ID: 1073353305

View in Genome Browser
Species Human (GRCh38)
Location 10:102835006-102835028
Sequence CCTGACAAACTGAAGGGAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073353300_1073353305 4 Left 1073353300 10:102834979-102835001 CCAGCATATCACACAATGTACTG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1073353305 10:102835006-102835028 CCTGACAAACTGAAGGGAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 229
1073353299_1073353305 17 Left 1073353299 10:102834966-102834988 CCGTTGTGGGTGGCCAGCATATC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1073353305 10:102835006-102835028 CCTGACAAACTGAAGGGAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073353305 Original CRISPR CCTGACAAACTGAAGGGAGA GGG Exonic
900199980 1:1400084-1400106 CCTCACAAACGCCAGGGAGACGG + Intronic
901350970 1:8596391-8596413 TCTGAGAAACTGATTGGAGATGG - Intronic
901561381 1:10074263-10074285 GCTGAGTAACTGAAGGGAGATGG - Intronic
901676749 1:10889796-10889818 CCTGGCAATCTAATGGGAGATGG + Intergenic
902764718 1:18606678-18606700 CCTGTCATTCTGGAGGGAGAGGG + Intergenic
903051140 1:20602113-20602135 CCTGTCAAAAAGAAAGGAGAGGG + Intronic
903336094 1:22625788-22625810 CCTGACAAGGTAAAGGGAGGAGG + Intergenic
904286371 1:29455335-29455357 CCTGGCACATGGAAGGGAGAGGG + Intergenic
905118241 1:35660851-35660873 CCTGACAAACTTGGGGCAGAAGG - Intergenic
906192622 1:43907705-43907727 CCTGAGAAGGTGAAGGGAGATGG - Intronic
907255681 1:53177023-53177045 GCTGGCACACAGAAGGGAGAGGG - Intergenic
907821690 1:57976218-57976240 CCTGAGAGCCGGAAGGGAGATGG - Intronic
908601229 1:65742531-65742553 CCCTACAAACAGAAGAGAGAGGG - Intergenic
908968985 1:69802580-69802602 ACTTACAAACTGAAGGTAAAGGG - Intronic
911060128 1:93740427-93740449 CCTGACAGACTGATGGGACTGGG - Intronic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
915291623 1:154888054-154888076 TCTGAGAAACTGGAGGGAGTTGG - Intergenic
915302849 1:154961530-154961552 CCGGACAAGCTGGAGGGAGGTGG - Exonic
918672494 1:187236873-187236895 CTTGACAAGTTGAAGTGAGAGGG + Intergenic
919359728 1:196577401-196577423 CCTGACAGACTGAATGGAGAAGG + Intronic
921137824 1:212277839-212277861 CCTGACAAACAGAAGGCACTTGG + Intergenic
921568648 1:216751678-216751700 CCTGATAAAGTCAAGGGAAAAGG + Intronic
923141848 1:231167247-231167269 CCTCACAAAAGCAAGGGAGAGGG + Intronic
924354364 1:243154606-243154628 ACTGACAAACTAGAGGGATAAGG + Intronic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1063790190 10:9435988-9436010 TCTGACAATATGAAGGGAGCAGG - Intergenic
1064137917 10:12766433-12766455 GCTGACAAAGAAAAGGGAGATGG + Intronic
1064652240 10:17521156-17521178 CCTGACTAACTGAAGAGAATAGG + Intergenic
1065572813 10:27089282-27089304 CCTGAAAAATTCAAGGCAGAGGG + Intronic
1066082198 10:31942440-31942462 TCTGTCAAACCCAAGGGAGATGG - Intergenic
1069881514 10:71596618-71596640 GCTGCCACACTGGAGGGAGAGGG - Intronic
1070675814 10:78410554-78410576 CCTGAGACACTGAAGGGAAAGGG - Intergenic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1073353305 10:102835006-102835028 CCTGACAAACTGAAGGGAGAGGG + Exonic
