGCCTCCTGGTCTAGAGGCAGG + Intergenic
1065602533 10:27384328-27384350 CTTTCTTCAGGTCAAGAGGCAGG - Intergenic
1068739468 10:60452144-60452166 CTGTGTGCACCGCTAGAGGCTGG - Intronic
1069747104 10:70722505-70722527 CTGTTTTCAGGGATACAGGCAGG - Intronic
1069822363 10:71235668-71235690 CAGTCCTCAGGGCTGGAGGCTGG - Intronic
1071051694 10:81458461-81458483 CTGTCTACAGAGCTAAGGGAAGG + Intergenic
1071836846 10:89426757-89426779 CTTTTTTCAGGGCAAGAGGCTGG - Intergenic
1072276619 10:93829546-93829568 GAGTCTACAGGCTTAGAGGCAGG + Intergenic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1073814979 10:107196518-107196540 CTGTCTACAAGGCAGGAAGCAGG + Intergenic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1075714742 10:124549720-124549742 ATGCCCACAGGGCCAGAGGCAGG - Intronic
1077046683 11:549812-549834 CTGTCTTCAGGGGTAGGGGCAGG - Intronic
1077343113 11:2034806-2034828 CTGTCTACAGGGCCACTGGTGGG + Intergenic
1078611408 11:12822614-12822636 CTTTTTCCAGGGCTGGAGGCTGG + Intronic
1079228864 11:18632114-18632136 CTGTCGTCCGGGCTGGAGGCTGG - Intronic
1081805463 11:45887585-45887607 CTGCCCACTGGGCCAGAGGCAGG - Intronic
1085281690 11:75335159-75335181 CTGTCTGTTGGGCTGGAGGCAGG - Intronic
1085654107 11:78296817-78296839 CAGTCCACAGTGCTGGAGGCTGG + Intronic
1087338347 11:96870818-96870840 CTGGCTACAGTCCTACAGGCAGG - Intergenic
1089214901 11:116829518-116829540 CTGTGTTCAGGGCTTGGGGCTGG + Intergenic
1089614147 11:119685722-119685744 ATGTCTTGAAGGCTAGAGGCAGG - Intronic
1202826099 11_KI270721v1_random:89995-90017 CTGTCTACAGGGCCACTGGTGGG + Intergenic
1094216430 12:27947652-27947674 CTTTCTAAAGAGATAGAGGCTGG + Intergenic
1095568639 12:43656516-43656538 TTGTTTACAGTTCTAGAGGCTGG + Intergenic
1095850977 12:46805883-46805905 GTGTCTATAGGGGTAGGGGCTGG + Intronic
1096630321 12:52922293-52922315 CTGTCTTCAGGGAGAGAGGGAGG - Intronic
1096816233 12:54203621-54203643 CTGACCCCAGGGCCAGAGGCAGG + Intergenic
1097291294 12:57917840-57917862 CTGTTTTCATGGCTAGAGGAGGG + Intergenic
1101095298 12:101332616-101332638 CTGTTTAGAGGCATAGAGGCTGG - Intronic
1104261998 12:127193228-127193250 GTGTCTACAGGGCATTAGGCAGG + Intergenic
1108822243 13:54367842-54367864 ATGTCTATAGGGATGGAGGCTGG + Intergenic
1111415353 13:87934723-87934745 TTCTCTACAGTTCTAGAGGCTGG + Intergenic
1113683180 13:112259336-112259358 CCCTCTGCAGGGCGAGAGGCAGG + Intergenic
1114588694 14:23839358-23839380 CTGTATCCAGAGCTAGAGTCAGG + Intergenic
1116614136 14:47112394-47112416 CTGTCTTGAGGGGTAGAGGGAGG - Intronic
1117706776 14:58478047-58478069 CTGTCATCTAGGCTAGAGGCTGG + Intronic
1118048641 14:62002605-62002627 CTGTCTCCGGGGAGAGAGGCAGG - Intronic
1119159177 14:72438924-72438946 CTGTCCAGAGGGCAAGAGGCAGG - Intronic
1119221909 14:72915606-72915628 CTGTTTCCAGGGCTAGAGCAGGG - Intergenic
1119635804 14:76272292-76272314 TTCTCTACAGTGCTGGAGGCTGG + Intergenic
1122155355 14:99747327-99747349 CTTTCTCCTGGGCCAGAGGCTGG - Intronic
1122214616 14:100194614-100194636 CTGTCTTCAAGGTTGGAGGCTGG + Intergenic
1122281048 14:100622575-100622597 CAGTCTACAGGCCGGGAGGCAGG - Intergenic
1126490770 15:49233225-49233247 ATGTCTACATGGCCAGAGCCAGG + Intronic
