ID: 1073352719

View in Genome Browser
Species Human (GRCh38)
Location 10:102831292-102831314
Sequence AGGGTGAATTTGCAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073352719 Original CRISPR AGGGTGAATTTGCAGTTGGT TGG Intronic
902733201 1:18383501-18383523 TGGGGGAATCTGCAGATGGTGGG - Intergenic
902802809 1:18840813-18840835 AGGGAGGAACTGCAGTTGGTAGG - Intronic
905765109 1:40594004-40594026 AGTTTTAATTTGCAGCTGGTTGG + Intergenic
906670221 1:47648895-47648917 AGTGGGAATTTGGAGTTGGGGGG + Intergenic
910717011 1:90243363-90243385 AGGTTGAATAGGCAGTTGCTGGG + Intergenic
911557670 1:99364614-99364636 AAGGTGTATTTGCAGTTTGGAGG + Intergenic
912500972 1:110121677-110121699 GGGGTGCATTTGGAGATGGTTGG - Intergenic
914200905 1:145484467-145484489 AGGATGAATAGGCAGTTGCTGGG + Intergenic
914411758 1:147436049-147436071 AGGGTGTCTGTTCAGTTGGTTGG - Intergenic
914480018 1:148057595-148057617 AGGATGAATAGGCAGTTGCTGGG + Intergenic
915801823 1:158801732-158801754 AGGGTGGATATGGAGTTGGGTGG + Intergenic
916531415 1:165660217-165660239 AGCCTGGACTTGCAGTTGGTTGG - Intronic
923463365 1:234226796-234226818 AGTGTGATTTTGCAGGTGGCGGG + Intronic
1062777229 10:162171-162193 TGGGAGAATGAGCAGTTGGTGGG + Intronic
1062809759 10:454056-454078 AGGGTGAATTTGGAGCTGAGAGG + Intronic
1063009154 10:2005650-2005672 AGGGTGACTTTGTCGTAGGTCGG + Intergenic
1069896946 10:71685830-71685852 AGGGTGATTTTGCACGTGGCTGG + Intronic
1070894709 10:79973546-79973568 AGGGAGAATTTGCAGTGAGCCGG + Intronic
1073352719 10:102831292-102831314 AGGGTGAATTTGCAGTTGGTTGG + Intronic
1074103871 10:110374640-110374662 ATGGTGAGTTGGCAGGTGGTGGG - Intergenic
1074464701 10:113671010-113671032 AGGGTGGATTTGAAGTTGTGAGG + Intergenic
1075441329 10:122481423-122481445 AGAGTGAAGCTGCAGCTGGTTGG - Intronic
1080746088 11:35109959-35109981 GGGCTGAGCTTGCAGTTGGTGGG + Intergenic
1084370880 11:68742011-68742033 AGGTGGAATATGCTGTTGGTGGG + Intronic
1087002063 11:93431263-93431285 AGGCTGGATTTGCTGTTGTTTGG - Intronic
1088291774 11:108246342-108246364 AGGGTGAATTTAAAATTGGCAGG + Intronic
1088850409 11:113699448-113699470 AGGGTGAAATTGCAGCAGGAGGG - Intronic
1090046929 11:123343896-123343918 AGTGTGAAATTCCAGGTGGTTGG - Intergenic
1090072397 11:123555178-123555200 AGGGTGGATTTGCAGCTGAGGGG + Intronic
1091267057 11:134278744-134278766 AGGGTGAATTTGAAGCTGAGAGG + Intronic
1092095292 12:5837171-5837193 TGGGTGCCTTTGCACTTGGTAGG - Intronic
1093444732 12:19243629-19243651 AAGGAGAATTTGTAGATGGTGGG + Intronic
1094242812 12:28248219-28248241 AGGGTAAATTTGAGGTTGGTGGG + Intronic
1098454547 12:70657263-70657285 AGGGTGAATTTGAAGGAGGCAGG + Intronic
1102089751 12:110176009-110176031 AGGGTGAAAATGTGGTTGGTGGG - Intronic
1103097723 12:118145385-118145407 AGGGTGGCTTTGCTGTTGTTGGG + Exonic
1106936044 13:34721312-34721334 AAGGGGAATTTGCACTTGGGAGG + Intergenic
1107001290 13:35548209-35548231 AGGGTGAATTTGCACATGGAAGG + Intronic
1107028578 13:35828159-35828181 AGGGTGAACTTGTATTTGTTTGG + Intronic
1109578120 13:64288822-64288844 AGGGTGAGTTTGGAGATGATAGG + Intergenic
1111412224 13:87892017-87892039 AGGGTGCATCTTCGGTTGGTGGG + Intergenic
1111669515 13:91311910-91311932 AGGGTGAATTTGGAGCTGAGAGG + Intergenic
1112762647 13:102708869-102708891 AGGGTGAATTTGGAGCTGAAAGG - Intergenic
1115287791 14:31735780-31735802 AGGTGGAAGTTGCAGTTAGTCGG + Intronic
1116804709 14:49481594-49481616 AGGGTGAGGTGGCAGGTGGTGGG - Intergenic
1118019985 14:61701685-61701707 AGGCTGAATTTGAAATTTGTGGG + Intronic
1118951478 14:70439887-70439909 AGGGTGAATACCCAGTTGTTTGG + Intergenic
1121499783 14:94425641-94425663 AGGGTGAATTTGGAGGTGAGAGG - Intergenic
1121526270 14:94621558-94621580 AGGGGGAGTTTGCAGGTGGCAGG + Intronic
1121806288 14:96827218-96827240 GGGGTGAATTTGGAGTTGAGAGG - Intronic
1124512804 15:30340926-30340948 ATGGTGAGTTTTCAGTTGTTTGG - Intergenic
1124730111 15:32189824-32189846 ATGGTGAGTTTTCAGTTGTTTGG + Intergenic
1126731828 15:51691426-51691448 AGGGTGATGTTGCAGTTAGCAGG + Intronic
1128513035 15:68325366-68325388 AGGGTGAGTCTGCAGGTGGATGG + Intronic
1129036001 15:72648668-72648690 AGTGAGAAATTGCAGTTGCTTGG + Intergenic
1129213884 15:74088548-74088570 AGTGAGAAATTGCAGTTGCTTGG - Intergenic
1129391538 15:75223379-75223401 AGTGAGAAATTGCAGTTGCTTGG + Intergenic
1129400128 15:75276815-75276837 AGTGAGAAATTGCAGTTGCTTGG + Intronic
1130222517 15:82032498-82032520 AAGATGAAGTTGCAGGTGGTAGG - Intergenic
1130916671 15:88310545-88310567 AGGATGAGCTTGCAGTTGGCAGG - Intergenic
1132269595 15:100512191-100512213 AGGATGAATTTGGAGTTGAGAGG - Intronic
1134032756 16:11005669-11005691 AATGTGAAGGTGCAGTTGGTGGG + Intronic
1135070633 16:19348724-19348746 AGTCTGAATATGCAGATGGTTGG - Intergenic
1135435005 16:22420840-22420862 AAGGTGCAGTTGCAGTGGGTGGG + Intronic
1138177421 16:54913339-54913361 AGGGTGAATTTCCAGAAGTTGGG + Intergenic
1139036034 16:62947738-62947760 AGGATGATTTTGGAGTTGGCTGG + Intergenic
1141120095 16:81346968-81346990 AGGGTGAATTTGGAGCTGAGAGG + Intronic
1143803215 17:9402677-9402699 AGGGTGAATTTGGAGCTGAGAGG - Intronic
1144146429 17:12403789-12403811 AGTGTGTGTTTGCAGCTGGTGGG - Intergenic
1144583224 17:16471885-16471907 AGGGTAAAATGGCAGTTGCTGGG + Intronic
1148456046 17:47812081-47812103 AGAGAGAAGTGGCAGTTGGTGGG - Intronic
1149354042 17:55821339-55821361 AGAGTAAATTAGCAGTTGCTTGG + Intronic
1152991877 18:371093-371115 AGGTTGTATTTACAGGTGGTTGG - Intronic
1157732147 18:50013382-50013404 AGGGTGTAGGTGCAGTTGGGAGG - Intronic
1157783510 18:50461280-50461302 GGTGAGAATTTGCAGGTGGTTGG + Intergenic
1158041209 18:53096483-53096505 AGTTTGAATTTGCAGTTGAATGG + Intronic
1160557691 18:79736567-79736589 GAGGTGACTCTGCAGTTGGTGGG + Intronic
1161259389 19:3328416-3328438 AGGGTGACTTTGTGGGTGGTGGG - Intergenic
1162872541 19:13597552-13597574 TGGGTGAATGGGAAGTTGGTTGG + Intronic
1162937234 19:13987316-13987338 AAGGTGACTTTGGAGGTGGTAGG - Intronic
1163197323 19:15732297-15732319 AGGGTGTCTGTTCAGTTGGTTGG - Intergenic
1164700318 19:30280166-30280188 AGGGTGAAAGTGCAGATGGAAGG - Intronic
1164797542 19:31046148-31046170 AGAGTTCATTTGCAGTTGTTTGG - Intergenic
928022093 2:27713354-27713376 AAGGCGAATTTGCAGGTGGTAGG + Intronic
928367155 2:30711650-30711672 AGAGTGGATTTGCAGTTGACAGG - Intergenic
928528998 2:32171517-32171539 AGTGTAAAATTGCAGTTGTTTGG + Intronic
928662534 2:33517771-33517793 AGGGTGAGAATGCTGTTGGTGGG - Intronic
931431448 2:62212059-62212081 AGGGTGAATTTGGAGCAGGAAGG - Intronic
932388133 2:71357530-71357552 AAGGTGAATTTTTAGTTGGATGG + Intronic
932532251 2:72548216-72548238 AGGAAGAATTTGCAGGTGCTTGG + Intronic
932788040 2:74625524-74625546 AGGATGAATTTGGAGTTGAGAGG - Intronic
934678058 2:96264037-96264059 AGGGTGATTTTGTAGAAGGTTGG - Intronic
935288104 2:101583497-101583519 AGGGTGAATTTGGAGCTGAGAGG - Intergenic
935452970 2:103232355-103232377 GGGGTGAATTTGTTGTTTGTTGG - Intergenic
936270510 2:111045159-111045181 AGGGAGACTTTGCATTTTGTTGG + Intronic
939685342 2:145191839-145191861 AAGGGGAATTTGCTGTTGCTTGG + Intergenic
943791733 2:191940688-191940710 AGGGTCACTTGGCAGTTTGTGGG - Intergenic
944892803 2:204135042-204135064 AGCTTGAATTTTCAGTCGGTGGG - Intergenic
946630057 2:221657233-221657255 AGGGTGATTTGGCAGTGGATAGG + Intergenic
946652513 2:221908819-221908841 AGGGTGAACCTCCAGTTGGTAGG + Intergenic
947350814 2:229242970-229242992 AGGATGAATAGGCATTTGGTAGG - Intronic
1168802731 20:653472-653494 AGGGTGAGTTTGCAGGTCGCGGG + Intronic
1169089866 20:2852379-2852401 AGGGTGAATTTGGAGCTGAGAGG + Intronic
1172050945 20:32117538-32117560 GGGGTGAATTTGGAGTGGCTGGG + Intronic
1172107220 20:32523975-32523997 AGGGTGGATTAGCACGTGGTGGG + Intronic
1173286493 20:41675826-41675848 AGGGTGATTATGTAGCTGGTAGG + Intergenic
1174580523 20:51568311-51568333 AGGGAGAATTGGCAGGGGGTGGG - Intergenic
1177664117 21:24130470-24130492 AGGCTGAATTTGGAGCTGGTAGG - Intergenic
1179080630 21:38167352-38167374 GGGGTGATTTTGCATTTGGCAGG + Intronic
1183661417 22:39223829-39223851 AGGGGGAAAGTGCAGTAGGTGGG + Exonic
955042528 3:55331741-55331763 TGGGTGAATGGGCGGTTGGTAGG + Intergenic
956877501 3:73478106-73478128 AGGGTGAATTTGCATTACTTTGG + Intronic
960022598 3:112971944-112971966 AGGGAGAAATTACAGTGGGTTGG - Intronic
960572169 3:119196047-119196069 ATGATGAATTTGTAGTTGGTAGG - Intronic
962773249 3:138632928-138632950 AGGGTGAGTTTGTAGATGATGGG + Exonic
963771886 3:149395219-149395241 AGGGTAAATTTTTAGTTTGTTGG + Intergenic
964795406 3:160491418-160491440 AGAGTGGATTTGGAGATGGTGGG + Intergenic
968223791 3:196959460-196959482 AAGGAGAACTTGCAGCTGGTGGG - Intronic
968785772 4:2621297-2621319 AGGGTGGATTTGGAGTTGAGAGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
970577955 4:17445972-17445994 AGGGTGAATTTGGAGCTGAGAGG + Intergenic
970691074 4:18621315-18621337 AGGCTGAATTTGGTGGTGGTAGG - Intergenic
970702766 4:18762501-18762523 AGTGTAAATCTGCAATTGGTTGG + Intergenic
970945605 4:21687869-21687891 AGGGTGAATTTGAATTTGAGAGG + Intronic
973105351 4:46329187-46329209 AGGGTGGATTTGGAGTTGAGAGG - Intronic
976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG + Intronic
981698385 4:147581761-147581783 AGGCTGACTTTGCAGATGCTTGG - Intergenic
982118421 4:152116623-152116645 AGAGAGAACTTGCAATTGGTTGG - Intergenic
984548294 4:181132434-181132456 AGGGTGAATTTGCTCTTTGCAGG + Intergenic
986992487 5:13570313-13570335 TGGGTGAAATTGAAGTTGGAAGG + Intergenic
987275206 5:16355091-16355113 AGTTTGAGTTTGCTGTTGGTAGG + Intergenic
988796103 5:34655251-34655273 AGGGTGAATTTCAATTTTGTTGG + Intergenic
989162366 5:38403911-38403933 AGGTTGAATTTTCAGTTGACAGG + Intronic
989726441 5:44592172-44592194 AGGTATAATTTGCATTTGGTAGG - Intergenic
990627989 5:57635811-57635833 AGCATGAATTTGAATTTGGTGGG - Intergenic
990873993 5:60463807-60463829 TGTTTGAATTGGCAGTTGGTTGG - Intronic
994303319 5:98172898-98172920 AGGGAGAATTTGTAGGTTGTAGG - Intergenic
994789395 5:104205079-104205101 AGGGTAAATTTGCAGGTGTATGG + Intergenic
995010581 5:107253383-107253405 AGGAGGAAGTTTCAGTTGGTTGG - Intergenic
996508464 5:124293231-124293253 AGGCTGAATTTGGAGATTGTGGG - Intergenic
996567108 5:124892127-124892149 AGGTTGAATTTGAAGTTGACAGG + Intergenic
996894866 5:128469173-128469195 AGAGTTAATTTACAGTTTGTTGG + Intronic
1001567776 5:172711642-172711664 AGGGTGGGTTTGCAGTTCCTAGG - Intergenic
1003101616 6:3180299-3180321 ATTGTGAATTTGCAGTAGGGAGG + Intergenic
1003754094 6:9096511-9096533 AGGCTGAATCTGCATTTGCTGGG + Intergenic
1005619830 6:27609551-27609573 AGGGTGAATTTGGAGCTGAGAGG + Intergenic
1012286124 6:97390650-97390672 AGGTTGTATTGGCAGCTGGTGGG + Intergenic
1013479240 6:110538851-110538873 AGGGTGAATTTGGAGCTGAGAGG + Intergenic
1014368264 6:120572744-120572766 AGGGTGAATGTGCATTAGGAAGG - Intergenic
1017507961 6:155086003-155086025 AGGGAGAATTTGCAGTGGGCCGG - Intronic
1017792004 6:157808542-157808564 AGGGTGAATTTGGAGCTGAGAGG - Intronic