1073511080 10:104042722-104042744 CCTGACAAGCTCCAGTGAGAAGG - Intronic
1073839962 10:107487054-107487076 GATGACAAACTGGAGGGAAAAGG - Intergenic
1074290446 10:112134223-112134245 GCTGAAAAACAGAAGGGAGAGGG + Intergenic
1074551371 10:114445469-114445491 CCTAACAAACTGAACACAGATGG - Intronic
1075831636 10:125417079-125417101 CCTGATGAGCTGACGGGAGATGG - Intergenic
1076289252 10:129331741-129331763 CCTGACAATATGAGGGCAGACGG - Intergenic
1077891941 11:6425159-6425181 CTTTACAGACTGAAGGGAGAGGG + Intergenic
1078789449 11:14527766-14527788 CCTGAGAAACTGAGGTGGGAAGG - Intronic
1079230941 11:18648187-18648209 CCTGAGAAACTGAGGTGGGAAGG - Intergenic
1083815766 11:65131588-65131610 GATGGCATACTGAAGGGAGAGGG + Exonic
1083968880 11:66060160-66060182 GCTGGCAAAGTGAAGGCAGAGGG - Intronic
1084385409 11:68840747-68840769 CCTGACAAACCGAAAGAAGCCGG + Intronic
1086282860 11:85210852-85210874 CCTGTGAAATGGAAGGGAGAAGG - Intronic
1088433825 11:109788518-109788540 CCTGACAAAAGTGAGGGAGAAGG + Intergenic
1089084987 11:115809431-115809453 ACTGACAAACAGCGGGGAGACGG - Intergenic
1089423547 11:118350538-118350560 TCTGACACACTGTAGGGAAAAGG - Exonic
1090989470 11:131803166-131803188 ACTGACAAACTTAATTGAGAGGG + Intronic
1094043623 12:26143843-26143865 CCTGAGAATCTGACAGGAGATGG - Intronic
1097164945 12:57078906-57078928 CCTTAGCAACTGAAGAGAGAGGG + Intronic
1098184276 12:67879603-67879625 CCTGACAGGCTTAAGGGGGATGG + Intergenic
1098348248 12:69528898-69528920 CCTGAGATCCTGAAGTGAGAAGG + Intronic
1098406551 12:70132523-70132545 CCTGAGAAACTGAGGTGGGAAGG + Intergenic
1098843072 12:75501052-75501074 AGTGACACACTGAAGGGAGAGGG - Exonic
1098975758 12:76900254-76900276 CCTTACAAAAGGAAGGGAAATGG - Intergenic
1100686413 12:96991373-96991395 GCTGACATCCTGAAGGGAGGGGG + Intergenic
1101279593 12:103238794-103238816 CCTGAAAGACTAAAGGAAGAGGG + Intronic
1101425751 12:104586711-104586733 CCAGGGAAACTGCAGGGAGAGGG + Intronic
1101586327 12:106088923-106088945 CCTGATAAAATGAAGGGGGAAGG + Intronic
1102237627 12:111304135-111304157 CCTGAAACAGTGCAGGGAGAAGG + Intronic
1102904929 12:116667187-116667209 ACTGACAAGCTGAAGGTAGAAGG + Intergenic
1104428350 12:128696260-128696282 CCTTCCAAACAGAATGGAGAAGG + Intronic
1104726366 12:131078006-131078028 CCTGACAACATGCAGGGTGATGG - Intronic
1105888346 13:24662361-24662383 GCAGACAAAGTGAAGGTAGATGG - Intergenic
1106431503 13:29684983-29685005 AATGACAAATTGAAAGGAGAAGG + Intergenic
1107650730 13:42542097-42542119 CCTTAAAAACTGAAGGGAAAAGG - Intergenic
1108332002 13:49396144-49396166 CCAGGAAAACTGAAGGGAGTGGG + Intronic
1108519836 13:51236374-51236396 ACTGAGAAACTAAAGGGAGAAGG - Intronic
1108623504 13:52206114-52206136 CCTGAAAAAAAGAAGGGTGAGGG - Intergenic
1108663212 13:52604930-52604952 CCTGAAAAAAAGAAGGGTGAGGG + Intergenic
1112141827 13:96652446-96652468 GCAGACAAACAGAAGGAAGAAGG - Intronic
1112286119 13:98105878-98105900 ACAGACACACTGAAGGGTGAGGG + Intergenic
1116256390 14:42562049-42562071 ACAGACACACTGAAGGGTGAGGG + Intergenic
1118765218 14:68904941-68904963 CCTGACAATCTGAAGCTTGAAGG - Intronic
