ID: 1073352520

View in Genome Browser
Species Human (GRCh38)
Location 10:102830143-102830165
Sequence AATCCCAGCTACAGTGGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073352511_1073352520 1 Left 1073352511 10:102830119-102830141 CCAACCTCCCTCCTGGCCTCCTG No data
Right 1073352520 10:102830143-102830165 AATCCCAGCTACAGTGGGAACGG No data
1073352513_1073352520 -6 Left 1073352513 10:102830126-102830148 CCCTCCTGGCCTCCTGTAATCCC No data
Right 1073352520 10:102830143-102830165 AATCCCAGCTACAGTGGGAACGG No data
1073352514_1073352520 -7 Left 1073352514 10:102830127-102830149 CCTCCTGGCCTCCTGTAATCCCA No data
Right 1073352520 10:102830143-102830165 AATCCCAGCTACAGTGGGAACGG No data
1073352510_1073352520 2 Left 1073352510 10:102830118-102830140 CCCAACCTCCCTCCTGGCCTCCT No data
Right 1073352520 10:102830143-102830165 AATCCCAGCTACAGTGGGAACGG No data
1073352508_1073352520 23 Left 1073352508 10:102830097-102830119 CCTGTCATAATTAGAATAAAACC No data
Right 1073352520 10:102830143-102830165 AATCCCAGCTACAGTGGGAACGG No data
1073352512_1073352520 -3 Left 1073352512 10:102830123-102830145 CCTCCCTCCTGGCCTCCTGTAAT No data
Right 1073352520 10:102830143-102830165 AATCCCAGCTACAGTGGGAACGG No data
1073352515_1073352520 -10 Left 1073352515 10:102830130-102830152 CCTGGCCTCCTGTAATCCCAGCT No data
Right 1073352520 10:102830143-102830165 AATCCCAGCTACAGTGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073352520 Original CRISPR AATCCCAGCTACAGTGGGAA CGG Intergenic
No off target data available for this crispr