ID: 1073349377

View in Genome Browser
Species Human (GRCh38)
Location 10:102809024-102809046
Sequence AGGACGCCTCCAGCACCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073349377 Original CRISPR AGGACGCCTCCAGCACCTTG GGG (reversed) Intronic
901316628 1:8314465-8314487 GGGACTCTTCCACCACCTTGTGG + Intergenic
901461121 1:9392486-9392508 AGGCCACCCCCAGGACCTTGAGG + Intergenic
904703938 1:32376478-32376500 AGGATGCCTCTAGCAGCTTTTGG + Exonic
905788845 1:40779428-40779450 TGGGCCCCTCCAGCACCTCGTGG + Intergenic
911853075 1:102842807-102842829 AGGACCTCTTCAGTACCTTGGGG + Intergenic
915597515 1:156904033-156904055 AGGGCCCCTGCTGCACCTTGAGG + Intronic
920690846 1:208145313-208145335 GGGACGCAGCCAGCACCTTGAGG - Intronic
922163774 1:223097789-223097811 AGGATGGCTCCAGCCCCTCGAGG - Intergenic
1067695058 10:48528560-48528582 AGGAGGGGTCCAGCACCTTAGGG + Intronic
1069591143 10:69642724-69642746 AGGAGCCCTCCAACACCTTAAGG + Intergenic
1070610251 10:77927299-77927321 AGGGGGTCTCCAGCAGCTTGTGG - Intergenic
1070937743 10:80314472-80314494 AGGACGTCTCAAGCACCTCTGGG + Intergenic
1073349377 10:102809024-102809046 AGGACGCCTCCAGCACCTTGGGG - Intronic
1073528075 10:104204782-104204804 ATGACATCTCCAGGACCTTGAGG - Intronic
1074591658 10:114819918-114819940 AGGATGCCTCCAGCATTCTGGGG + Intergenic
1074716653 10:116226084-116226106 AGTACCCCTCCAAAACCTTGGGG - Intronic
1083593644 11:63909012-63909034 TGTTCGCGTCCAGCACCTTGCGG - Exonic
1084171729 11:67404249-67404271 AGGATGACTCCAGCTCCTTGGGG + Exonic
1088626044 11:111731443-111731465 ATGGTGCCTCCAGCACCCTGAGG - Intronic
1089126725 11:116181453-116181475 ATTACGCCACCAGCACCTTTGGG + Intergenic
1090189676 11:124759858-124759880 AGGGGGCGTCCAGCTCCTTGAGG - Intronic
1111914069 13:94342762-94342784 AGGTTGCCTCCTGCACCTCGGGG + Intronic
1113757528 13:112823508-112823530 AGAAAGCCTCCAGCACCTCAAGG - Intronic
1121928190 14:97948303-97948325 AGGATCCCTCCAGCATCTTCAGG - Intronic
1125122866 15:36183527-36183549 ATGACGACTCAAGCATCTTGTGG + Intergenic
1127578713 15:60317189-60317211 AGGACTCCTGCAACACCCTGGGG + Intergenic
1127617811 15:60704401-60704423 AGTGTGCCTCCAGCACCTTTGGG - Intronic
1128304013 15:66586398-66586420 AGTACGCCTCCAGCACCGAGGGG + Intronic
1129734609 15:77952595-77952617 GCTGCGCCTCCAGCACCTTGGGG - Intergenic
1129840981 15:78743396-78743418 GCTGCGCCTCCAGCACCTTGGGG + Intergenic
1129898949 15:79130717-79130739 AGCACAGCCCCAGCACCTTGTGG - Intergenic
1132701264 16:1223080-1223102 AGGACCACGGCAGCACCTTGGGG + Intronic
1132895986 16:2229614-2229636 AGGCCGCCTCCACCACGATGTGG - Exonic
1133058102 16:3157626-3157648 AGGACGCCGCCAGGCCCGTGCGG + Intergenic
1138144233 16:54594876-54594898 CTAACTCCTCCAGCACCTTGAGG - Intergenic
1141531787 16:84651343-84651365 AAGACGACTCCAGGCCCTTGGGG - Intronic
1151697174 17:75723655-75723677 AGGGCTTCTCCAGCACCTCGGGG + Intronic
1160003935 18:75054055-75054077 AGGAGACCTCCAGCACCCTGTGG - Intronic