1118835359 14:69474030-69474052 CTTGACAAACTGAGAGGAGCGGG + Intergenic
1118953017 14:70452136-70452158 CCTGAGAGACAAAAGGGAGAGGG + Exonic
1119148940 14:72340582-72340604 GTAGACAAAGTGAAGGGAGAGGG + Intronic
1124210870 15:27764083-27764105 ACTGAGAAACAGAAGGGACAGGG + Intronic
1124664772 15:31582866-31582888 GGTGACCAACTGGAGGGAGAAGG + Intronic
1128524355 15:68402486-68402508 CCAGACCAAGTGGAGGGAGAGGG - Intronic
1128641734 15:69343398-69343420 CCTGACACAATCAAGAGAGAGGG + Intronic
1129148452 15:73671009-73671031 CCTGAGAAACAAAAGGTAGATGG - Intergenic
1130391384 15:83458728-83458750 CCTGAGAAAATGAGAGGAGATGG - Intronic
1131157061 15:90081779-90081801 TCTTGGAAACTGAAGGGAGAAGG + Exonic
1132301510 15:100779072-100779094 CCTGTCCATCTGCAGGGAGAGGG + Intergenic
1132951372 16:2564221-2564243 CCTGGCAAACAGAAGTGAGCAGG + Intronic
1132962978 16:2635949-2635971 CCTGGCAAACAGAAGTGAGCAGG - Intergenic
1133237307 16:4393216-4393238 CCTGAGAAAGTGAAGGGGGCCGG + Intronic
1134229796 16:12419895-12419917 TCTGACTAGCAGAAGGGAGATGG + Intronic
1134833548 16:17343273-17343295 CCTGAAAGACCGCAGGGAGACGG - Intronic
1135762261 16:25146883-25146905 CCTGCCTGACTGAAGGAAGAAGG - Intronic
1138888899 16:61116468-61116490 CCTGACTAATTGAATGGATAAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139485677 16:67255450-67255472 ACTGACTACCTGAAGGGAGTCGG + Exonic
1141454517 16:84131319-84131341 CATGGCAACCTGCAGGGAGAGGG + Exonic
1143106328 17:4532275-4532297 CCAGACAGACTGAAGGAAGAAGG - Intronic
1146682869 17:34821150-34821172 CCAGACACAGGGAAGGGAGAGGG - Intergenic
1150724454 17:67640255-67640277 CCTCTAAAACTGGAGGGAGAGGG + Intronic
1153227346 18:2908921-2908943 CCTGAAAAACAGAAAGGAAATGG - Exonic
1155487392 18:26360425-26360447 CCAGACAAACTGAAAGAAAATGG - Intronic
1157267956 18:46245230-46245252 CCTTAAAAAGTGAAGGAAGAGGG - Intronic
1157857926 18:51118315-51118337 CCCTTCAAACTGTAGGGAGAGGG - Intergenic
1158014551 18:52768339-52768361 CCTCAGAAATTGCAGGGAGAAGG + Intronic
1158249133 18:55467272-55467294 CCTGACAAAGTTCAAGGAGAGGG - Intronic
1158249912 18:55476291-55476313 CCTCACAAAGTGAAGAGTGAAGG + Intronic
1158762857 18:60411108-60411130 CCTGGAATATTGAAGGGAGAAGG + Intergenic
1159049358 18:63404327-63404349 GCAGACAGACAGAAGGGAGAAGG + Intronic
1159924955 18:74260842-74260864 CTTGTCAAACTGAAGGCAGAGGG - Intronic
1159967138 18:74606046-74606068 CCTGACAATCTGAAGGGTTAGGG - Intronic
1162452777 19:10764768-10764790 CCTGAGAATCAGGAGGGAGATGG - Intronic
1163920459 19:20283861-20283883 CCTGCCAAACCCAAGGAAGAAGG + Intergenic
1163939527 19:20479225-20479247 ACTGACCATTTGAAGGGAGAAGG + Intergenic
1166987931 19:46673311-46673333 CTTGAAAGACTGAAGGCAGAGGG - Intergenic
925734128 2:6945511-6945533 CATGCCAAATTGGAGGGAGACGG + Intronic
927123058 2:19986682-19986704 CCTGAGAAGGTGAAGGGAGATGG + Intronic
932604815 2:73157889-73157911 CCTGAGAAACTGATGGGAACAGG + Intergenic
934085519 2:88505999-88506021 ACTGACACACAGAAGAGAGAAGG - Intergenic
934281348 2:91615716-91615738 CCTAACAAACTGAAGGAACCTGG - Intergenic
935607085 2:104982057-104982079 TCTGAAAAACTGAAAGGAGGTGG + Intergenic