1126943629 15:53792821-53792843 CTGTCACCTGGGCTGGAGGCCGG - Intergenic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1129681237 15:77659633-77659655 CTGCCTACAGGGGTAGTGGATGG + Intronic
1129737230 15:77973161-77973183 ATTTCTACAGGGAGAGAGGCAGG + Intergenic
1129848848 15:78780474-78780496 ATTTCTACAGGGAGAGAGGCAGG - Intronic
1130253104 15:82313606-82313628 ATTTCTACAGGGAGAGAGGCAGG + Intergenic
1132458212 16:35931-35953 CTGTCTCCAGGGCCAAGGGCTGG - Intergenic
1134523004 16:14927158-14927180 CTGTCAGCAGGGCAGGAGGCCGG - Intronic
1134710671 16:16325809-16325831 CTGTCAGCAGGGCAGGAGGCCGG - Intergenic
1134718842 16:16370097-16370119 CTGTCAGCAGGGCAGGAGGCCGG - Intergenic
1134948930 16:18342836-18342858 CTGTCAGCAGGGCAGGAGGCCGG + Intergenic
1134955914 16:18382062-18382084 CTGTCAGCAGGGCAGGAGGCCGG + Intergenic
1136023803 16:27456971-27456993 ATGTCCACAGGGCTGGAGGCTGG - Intergenic
1136683467 16:31981178-31981200 CTGTTTACAGGTGTAGAGGGTGG + Intergenic
1137724936 16:50650740-50650762 CTGGCTGCAGGGCGAAAGGCTGG + Intergenic
1138813479 16:60177853-60177875 GTGACTGCAGGGCTAGAGGAAGG + Intergenic
1139357756 16:66377401-66377423 CTTCCTCCAGGGCCAGAGGCAGG + Intronic
1139572665 16:67823012-67823034 GTGTCTAGAAGGCAAGAGGCTGG + Intronic
1141046781 16:80722726-80722748 CTTTGTACAGGGCTAGGAGCTGG + Intronic
1141464591 16:84197338-84197360 CTGTTCACAGGGCTGGAGGCAGG + Intergenic
1141547516 16:84781144-84781166 CTGTCTCCAGGCCAAGAAGCAGG - Intergenic
1142266885 16:89068047-89068069 CTCTCCCCAGGGCTGGAGGCTGG + Intergenic
1143022211 17:3922771-3922793 CTGCCCACAGGGCCAGAGGCAGG - Intergenic
1143432350 17:6896297-6896319 CAGCCTACAGGGCCAGGGGCAGG - Intronic
1144828309 17:18118766-18118788 CTCTCTACAGGGCCTGGGGCCGG - Exonic
1147322176 17:39653118-39653140 CTGTTGACAGGACCAGAGGCTGG + Intronic
1148162108 17:45456157-45456179 CTGTCTACAGAGGTAGAGAGTGG - Intronic
1148854126 17:50569443-50569465 TAGGCTACAGTGCTAGAGGCAGG - Intronic
1149429771 17:56588463-56588485 CTGTCTCCAGGGCTGGAGAGAGG + Intergenic
1150393341 17:64802805-64802827 CTGTCTACAGAGGTAGAGAGTGG - Intergenic
1151279772 17:73064759-73064781 CTGGCTACAGGGTTGGATGCCGG - Intronic
1152962167 18:86497-86519 CTGTCTCCAGGGCCAAGGGCTGG - Intergenic
1153837009 18:8972342-8972364 CTGTCCTCAGGGCTGGAGGCTGG + Intergenic
1156605746 18:38665038-38665060 CTGTCTCCAAGCCCAGAGGCTGG - Intergenic
1157297848 18:46458915-46458937 ATGTCTCCAGGGCTAAAGGCTGG + Exonic
1159282507 18:66305017-66305039 CTGTTAACAGGGCTGGAGGTAGG - Intergenic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162565141 19:11441806-11441828 CTGTGTACTGGGCAGGAGGCTGG + Intronic
1166988611 19:46677544-46677566 ATGTTTAGAGGGCCAGAGGCAGG - Intronic
1167464825 19:49645197-49645219 CTGACTCCAGGGCCTGAGGCAGG + Intronic
1168540694 19:57207232-57207254 CTGTCTACTTGGCTGGATGCAGG - Intronic
1202678317 1_KI270711v1_random:27497-27519 CTGCCTACAGGGCAGGAGCCAGG + Intergenic
925025249 2:602105-602127 CTTCCTCCAGGGCTTGAGGCTGG + Intergenic
927565026 2:24104469-24104491 GAGACTACTGGGCTAGAGGCTGG - Intronic
927719126 2:25372070-25372092 CGGTCTACAGTGCTCAAGGCGGG - Intergenic
931633380 2:64321079-64321101 CTTTCTCCAGCTCTAGAGGCTGG - Intergenic
931709327 2:64974642-64974664 CTGTGTGCAGGGTTAGGGGCTGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