1160267862 18:77356033-77356055 AGGACGCTTAGAGCTCCTTGCGG - Intergenic
1161220392 19:3115676-3115698 ATGACCCCTCCCGCACCATGCGG - Intronic
1161800166 19:6412930-6412952 AGTTTCCCTCCAGCACCTTGGGG - Intergenic
1161905407 19:7152778-7152800 AGGACTCCTCCAGCTCCTTCAGG + Exonic
1161993536 19:7698715-7698737 AGGACACCCCCAGCTCCATGTGG - Intronic
1162301996 19:9849526-9849548 AGTCTGCCTCCAGCACCTGGGGG - Exonic
1163674745 19:18649979-18650001 AGGAAGTAACCAGCACCTTGGGG + Intronic
1164767333 19:30781935-30781957 AGGGCACCTCCTGCACCTTGAGG - Intergenic
928310884 2:30208748-30208770 AGGATGCCTCCAGGACCCAGAGG + Intergenic
929866069 2:45718291-45718313 AGGAAGGCTCCAGCAATTTGGGG + Intronic
931657045 2:64518669-64518691 AGTACTTCTCCAGCTCCTTGAGG - Intergenic
933691979 2:85185831-85185853 AGGAGGCCTCCACCAACATGGGG - Intronic
934674692 2:96241277-96241299 TGGGCCCCTCCATCACCTTGGGG + Intergenic
936607047 2:113969244-113969266 GGGACTGCTCCAGCAACTTGGGG + Intergenic
938151895 2:128894291-128894313 ATGACACCTCTAGCACCTAGAGG + Intergenic
938565922 2:132518923-132518945 TGGAAGCCACCAGCCCCTTGTGG - Intronic
944295099 2:198052821-198052843 TAGAGGCCTCCAGCACCTTGAGG - Intronic
945290469 2:208121807-208121829 AGGAGCCCTCCAGCACGTTGAGG + Exonic
946008506 2:216545725-216545747 AGGAAACATCCAGCATCTTGAGG + Intronic
948897546 2:240934334-240934356 AGGCCGCCTGCAGCAGCTGGAGG + Intronic
1169278126 20:4247081-4247103 AGGCCGCCTCCTACCCCTTGAGG - Intronic
1171361351 20:24588567-24588589 AGGAGGCCTCCAGCTCCTCATGG + Intronic
1171743948 20:28942812-28942834 TGGACACCTCGAGCGCCTTGAGG + Intergenic
1176112155 20:63415675-63415697 AGGAAGGCTCCGGCACCTCGTGG - Intronic
1177410843 21:20728774-20728796 AGGAAGCCTCCAGCATTTTACGG - Intergenic
1178885349 21:36480494-36480516 GGAACGCCTCCAGCCCTTTGAGG + Intronic
1179173275 21:38989560-38989582 AGGACGCGTCCAGCTCCTTGAGG - Intergenic
1180396801 22:12354987-12355009 TGGACACCTCGAGCTCCTTGAGG - Intergenic
1180402913 22:12509142-12509164 TGGACACCTCAAGCTCCTTGAGG + Intergenic
1181167275 22:20990591-20990613 AGAACGCCTCTTGCACCTGGTGG + Intronic
1181506341 22:23360782-23360804 TGGACACCTCCGGCACCATGGGG - Intergenic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183786282 22:40030871-40030893 AGGACACTACCAGCACCTGGGGG + Exonic
1184032733 22:41904533-41904555 AGGCAGCCTCCAGGGCCTTGGGG + Intronic
1184923065 22:47619298-47619320 AGGACCCATCCATCACCTTCAGG - Intergenic
951206799 3:19934089-19934111 AAGACGCCTCCAATCCCTTGCGG + Exonic
952636254 3:35536526-35536548 AGAAAACCTCCAGGACCTTGTGG + Intergenic
957054657 3:75434784-75434806 AGGGCGTCTCCACCGCCTTGGGG - Intergenic
961483679 3:127200814-127200836 AGCACTCCTCTAGCGCCTTGAGG - Intergenic
964291921 3:155190852-155190874 AGGCTGGCTCCAGCACATTGTGG - Intergenic
966914513 3:184577475-184577497 AGGCCTCCTCCTGCCCCTTGAGG - Intronic
