ID: 1073356713

View in Genome Browser
Species Human (GRCh38)
Location 10:102860802-102860824
Sequence GGCACGGGCCCTGCCTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073356713_1073356720 13 Left 1073356713 10:102860802-102860824 CCTGTAAAGGCAGGGCCCGTGCC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1073356720 10:102860838-102860860 CACTGTACTTGGCACCTGTGAGG No data
1073356713_1073356718 2 Left 1073356713 10:102860802-102860824 CCTGTAAAGGCAGGGCCCGTGCC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1073356718 10:102860827-102860849 GACCATGCTAGCACTGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073356713 Original CRISPR GGCACGGGCCCTGCCTTTAC AGG (reversed) Intronic