ID: 1073352517

View in Genome Browser
Species Human (GRCh38)
Location 10:102830137-102830159
Sequence TCCTGTAATCCCAGCTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499629
Summary {0: 3, 1: 189, 2: 10495, 3: 184780, 4: 304162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073352512_1073352517 -9 Left 1073352512 10:102830123-102830145 CCTCCCTCCTGGCCTCCTGTAAT No data
Right 1073352517 10:102830137-102830159 TCCTGTAATCCCAGCTACAGTGG 0: 3
1: 189
2: 10495
3: 184780
4: 304162
1073352508_1073352517 17 Left 1073352508 10:102830097-102830119 CCTGTCATAATTAGAATAAAACC No data
Right 1073352517 10:102830137-102830159 TCCTGTAATCCCAGCTACAGTGG 0: 3
1: 189
2: 10495
3: 184780
4: 304162
1073352510_1073352517 -4 Left 1073352510 10:102830118-102830140 CCCAACCTCCCTCCTGGCCTCCT No data
Right 1073352517 10:102830137-102830159 TCCTGTAATCCCAGCTACAGTGG 0: 3
1: 189
2: 10495
3: 184780
4: 304162
1073352507_1073352517 27 Left 1073352507 10:102830087-102830109 CCAGTGACTTCCTGTCATAATTA No data
Right 1073352517 10:102830137-102830159 TCCTGTAATCCCAGCTACAGTGG 0: 3
1: 189
2: 10495
3: 184780
4: 304162
1073352506_1073352517 30 Left 1073352506 10:102830084-102830106 CCTCCAGTGACTTCCTGTCATAA No data
Right 1073352517 10:102830137-102830159 TCCTGTAATCCCAGCTACAGTGG 0: 3
1: 189
2: 10495
3: 184780
4: 304162
1073352511_1073352517 -5 Left 1073352511 10:102830119-102830141 CCAACCTCCCTCCTGGCCTCCTG No data
Right 1073352517 10:102830137-102830159 TCCTGTAATCCCAGCTACAGTGG 0: 3
1: 189
2: 10495
3: 184780
4: 304162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073352517 Original CRISPR TCCTGTAATCCCAGCTACAG TGG Intergenic
Too many off-targets to display for this crispr