967171081 3:186824410-186824432 GGGACGCCTGGAGCACCATGGGG - Intergenic
968467751 4:761213-761235 AGGAAGCCTCCAGAACCGTCCGG + Intronic
969927863 4:10602059-10602081 AGCACCCTTCCAGCACCTTCAGG + Intronic
975796873 4:78015391-78015413 AGGACTCCTCCAGCAGCTGCTGG + Intergenic
976111736 4:81682670-81682692 ATGACGCCTCCAGCCACCTGGGG + Intronic
982308151 4:153955134-153955156 AGGTAGCCTCCAGCTCCTTCAGG - Intergenic
982661349 4:158210470-158210492 AGGCCGCCCCCAGCACGTAGAGG + Exonic
985275915 4:188237578-188237600 AGGCCGCCTCCATCACTGTGTGG - Intergenic
986528258 5:8704179-8704201 AGGACCCACCCAGCACCATGAGG + Intergenic
986794817 5:11199628-11199650 AGGAGGCATCCAGCTCCTGGTGG - Exonic
988858246 5:35250368-35250390 AGGTAGTCTGCAGCACCTTGGGG - Intergenic
991682091 5:69149897-69149919 AGGACGCTTCAATCAGCTTGTGG + Intergenic
992001872 5:72444004-72444026 AGGCTTCCTCCAGCACCTCGGGG + Exonic
999929780 5:156418636-156418658 AGGACTCCTCCATCTCCTTGTGG - Intronic
1000012879 5:157249174-157249196 AGGTCGCCTTCAGCTCCTTTAGG - Intronic
1000745622 5:165029742-165029764 GGGAAGCCTCCAGAACCTAGTGG + Intergenic
1002172724 5:177384427-177384449 ATGAAGCCTCCAGGACCCTGAGG - Exonic
1002805230 6:567267-567289 AGGACGCCTGCAGCACCAGGAGG - Intronic
1006004157 6:30989107-30989129 AGGAGCCCTCCATTACCTTGTGG - Exonic
1006223452 6:32515978-32516000 AGGACCCCTGCAGCAGCTTTAGG - Intergenic
1006933761 6:37703394-37703416 TGGATGCCTCCAGCACAATGGGG - Intergenic
1012666526 6:101977655-101977677 CGACAGCCTCCAGCACCTTGGGG - Intronic
1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG + Intronic
1019619617 7:1985207-1985229 AGGCCTCCTCCAACCCCTTGAGG + Intronic
1021405012 7:20255430-20255452 AAGATGGCTCCAGCAGCTTGAGG + Intergenic
1023842815 7:44106598-44106620 AGGACTCCTTGGGCACCTTGGGG - Exonic
1025312670 7:57968688-57968710 TGGACGTTTCGAGCACCTTGAGG - Intergenic
1038048104 8:23784215-23784237 AGACCGCCTCCAACACCATGGGG - Intergenic
1042428222 8:68673443-68673465 AGGTCTCCTCCATCAGCTTGTGG - Intronic
1045251351 8:100485718-100485740 AAGACGTCTCCAGCACGTTTGGG + Intergenic
1045690614 8:104756430-104756452 ATGACGACTCCAACACCTAGTGG - Intronic
1047426201 8:124749154-124749176 AGGAGGTCTCCAGCAGCCTGAGG + Intergenic
1048276289 8:133068385-133068407 AGGACACCTCCATCCCCTTCTGG - Intronic
1053049881 9:34951867-34951889 AGGCCACCCTCAGCACCTTGAGG + Intergenic
1056827714 9:89888307-89888329 AGCACCCCTCCAACACCTTCTGG - Intergenic
1061158148 9:128877581-128877603 AGGAGACCACCAGCCCCTTGGGG + Intronic
1203379434 Un_KI270435v1:17515-17537 TGGACACTTCGAGCACCTTGAGG + Intergenic
1187612299 X:20955645-20955667 AGGGCACCTGCAGGACCTTGGGG - Intergenic
1188030507 X:25258405-25258427 AGGAAGCCTCTACCACCCTGTGG + Intergenic
1191115059 X:56843768-56843790 AGGACACCTGCAGCACCTTCAGG + Intergenic
1197875519 X:131100552-131100574 AGGTGGCCTCTAGGACCTTGGGG - Intergenic
1199223183 X:145340674-145340696 AGGGCTCCTCCATCAGCTTGTGG - Intergenic