935798474 2:106668731-106668753 CTATCTCCAGGGCTAGAGGTGGG + Intergenic
938107874 2:128545545-128545567 GAGTCTACAGAGCTAGAAGCTGG + Intergenic
938213194 2:129485701-129485723 CTGTCTCCAGGGCCAGGTGCTGG + Intergenic
938582547 2:132660077-132660099 CTGGAGACAGTGCTAGAGGCGGG - Intronic
946392764 2:219426392-219426414 CTCTCTCCTGGGCTAGGGGCTGG - Exonic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
947825264 2:233101385-233101407 ACGTCTACAGTCCTAGAGGCAGG - Intronic
948462815 2:238138595-238138617 CTGTCTGCAGGGCGAGGGGAGGG - Intergenic
1168962247 20:1877493-1877515 CTGTGTACCAGGCTAGGGGCGGG - Intergenic
1169281166 20:4268060-4268082 CTGTCTACAAGTCAGGAGGCAGG - Intergenic
1169702630 20:8465237-8465259 CTGTCCACAGAGGTAGAGGTGGG + Intronic
1170435047 20:16317905-16317927 CTGTCTCCAGAGACAGAGGCAGG + Intronic
1172697631 20:36833417-36833439 CTGTTTACAGCGCTAGGGCCTGG + Intronic
1174548083 20:51341612-51341634 CTTTCTACAAGACTAGAGGTCGG + Intergenic
1175249090 20:57598139-57598161 CTGGCTACAGAGCTCGAGACAGG - Intergenic
1175442565 20:59001927-59001949 GTGTCTGCAGGGCCAGATGCTGG - Intronic
1175991747 20:62793344-62793366 CTGTCTCCAGGGCTCTATGCTGG - Intergenic
1176201341 20:63862105-63862127 CTGTCTGCACCGCTCGAGGCCGG + Exonic
1176290759 21:5043465-5043487 CTGTCTACAGGGCCTGAGAGAGG + Intergenic
1176719525 21:10381683-10381705 CTGTGCACAGGGCCAGAGGAAGG + Intergenic
1179866496 21:44220176-44220198 CTGTCTACAGGGCCTGAGAGAGG - Intergenic
1180300758 22:11034657-11034679 CTGTGCACAGGGCCAGAGGAAGG + Intergenic
1180783814 22:18536000-18536022 CAGTCCACAGGACTACAGGCAGG - Intergenic
1181003970 22:20000874-20000896 CTGTTCACAGTGCTGGAGGCTGG - Intronic
1181026303 22:20129704-20129726 CTGTCTGCCGGGCTGCAGGCTGG + Intronic
1181127383 22:20710049-20710071 CAGTCCACAGGACTACAGGCAGG - Intronic
1181240714 22:21475352-21475374 CAGTCCACAGGACTACAGGCAGG - Intergenic
1181265221 22:21627197-21627219 CATTTTACAGGGGTAGAGGCAGG - Intergenic
1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG + Intronic
1183408444 22:37641436-37641458 CTGTCTGCAGGGCCAGAGCGGGG + Exonic
1184500626 22:44869426-44869448 CTGTCTGCAGGGCCAGTGACCGG - Intergenic
1184592433 22:45494045-45494067 CTGTGTACAGGTCTAGAGGAAGG - Intergenic
1185129963 22:49033281-49033303 CTGTCTCCAGGGCTGGAGCCAGG - Intergenic
1185294554 22:50046781-50046803 CTTTGTGCAGGGCTGGAGGCCGG + Intronic
1185376469 22:50484741-50484763 CTGACTACAGGGCATGAGGAGGG - Exonic
950258945 3:11529932-11529954 CTGTCTCCTGGGCAAGAGGATGG - Intronic
951782703 3:26382183-26382205 ATGTCTACACAGCTAGAGACAGG + Intergenic
957281300 3:78154483-78154505 CTGCCTACAGGGCAAGGAGCAGG - Intergenic
959836455 3:110923992-110924014 GTGTTTAGAGGGCTAGAGTCTGG + Intergenic
961044535 3:123699627-123699649 CTGTCTACAGGCTTGGAGGTGGG - Intronic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
964319962 3:155485430-155485452 CTGTCAACAGGCATAGAGACAGG + Exonic
967824833 3:193869759-193869781 GTGTCTGCAGGGCTGGGGGCGGG - Intergenic
968130960 3:196192569-196192591 CTGTCCACCAGGCTGGAGGCGGG - Intergenic
969570008 4:8002668-8002690 CTGTAGACAGGTCTGGAGGCAGG - Intronic
969975263 4:11093163-11093185 ATTTTTACAGGGCTAGGGGCTGG - Intergenic
