ID: 1073356713

View in Genome Browser
Species Human (GRCh38)
Location 10:102860802-102860824
Sequence GGCACGGGCCCTGCCTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073356713_1073356718 2 Left 1073356713 10:102860802-102860824 CCTGTAAAGGCAGGGCCCGTGCC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1073356718 10:102860827-102860849 GACCATGCTAGCACTGTACTTGG No data
1073356713_1073356720 13 Left 1073356713 10:102860802-102860824 CCTGTAAAGGCAGGGCCCGTGCC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1073356720 10:102860838-102860860 CACTGTACTTGGCACCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073356713 Original CRISPR GGCACGGGCCCTGCCTTTAC AGG (reversed) Intronic
900809274 1:4788874-4788896 GGCATGGGCTGTGCGTTTACAGG - Exonic
901449790 1:9329013-9329035 GGGGCGGGCCCTGCATTTGCTGG + Intronic
901813145 1:11779021-11779043 GGCACGGGCCCAGCAGTTCCAGG + Exonic
902372825 1:16016539-16016561 GGCAGGGGCCCTGCAGTTTCGGG - Intronic
903035566 1:20490475-20490497 GGCAGAGGCCCTGCCTTTCAAGG - Intergenic
905033900 1:34904929-34904951 GGCCCGGGCCCTGCCCCTGCTGG + Exonic
905403455 1:37718591-37718613 GGCCCTGCCCCTGCCTATACTGG - Intronic
905839385 1:41162105-41162127 GGCAGGAGCCCTGCCGTGACGGG + Intronic
907289235 1:53402343-53402365 GGCACCTGCCCAGCCTTTGCAGG + Intergenic
1064120119 10:12611267-12611289 GGCACAGGGCCTGCGTTTAGTGG - Intronic
1069163029 10:65113301-65113323 GCCATGGGCCTTGCCTTTAAAGG + Intergenic
1071499746 10:86194904-86194926 GGCATGGTCCCTGCCCTGACAGG - Intronic
1073023872 10:100471407-100471429 GGCACAGGCCCTGCTTTATCTGG - Intronic
1073356713 10:102860802-102860824 GGCACGGGCCCTGCCTTTACAGG - Intronic
1074897900 10:117792826-117792848 GCCATGGGGCCTGCCTTTAGTGG - Intergenic
1075392330 10:122101343-122101365 GGCACAGTCCCTGCCATTGCAGG - Intronic
1076558553 10:131345995-131346017 GGCACGGGCTCTGTCATCACGGG + Intergenic
1076610828 10:131725087-131725109 GGCAGGGGCCCTGCCTTCTCAGG - Intergenic
1077005572 11:354121-354143 GACAGGGGCCCTTCCCTTACAGG + Intergenic
1077541214 11:3147339-3147361 GGCACGGCTCCTGCCTCTGCTGG + Intronic
1079101360 11:17544175-17544197 GGCACTGCCCCTCCCTTTTCCGG - Intronic
1080872627 11:36250494-36250516 GGCATGGTCCCTGTCTTCACAGG - Intergenic
1082203796 11:49405997-49406019 GGCAGGGGCCTGGCCTTTATAGG + Intergenic
1084225487 11:67712309-67712331 GCCACAGGCCCTGCCTTCCCAGG + Intergenic
1084263310 11:67992159-67992181 GCCACAGGCCCTGCCTTCCCAGG + Intronic
1084404885 11:68965965-68965987 GGCAGGACCCCTGCCTTTGCCGG - Intergenic
1084810093 11:71606968-71606990 GACACAGGCCCTGCCTTCCCAGG - Intergenic
1086412197 11:86553931-86553953 GGCTTGGGCCCTGGCTTTGCTGG + Intronic
1086651294 11:89294437-89294459 GGCAGGGGCCTGGCCTTTATAGG - Intronic
1088779240 11:113118382-113118404 GAAAAGGGCCCTGCCTTTATTGG + Intronic
1090972334 11:131654317-131654339 GACACCGGCCCTGCCTTTGGCGG - Intronic
1094322829 12:29204292-29204314 GACACGGCCCCTGTCTTCACAGG + Intronic
1103981497 12:124739715-124739737 GGCACAGGCTCTGCCCTTTCAGG - Intergenic
1104747810 12:131221133-131221155 AGCAAGGGCCCTGCCTGTGCAGG - Intergenic
1105332867 13:19434148-19434170 GCCACGGGCTTTGCCTTTAAAGG + Intronic
1108626208 13:52231010-52231032 GCCATGGGCCTTGCCTTTAAAGG + Intergenic
1108659858 13:52575472-52575494 GCCATGGGCCTTGCCTTTAAAGG - Intergenic
