ID: 1073352519

View in Genome Browser
Species Human (GRCh38)
Location 10:102830138-102830160
Sequence CCTGTAATCCCAGCTACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073352512_1073352519 -8 Left 1073352512 10:102830123-102830145 CCTCCCTCCTGGCCTCCTGTAAT No data
Right 1073352519 10:102830138-102830160 CCTGTAATCCCAGCTACAGTGGG No data
1073352508_1073352519 18 Left 1073352508 10:102830097-102830119 CCTGTCATAATTAGAATAAAACC No data
Right 1073352519 10:102830138-102830160 CCTGTAATCCCAGCTACAGTGGG No data
1073352510_1073352519 -3 Left 1073352510 10:102830118-102830140 CCCAACCTCCCTCCTGGCCTCCT No data
Right 1073352519 10:102830138-102830160 CCTGTAATCCCAGCTACAGTGGG No data
1073352507_1073352519 28 Left 1073352507 10:102830087-102830109 CCAGTGACTTCCTGTCATAATTA No data
Right 1073352519 10:102830138-102830160 CCTGTAATCCCAGCTACAGTGGG No data
1073352511_1073352519 -4 Left 1073352511 10:102830119-102830141 CCAACCTCCCTCCTGGCCTCCTG No data
Right 1073352519 10:102830138-102830160 CCTGTAATCCCAGCTACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073352519 Original CRISPR CCTGTAATCCCAGCTACAGT GGG Intergenic
No off target data available for this crispr