ID: 1073352511

View in Genome Browser
Species Human (GRCh38)
Location 10:102830119-102830141
Sequence CAGGAGGCCAGGAGGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073352511_1073352519 -4 Left 1073352511 10:102830119-102830141 CCAACCTCCCTCCTGGCCTCCTG No data
Right 1073352519 10:102830138-102830160 CCTGTAATCCCAGCTACAGTGGG No data
1073352511_1073352517 -5 Left 1073352511 10:102830119-102830141 CCAACCTCCCTCCTGGCCTCCTG No data
Right 1073352517 10:102830137-102830159 TCCTGTAATCCCAGCTACAGTGG 0: 3
1: 189
2: 10495
3: 184780
4: 304162
1073352511_1073352520 1 Left 1073352511 10:102830119-102830141 CCAACCTCCCTCCTGGCCTCCTG No data
Right 1073352520 10:102830143-102830165 AATCCCAGCTACAGTGGGAACGG No data
1073352511_1073352524 30 Left 1073352511 10:102830119-102830141 CCAACCTCCCTCCTGGCCTCCTG No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073352511 Original CRISPR CAGGAGGCCAGGAGGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr