ID: 1073352848

View in Genome Browser
Species Human (GRCh38)
Location 10:102832155-102832177
Sequence CACTTGAACCAAGGCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073352848_1073352855 9 Left 1073352848 10:102832155-102832177 CCTCCGCCGCCTTGGTTCAAGTG No data
Right 1073352855 10:102832187-102832209 CCTCAGCCTCCTGAGTAGCTGGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
1073352848_1073352853 8 Left 1073352848 10:102832155-102832177 CCTCCGCCGCCTTGGTTCAAGTG No data
Right 1073352853 10:102832186-102832208 GCCTCAGCCTCCTGAGTAGCTGG 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
1073352848_1073352857 17 Left 1073352848 10:102832155-102832177 CCTCCGCCGCCTTGGTTCAAGTG No data
Right 1073352857 10:102832195-102832217 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073352848 Original CRISPR CACTTGAACCAAGGCGGCGG AGG (reversed) Intronic
No off target data available for this crispr