1112394277 13:99014195-99014217 GGGAGGGGCACTGCCATTACTGG + Intronic
1113759403 13:112837109-112837131 CCCACGGGCCCTGCCTGTCCAGG - Intronic
1113902966 13:113806708-113806730 GGCACGGTCCCTGCCATGATGGG - Intronic
1115333919 14:32226567-32226589 GGCCTGGGACCTGCCTTAACAGG + Intergenic
1117746371 14:58873738-58873760 GGCAAAGGGCCAGCCTTTACAGG - Intergenic
1124367984 15:29087618-29087640 GGCACAGGCCCTGGCAGTACTGG + Intronic
1130906761 15:88246248-88246270 GCCATGGGCCCTGCCTGGACTGG - Intronic
1131208597 15:90473544-90473566 GGCACGGGCCATCCCTCCACTGG - Intronic
1132500707 16:283442-283464 GGCACATGCCCTGCATTTGCCGG - Intronic
1134053274 16:11152536-11152558 GGCACTGGCCCTGCTCTGACAGG - Intronic
1134624607 16:15714710-15714732 GACCCGGGCCCTGCCTTGCCTGG - Intronic
1135977059 16:27115374-27115396 GGCACCGCCCCTACCTTCACAGG - Intergenic
1136067199 16:27767236-27767258 GGCACGTGGCCTGCCTTCCCTGG + Intronic
1138537812 16:57669001-57669023 TGCCCGGGCCTTGCCTTTGCTGG + Intronic
1139267347 16:65652379-65652401 GGCACGGGCCATGCTTTCAATGG + Intergenic
1139590238 16:67929196-67929218 GGCAGGGCCCCTGCCATTGCAGG + Exonic
1142233103 16:88909021-88909043 GGCACCGGCTCTGCCCTTCCTGG + Intronic
1144705766 17:17366941-17366963 GGCAGAGGCCCTGGCTTTGCAGG + Intergenic
1147143462 17:38472265-38472287 CACACGGGCCCTGGCTTGACAGG + Intronic
1148618560 17:49017328-49017350 GGCATGGTCCCTGCTTTGACAGG - Intronic
1150220910 17:63495422-63495444 GGCATGGGCCCTGCCCTTGCTGG - Intronic
1151317940 17:73335384-73335406 GGCAGGGGCCCTGGCATCACTGG + Exonic
1152799455 17:82324078-82324100 GGCACCTGCCCTCCCTTTACTGG - Intronic
1155511710 18:26584618-26584640 GACACAGTCCCTGCCTTTAAGGG + Intronic
1161470124 19:4453088-4453110 GGCTCTGGTCCTGCCTTTGCTGG + Intronic
929918638 2:46156448-46156470 GACACGGTCCCTGCCCTCACGGG - Intronic
932712533 2:74077874-74077896 GGCCCAGGCCCTGCCCTTATGGG + Intronic
934561589 2:95316309-95316331 GGCACCGCACCTTCCTTTACTGG + Intronic
935572397 2:104675900-104675922 GGCACGGGCCCTTCCTGGATGGG - Intergenic
937870270 2:126781394-126781416 GTCCCGGGTCCTGCCTTTCCCGG - Intergenic
940274825 2:151928389-151928411 GGCATGGTCCTTGCCTTTATGGG - Intronic
948017088 2:234699696-234699718 GGCACTGGCCCTGCCTGCTCAGG + Intergenic
948190642 2:236055609-236055631 GGCACAGTCCCTGCCTGGACGGG - Intronic
948391752 2:237616462-237616484 GGCACAGTCCCTGCCTTCAGTGG - Intergenic
1169799759 20:9502943-9502965 GGCAGGGGCCATTCCATTACTGG - Intergenic
1172273191 20:33666148-33666170 GGCTCTGGCCCTACCTTTATGGG - Intronic
1172831282 20:37837267-37837289 AGAACGGGCCCTGCCTTCACAGG - Intronic
1174138797 20:48398608-48398630 GGCAGGAGCCCTGCCTTTCCAGG - Intergenic
1174183776 20:48691178-48691200 GGCGAGGGCCCTGCCTGTGCTGG - Intronic
1175632522 20:60554245-60554267 GGCACGGTCCCTGCCTTGCTGGG + Intergenic
1176072779 20:63235604-63235626 GTCACGGCCCCTGCCTGCACAGG + Intergenic
1176740154 21:10594393-10594415 GCCACGGGCTTTGCCTTTAAAGG - Intronic
1177117615 21:17105013-17105035 GGCAGGGACCCTTCCTTGACCGG - Intergenic
1182166853 22:28183433-28183455 GGCTCTGGTCCTGCCTTCACTGG - Intronic
952945239 3:38474541-38474563 GGCAAGGGTCCTGCCTTTGTCGG + Intronic
955303680 3:57809073-57809095 GGCAGGAGCCCTGCCCTTCCGGG + Intronic
956737644 3:72250442-72250464 GGCAGGGGCCTTGCTTTCACAGG - Intergenic