936068394 2:109349315-109349337 CTTGATAAAAGGAAGGGAGAAGG - Intronic
936984912 2:118300010-118300032 CAGGAAAAACTGAAAGGAGAGGG + Intergenic
937461991 2:122097348-122097370 ACTGAGAAACTGAATGGAGGGGG - Intergenic
940950773 2:159671140-159671162 CCTGACAAAATCAAGGGATGAGG - Intergenic
942568531 2:177290173-177290195 CCTTAAAAACTGAATGGAGTGGG + Intronic
942785233 2:179693327-179693349 GCTGAATGACTGAAGGGAGAAGG + Intronic
944139501 2:196439703-196439725 CCTGACCAACAGTAGGGAGTGGG + Intronic
944983077 2:205144466-205144488 ACAAACAAATTGAAGGGAGAGGG - Intronic
945417467 2:209591825-209591847 CCTAACAAATAGAGGGGAGAGGG - Intronic
945502883 2:210599469-210599491 TGTGACAAACTGAGGGGTGATGG - Exonic
947526857 2:230882384-230882406 CATGAAATACTGAGGGGAGAGGG - Intergenic
948856650 2:240733361-240733383 CCAGACTCACTGCAGGGAGAGGG + Intronic
1170196227 20:13692418-13692440 CCTGACAAACACAAGGGATGTGG + Intergenic
1170695092 20:18650760-18650782 CATTACAAACTAAAGGCAGATGG + Intronic
1170936233 20:20812217-20812239 GCTGACAAAGAGAAGGAAGATGG - Intergenic
1170962956 20:21041643-21041665 CCTCAGGAAATGAAGGGAGAGGG + Intergenic
1170985218 20:21251631-21251653 CCTGACATGCTGCCGGGAGACGG + Intergenic
1172829717 20:37823323-37823345 CCTGACTGGCTGAAGGAAGAAGG + Intronic
1173062796 20:39678467-39678489 CAGAACAAACTGAAGGGAAAGGG - Intergenic
1173182682 20:40816519-40816541 CCTGCCAGACTGAAGGGGCAAGG - Intergenic
1176665985 21:9688008-9688030 CCTGACACAGAGAAAGGAGAAGG + Intergenic
1178978762 21:37243602-37243624 CCAGAGACACTGAAAGGAGACGG + Intronic
1179132329 21:38649183-38649205 CCTGAGAAGCTGATGGGAAACGG + Intronic
1180637516 22:17272698-17272720 CCAGAGAAAATGAAGGGGGAGGG - Intergenic
1181952181 22:26562485-26562507 TATTACAAACTGGAGGGAGAAGG + Intronic
1183661406 22:39223791-39223813 CTTTACAAACTGAAGGAAGCAGG + Exonic
1184287300 22:43478804-43478826 CCTGACACCCTCAAGGGAGAAGG - Intronic
1184425357 22:44406034-44406056 CCTGGGAGAATGAAGGGAGATGG - Intergenic
950092496 3:10305764-10305786 CCTGAGAAGCGGAGGGGAGAGGG - Intronic
951043145 3:18010472-18010494 CCTGACACTCTGTAGTGAGAAGG + Intronic
951202245 3:19888641-19888663 CCTGTATAACAGAAGGGAGATGG - Exonic
951698637 3:25471933-25471955 CCTGACAATGAGAAGGTAGAGGG - Intronic
952907671 3:38153194-38153216 CTTGGCAAGATGAAGGGAGAAGG - Intergenic
954617497 3:51976840-51976862 ACTGACAAACTGAAGACACAAGG + Intronic
955446675 3:59018495-59018517 CCTGATAAACTGCACTGAGAAGG + Intronic
956065815 3:65396055-65396077 GCTGACAGACTGAATGGAGGAGG + Intronic
956917538 3:73888645-73888667 GCTGACAATCTGAGGGGAGAGGG + Intergenic
957469323 3:80638272-80638294 CCTGGGAACCTGAGGGGAGAGGG - Intergenic
959009958 3:101063240-101063262 TCTGACAAACTGAGGTGATAAGG - Intergenic
960068962 3:113407569-113407591 CCTGAGAAAATGAAGGCACAGGG - Intronic
962725170 3:138218361-138218383 TGAGACAAACTAAAGGGAGATGG - Intronic
963147253 3:142007176-142007198 GCAGAAAAACTGAAGGGAAAGGG - Intronic
963225991 3:142862108-142862130 CCTGCCAGGCTGGAGGGAGAAGG + Intronic
967954854 3:194870235-194870257 ACAGACACACTGAAGGTAGAAGG - Intergenic