1018079503 6:160246852-160246874 ATGGTGAATATGCAGATGATGGG + Intronic
1025908443 7:65808255-65808277 AGGGTGAATTTGGAACTGATGGG - Intergenic
1027205527 7:76094852-76094874 AGGGTGAATTTGGAACTGATGGG + Intergenic
1028024273 7:85817120-85817142 AGGCTGGATTTGAAGTTGGTTGG - Intergenic
1028437118 7:90816680-90816702 AGGGTGAGTTTGAGGTTGATAGG + Intronic
1031531489 7:122882173-122882195 ACTGTGAAATTGCAGATGGTGGG - Intronic
1031959277 7:127974322-127974344 AAGGTGAATTTGGAGTGGTTTGG + Intronic
1036406629 8:8461157-8461179 AGGTTGAATTTCCTCTTGGTGGG - Intergenic
1036929733 8:12943838-12943860 AGGGTGAATTTTGAGATAGTTGG - Intergenic
1038486169 8:27936662-27936684 AGGGTTTATTTGCAGATGATGGG - Intronic
1042782853 8:72510796-72510818 TGTGTGAGTCTGCAGTTGGTTGG - Intergenic
1044849217 8:96411358-96411380 AGGCTGGAATTGCAGTTGGGAGG - Intergenic
1045025158 8:98080058-98080080 AGGGTGCATGTGATGTTGGTGGG - Intronic
1045321090 8:101081653-101081675 AGTGTGAATTTCAAGATGGTGGG + Intergenic
1047092389 8:121588477-121588499 TGGGTGAATTTGGAGCTGATAGG - Intergenic
1047888062 8:129274845-129274867 AAGGAGAATTGGCAGTTGATTGG + Intergenic
1050364194 9:4859027-4859049 ATGGTGAACTTGCAACTGGTAGG - Intronic
1051059083 9:13025289-13025311 AGGGTGAAACTGTGGTTGGTTGG + Intergenic
1053507124 9:38652655-38652677 AGGCTGCATTTGCAGTGGGTGGG - Intergenic
1053791212 9:41687533-41687555 AGGTTGAATTTGTAGTTGTGAGG - Intergenic
1054153941 9:61627239-61627261 AGGTTGAATTTGTAGTTGTGAGG + Intergenic
1054179560 9:61899227-61899249 AGGTTGAATTTGTAGTTGTGAGG - Intergenic
1054473728 9:65558359-65558381 AGGTTGAATTTGTAGTTGTGAGG + Intergenic
1054657978 9:67681594-67681616 AGGTTGAATTTGTAGTTGTGAGG + Intergenic
1058810980 9:108639227-108639249 AGGGTGATTTTGTAGTTCTTGGG - Intergenic
1187060812 X:15785529-15785551 AGGGTGAATTTGTATTTAGTGGG + Exonic
1187102792 X:16212388-16212410 AGGGTGAATTTGGAGTTGAGAGG - Intergenic
1188591241 X:31838183-31838205 AGGGTGAATTTATAGTGGCTGGG - Intronic
1189367248 X:40398211-40398233 AGGGTGAATTGGCAGGAGGGGGG + Intergenic
1189860062 X:45262860-45262882 AGGGTGACTTGGCTGTTGGTTGG - Intergenic
1190092195 X:47448972-47448994 AGGATGAATTTTCTGATGGTGGG + Exonic
1191183656 X:57587650-57587672 AGGGTGAATTTGGAGCTGAGAGG - Intergenic
1192115318 X:68404922-68404944 AGGGGGAATTAGCATTTAGTGGG + Intronic
1192348488 X:70333571-70333593 AGGGTTAAGTAGCATTTGGTTGG + Intronic
1195463649 X:105155797-105155819 AGGCTGAATTTGCAGGCAGTTGG + Intronic
1197653079 X:129086698-129086720 AGGGTGGGTTTGCACTGGGTGGG - Intergenic
1197985702 X:132264710-132264732 AGGGTAAATTTGTAGTTGGAGGG + Intergenic
1198360915 X:135893779-135893801 AGGGTGAATTTGGAGCTGACAGG + Intronic
1198728464 X:139701633-139701655 AGGGTGTTTTTGTAGTAGGTAGG - Intronic