957078746 3:75620101-75620123 GCCACAGGCCCTGCCTTCCCAGG + Intergenic
961009471 3:123426165-123426187 GGCAAGCGCCCTGCCCTTTCTGG - Intronic
961522272 3:127473652-127473674 GGCTCAGGCCCTGCCTCTAAGGG + Intergenic
962250780 3:133834774-133834796 GGCACAGCCCCTGCCTTTGAGGG - Intronic
964793595 3:160475006-160475028 GGCACAGCCCCTGCCTTTGGTGG - Intronic
968359429 3:198136984-198137006 GGCTGGGTCCCTGCCTTCACCGG - Intergenic
969021825 4:4144069-4144091 GCCACAGGCCCTGCCTTCCCAGG + Intergenic
969732043 4:8963346-8963368 GCCACAGGCCCTGCCTTCCCAGG - Intergenic
969791636 4:9497431-9497453 GCCACAGGCCCTGCCTTCCCAGG - Intergenic
970309971 4:14771906-14771928 GGCACTGGCTCTGCCCTTTCTGG - Intergenic
973236782 4:47914345-47914367 GGTCGCGGCCCTGCCTTTACCGG + Exonic
975683307 4:76897153-76897175 GGCACGGGCTCTGCCTGCCCAGG - Exonic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
981595924 4:146421759-146421781 GGCATGGTCCCTGCCCTTACTGG + Intronic
982421112 4:155199206-155199228 GTCTCTGGCTCTGCCTTTACTGG + Intergenic
982452742 4:155572297-155572319 GCCACGGGCCCTGCCTTGTCAGG - Intergenic
985706815 5:1406227-1406249 GGCAGCGGCCCAGCCTGTACTGG - Exonic
994102397 5:95908275-95908297 GGGACGGTACCTGCCTTTTCAGG - Intronic
1002173353 5:177387584-177387606 GGCACGGGCTGTGCGTTTACAGG - Intronic
1005310029 6:24550255-24550277 AGCACAGAGCCTGCCTTTACAGG - Intronic
1018134546 6:160767131-160767153 GGCGAGGGTCCTGCCTTTCCCGG + Intergenic
1020309246 7:6856099-6856121 GCCACAGGCCCTGCCTTCCCAGG + Intergenic
1021739390 7:23670479-23670501 GGCTCGGGCCTTACCTTTGCAGG + Intergenic
1024532598 7:50406112-50406134 GGCAGGGGCTCAGCCTTTGCTGG - Intergenic
1028985332 7:97004983-97005005 GGCTCGGTCCCTGCCGTTTCAGG - Intergenic
1032792615 7:135253493-135253515 GGCATGGGCCCTGAGTTTAGGGG + Intronic
1034072690 7:148202136-148202158 GGCACGGCCCCTCCCTTCAATGG + Intronic
1034699042 7:153080865-153080887 GGCACAGGCCCTGCCTATCCAGG - Intergenic
1036220162 8:6914724-6914746 GGCAGGGGCCCTGACTTTCTTGG + Intergenic
1037054233 8:14418102-14418124 GACACACGCCCTGCCTTCACTGG + Intronic
1037673708 8:21036979-21037001 GGCCTGGGCCCTGCTTTGACAGG + Intergenic
1039457615 8:37717918-37717940 TGCATGGTCCCTGCCTTTTCTGG - Intergenic
1040878517 8:52177597-52177619 GGCATGGGGCCTGCCATTACTGG + Intronic
1047520754 8:125593847-125593869 GGCAGGTGCCCTCCCTTTCCTGG + Intergenic
1049769267 8:144372316-144372338 GGCCCGGGCACTGCCATCACAGG - Intergenic
1055562096 9:77531137-77531159 ATCTCGGGCCCTGCCTTTACTGG - Intronic
1056169461 9:83969747-83969769 GGCACAGGCCATGCCTCTACAGG - Intronic
1057130647 9:92652026-92652048 GCCACCGCACCTGCCTTTACTGG + Intronic
1057795978 9:98158544-98158566 GGCCTGAGCCCAGCCTTTACAGG + Intronic
1057908372 9:98999459-98999481 GGCATGGGCCCAGCCATAACAGG + Intronic
1058067771 9:100567930-100567952 TGCACAGGCCCTCTCTTTACTGG - Intronic
1058882476 9:109297580-109297602 GGCAGAGGCCCTGGCTTTGCCGG - Intronic
1060453134 9:123762638-123762660 GGCAGGGCCCCTGCCTTTGCAGG + Intronic
1060946242 9:127570751-127570773 GGCAGGGGCCCAGCCTTTGAGGG + Intronic
1186559869 X:10600047-10600069 AGCATGGGCCCTGCCTTCATGGG - Intronic
1187865333 X:23718525-23718547 GGCACAGGACCTGCCTTTTAGGG - Intronic
1198263760 X:134990837-134990859 AGCACGTGCCCTGCCCTTCCTGG + Intergenic