969028728 4:4194488-4194510 CCTAGCAAACTGAAGGAAGCCGG + Intronic
971984825 4:33808022-33808044 CCTGAGAAATTGAAGGGCAAGGG + Intergenic
973651865 4:53004751-53004773 CCTGACACCCTGAAGACAGATGG + Intronic
978328479 4:107586290-107586312 GCAGACAATTTGAAGGGAGAGGG + Intergenic
979247439 4:118525039-118525061 ACTGACAAACTGGAGGGATAAGG - Intergenic
979297550 4:119050967-119050989 CCCAACAAACTGGAGGGAGAAGG + Intronic
980939877 4:139263643-139263665 AGAAACAAACTGAAGGGAGAGGG + Intergenic
982304991 4:153921756-153921778 CCTGAGTAATTGAAGAGAGAGGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986418169 5:7549330-7549352 CATGGCAAATGGAAGGGAGATGG + Intronic
987069166 5:14319790-14319812 CCTGAGGAACTGAATGGGGAAGG + Intronic
988224240 5:28391495-28391517 CCTGACAAACAGAACTGAGAAGG + Intergenic
991492237 5:67194731-67194753 CCTTCCAACCTGAAGGGTGAGGG + Intronic
991776640 5:70091658-70091680 GCTGACACACTGAAGGGGCAAGG + Intergenic
991855927 5:70967105-70967127 GCTGACACACTGAAGGGGCAAGG + Intergenic
991869942 5:71099878-71099900 GCTGACACACTGAAGGGGCAAGG + Intergenic
992979767 5:82156723-82156745 CATGACAAACTAGAGGAAGAGGG - Intronic
994063574 5:95509305-95509327 GCAGACACACTGAAGGGTGAGGG + Intronic
994516306 5:100776656-100776678 CCTCACATAGTGAAGAGAGAGGG - Intergenic
995491692 5:112699643-112699665 CCTGACAAAATAAAAAGAGAGGG - Intergenic
996035009 5:118749178-118749200 CCTGACATGGTGAAGAGAGAGGG - Intergenic
997113584 5:131101731-131101753 CCTAACAAAATGAAGTCAGAAGG - Intergenic
1000686571 5:164256849-164256871 CCTAACCCACTGAAGGGAGTCGG + Intergenic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1002682802 5:180981520-180981542 CCTGAGAACCTGAAGGGTAAAGG + Intergenic
1004529094 6:16437004-16437026 CCTGAGTAACTGGAAGGAGATGG + Intronic
1006562883 6:34928779-34928801 TCTGGCTAACTGAAGGGAGATGG - Intronic
1007425426 6:41743310-41743332 ACTGCCATACTGCAGGGAGAAGG + Exonic
1009598861 6:65771988-65772010 GCTGTCAAAGTGAAGGGAGGAGG - Intergenic
1010292436 6:74153341-74153363 CCTGAGAAACTGTTGGGGGATGG - Intergenic
1010333520 6:74653328-74653350 CCTGAAAAATAGAAGTGAGAAGG - Intergenic
1011417140 6:87133672-87133694 TTTAACAAAATGAAGGGAGATGG + Intergenic
1011824555 6:91290706-91290728 CATGAAATACTAAAGGGAGAGGG - Intergenic
1013750531 6:113400584-113400606 CCTGACAAACTGGTGTGGGATGG - Intergenic
1013936862 6:115606655-115606677 CCAGACAAACTGAAAGCAAATGG + Intergenic
1014573160 6:123036625-123036647 CCTGAAAAGGTGAAGGGAAAAGG - Intronic
1015915434 6:138211406-138211428 GCTGCCAAACTGAAAGGATAAGG - Intronic
1015927555 6:138325387-138325409 TGTGAGAAACTGAAGGTAGAAGG - Intronic
1016104535 6:140145899-140145921 GCTGACAAACAGAAGGGAAGAGG + Intergenic
1016508795 6:144816200-144816222 ACAGACAAACTGTAGGGAAATGG + Intronic
1017402160 6:154077144-154077166 CCTGAGAAACTGAAAGGGGGTGG - Intronic
1021027121 7:15684119-15684141 CCTGAGAAACTTAAGGGCAATGG + Intronic
1021299298 7:18952393-18952415 CCTGACAAACTGAAAGGTGCTGG - Intronic
1022229232 7:28397459-28397481 CCCCACAATCTGGAGGGAGAGGG - Intronic
1024008065 7:45241827-45241849 ACTCAGAGACTGAAGGGAGACGG - Intergenic