973002807 4:44972831-44972853 GTGTATACAGGGGTAGAGGTGGG - Intergenic
973603372 4:52563215-52563237 ATTTCCACAGGGCTGGAGGCGGG - Intergenic
975813989 4:78198258-78198280 TCATCTGCAGGGCTAGAGGCTGG - Intronic
975848847 4:78551633-78551655 CTGTGTACAGGGATAGAGCCCGG + Exonic
978387736 4:108192532-108192554 CTTGGTTCAGGGCTAGAGGCTGG + Intergenic
981827441 4:148959760-148959782 ATGGCCACAGGGCTTGAGGCTGG - Intergenic
984039247 4:174708907-174708929 TGATGTACAGGGCTAGAGGCAGG - Intronic
986762309 5:10891360-10891382 CTTTACACAGGTCTAGAGGCTGG - Intergenic
990252656 5:53932368-53932390 CTGTTGGCAGGGCTAGGGGCTGG - Intronic
991398107 5:66225585-66225607 GTGTCTACAGGGAAAGAAGCAGG + Intergenic
994016741 5:94975452-94975474 CTGTCTACAAGCCAGGAGGCAGG + Intronic
999008425 5:148007453-148007475 CAGTCTACAGGGCCACAGTCTGG + Intergenic
1005326242 6:24703438-24703460 CTGACTCCAGGGCTTGAGGCTGG + Exonic
1005448494 6:25950928-25950950 CTGTCACCCAGGCTAGAGGCTGG - Intergenic
1007113310 6:39326196-39326218 ATGTCTGCAGGGCTTCAGGCAGG + Intergenic
1018257077 6:161931406-161931428 ATGTCTACTGGACTGGAGGCTGG - Intronic
1020900978 7:14003141-14003163 CTGTCGCCCAGGCTAGAGGCTGG + Intergenic
1029970480 7:104783721-104783743 CTGACTTCAGGGCTAGAGTCAGG - Intronic
1031206814 7:118769474-118769496 CTGTGTACAAGGCTAAAGGCTGG - Intergenic
1034880041 7:154756486-154756508 CTGTAAACAGGGATAGAAGCAGG - Intronic
1035566145 8:642813-642835 ATGTCTACAGGACTGGGGGCTGG + Intronic
1037322317 8:17655692-17655714 CTGTCTCCCAGGCTGGAGGCTGG - Intronic
1037357794 8:18040852-18040874 CTGGCTACAGGTGAAGAGGCTGG - Intergenic
1037948135 8:23002117-23002139 CTGTCTACAGACCTACATGCTGG + Intronic
1043606153 8:82003025-82003047 CTGTCTCCCAGGCTGGAGGCTGG + Intergenic
1045376659 8:101581095-101581117 CTGTCTACATGGAGAGAGACTGG + Intronic
1046522356 8:115341909-115341931 CTGTCTCCCAGGCTGGAGGCTGG + Intergenic
1046550271 8:115707086-115707108 CTCTTTACAGGTCTAGAGGTAGG + Intronic
1047765402 8:127986160-127986182 CTCTCTACAGGCCGAGAGGCAGG - Intergenic
1049545654 8:143229399-143229421 CTGGCTCCAGGGATAGAGGAGGG + Intergenic
1053008843 9:34622176-34622198 CTGTCTACGGGGATGGAGGGGGG - Intronic
1055765648 9:79660685-79660707 CAGTTTACATGCCTAGAGGCAGG - Intronic
1056548045 9:87629236-87629258 CGGTCTACAGGGAGAGACGCAGG + Intronic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1057177578 9:93011025-93011047 GTGTCTGCAGGGTCAGAGGCAGG + Intronic
1060227988 9:121807788-121807810 CAGACGACAGGGGTAGAGGCTGG + Intergenic
1060495407 9:124114915-124114937 CTGGCTTCTGAGCTAGAGGCAGG - Intergenic
1060724003 9:125995513-125995535 CTGTCTCCATGGCTCCAGGCAGG - Intergenic
1061250384 9:129422991-129423013 CTGTGGACAGGGCTGCAGGCGGG - Intergenic
1062735973 9:138137620-138137642 CTGTCTCCAGGGCCAAGGGCTGG + Intergenic
1186564914 X:10652229-10652251 CTGTTTACAGGGCCAGAGATGGG - Intronic
1194020260 X:88681053-88681075 TTTTCTACAGGGCTAGAAGCTGG - Intergenic
1196071480 X:111528099-111528121 CTATCAACATGGCGAGAGGCTGG + Intergenic
1200096098 X:153663412-153663434 CTGTCACCCAGGCTAGAGGCTGG - Intergenic
1202372330 Y:24207340-24207362 CCATCTGTAGGGCTAGAGGCTGG - Intergenic
1202498455 Y:25462780-25462802 CCATCTGTAGGGCTAGAGGCTGG + Intergenic