ID: 1073352524

View in Genome Browser
Species Human (GRCh38)
Location 10:102830172-102830194
Sequence ATGTCCACTCTGACCTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073352511_1073352524 30 Left 1073352511 10:102830119-102830141 CCAACCTCCCTCCTGGCCTCCTG No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data
1073352513_1073352524 23 Left 1073352513 10:102830126-102830148 CCCTCCTGGCCTCCTGTAATCCC No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data
1073352512_1073352524 26 Left 1073352512 10:102830123-102830145 CCTCCCTCCTGGCCTCCTGTAAT No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data
1073352521_1073352524 3 Left 1073352521 10:102830146-102830168 CCCAGCTACAGTGGGAACGGACC No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data
1073352516_1073352524 14 Left 1073352516 10:102830135-102830157 CCTCCTGTAATCCCAGCTACAGT No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data
1073352518_1073352524 11 Left 1073352518 10:102830138-102830160 CCTGTAATCCCAGCTACAGTGGG No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data
1073352515_1073352524 19 Left 1073352515 10:102830130-102830152 CCTGGCCTCCTGTAATCCCAGCT No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data
1073352514_1073352524 22 Left 1073352514 10:102830127-102830149 CCTCCTGGCCTCCTGTAATCCCA No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data
1073352522_1073352524 2 Left 1073352522 10:102830147-102830169 CCAGCTACAGTGGGAACGGACCA No data
Right 1073352524 10:102830172-102830194 ATGTCCACTCTGACCTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073352524 Original CRISPR ATGTCCACTCTGACCTCATC AGG Intergenic
No off target data available for this crispr