1024081463 7:45859486-45859508 CCTGCCAACCTGAAGGAAGCTGG + Intergenic
1024428160 7:49253757-49253779 ACAGAAAAAGTGAAGGGAGAAGG + Intergenic
1024620198 7:51150428-51150450 CCTGAAACACTGAATGGAGAAGG - Intronic
1024889732 7:54186113-54186135 CCTGACAGAATAAATGGAGAGGG + Intergenic
1025783822 7:64625874-64625896 GGTGACAAAGTAAAGGGAGAGGG - Intergenic
1027653993 7:80905617-80905639 AGTTACAAACTGAATGGAGAGGG - Intronic
1029433340 7:100546710-100546732 CCTGACATTCTGAAGGGGAAGGG + Intronic
1033935739 7:146583439-146583461 CATGAGAATCTGAAGGGAGAAGG + Intronic
1034315783 7:150131643-150131665 CCTGATGAACTAGAGGGAGAAGG - Intergenic
1034791106 7:153969158-153969180 CCTGATGAACTAGAGGGAGAAGG + Intronic
1035346767 7:158205397-158205419 CTTGATAAACTGCAGTGAGAGGG - Intronic
1035645181 8:1213709-1213731 CCCGACATCCTGATGGGAGAGGG - Intergenic
1037070311 8:14638196-14638218 CCTGACAAACTGAAAAAAGTTGG - Intronic
1037428692 8:18785968-18785990 CCTAACAAAGTGAAGGTTGATGG - Intronic
1040654951 8:49496847-49496869 CCTGAATGACTGGAGGGAGATGG + Intergenic
1041337533 8:56803859-56803881 CCTGCCAAAATGAAGTGAGAGGG + Intergenic
1042105923 8:65326092-65326114 CCAGGCAAAGTGAAGGCAGAAGG + Intergenic
1043783247 8:84363323-84363345 ACTCAGAAACAGAAGGGAGATGG + Intronic
1044120150 8:88384329-88384351 CCTGAAAAAATGAATGGAAATGG - Intergenic
1045092370 8:98759333-98759355 CCTGAGGAAAGGAAGGGAGATGG + Intronic
1045339404 8:101239537-101239559 CCTGCCAAAGTGGAGGCAGATGG + Intergenic
1047123450 8:121932192-121932214 CCTGACAAAGGGCAGGAAGAAGG + Intergenic
1050362484 9:4843805-4843827 CCTGACCAGCAGAAGTGAGAGGG - Intronic
1054784925 9:69201363-69201385 CCTGACAAAGAAAAGGGGGAGGG - Intronic
1055374840 9:75637480-75637502 GCTGATAAATTCAAGGGAGAAGG - Intergenic
1056272535 9:84960368-84960390 CCTGAGCCACAGAAGGGAGAAGG + Intronic
1056652897 9:88483896-88483918 CCTGAGAAAGTGAAGGTAGTAGG + Intergenic
1056761633 9:89419486-89419508 CCTGTCACACGGGAGGGAGAGGG + Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058602181 9:106682112-106682134 CCAGACAAATTGAAGCCAGATGG + Intergenic
1059314926 9:113416084-113416106 CAAGACACACTGAAGGAAGAAGG - Intronic
1059845264 9:118268535-118268557 CTTGACATACTGGAGGAAGAAGG + Intergenic
1061516757 9:131094626-131094648 GCTGAGAAACTGGAGGGAGGCGG - Intergenic
1203660113 Un_KI270753v1:33753-33775 CCTGACACAGAGAAAGGAGAAGG - Intergenic
1186781994 X:12922053-12922075 CCTGACAACCCGAAGGCAGAAGG + Exonic
1187111023 X:16300420-16300442 CCTGAAAAACTGGAATGAGATGG + Intergenic
1187891264 X:23937133-23937155 CAGGAACAACTGAAGGGAGAGGG + Intronic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188453442 X:30334743-30334765 AGTGAGAAAGTGAAGGGAGAAGG + Intergenic
1189267277 X:39726432-39726454 CCACACAGACTGGAGGGAGATGG - Intergenic
1189725974 X:43968699-43968721 CCTGGCAGCATGAAGGGAGAGGG - Intronic
1191865093 X:65697518-65697540 CCTGACAAACTCAAAGAGGAAGG - Intronic
1197266688 X:124381389-124381411 ACTGACAAATTAAAGAGAGAAGG - Intronic
1198702235 X:139409693-139409715 CCTTAAAAACTGAGGGTAGAAGG - Intergenic