ID: 1073357752

View in Genome Browser
Species Human (GRCh38)
Location 10:102870399-102870421
Sequence ACTTGGGACTACAGGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073357752_1073357758 -7 Left 1073357752 10:102870399-102870421 CCAGTGAGCCTGTAGTCCCAAGT 0: 1
1: 0
2: 2
3: 27
4: 161
Right 1073357758 10:102870415-102870437 CCCAAGTGCTTGGGAGGCTGAGG No data
1073357752_1073357761 24 Left 1073357752 10:102870399-102870421 CCAGTGAGCCTGTAGTCCCAAGT 0: 1
1: 0
2: 2
3: 27
4: 161
Right 1073357761 10:102870446-102870468 CGCGTGAGCCCAGAAGTTACAGG No data
1073357752_1073357760 -1 Left 1073357752 10:102870399-102870421 CCAGTGAGCCTGTAGTCCCAAGT 0: 1
1: 0
2: 2
3: 27
4: 161
Right 1073357760 10:102870421-102870443 TGCTTGGGAGGCTGAGGCAGAGG 0: 60
1: 1917
2: 4025
3: 6450
4: 7444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073357752 Original CRISPR ACTTGGGACTACAGGCTCAC TGG (reversed) Intronic
901487790 1:9577353-9577375 CCCTGGGATTACAGGCTCCCGGG - Intronic
903796716 1:25934562-25934584 ACTTGGGTCCACAGGCCCAAGGG - Intergenic
905229334 1:36504852-36504874 AGCTGGGACTACAGGGGCACAGG + Intergenic
905882023 1:41470179-41470201 AGTTTGGACTACAGGCTGAGAGG + Intergenic
906013469 1:42551884-42551906 AGTTGGGACCACAGGCACATAGG + Intronic
907891585 1:58641652-58641674 TTTTGTGACTAGAGGCTCACAGG + Intergenic
911004756 1:93208461-93208483 AGCTGGGACTACAGGCACAAGGG + Intronic
913204328 1:116522540-116522562 TCTTATGACTAGAGGCTCACAGG + Intronic
916348240 1:163819026-163819048 ACAAGGTACTACAGGATCACAGG + Intergenic
916900104 1:169213232-169213254 TGTTGTGACCACAGGCTCACAGG + Intronic
918975722 1:191483395-191483417 AGCTGGGACTACAGGACCACAGG + Intergenic
920522381 1:206637198-206637220 ACTGGGGAAGACAGGCTCAGAGG + Intronic
924442062 1:244094646-244094668 TGTTGGGACCAGAGGCTCACAGG - Intergenic
1062784924 10:256353-256375 ACTTGTGACATCAGGATCACTGG + Intergenic
1064367006 10:14717332-14717354 ACTAGGGAGAACTGGCTCACAGG + Intronic
1067724478 10:48759475-48759497 TCTTGGGACTACAGGTCCTCTGG + Intronic
1068859433 10:61831535-61831557 AATTGTGACTAGAAGCTCACAGG - Intergenic
1069465952 10:68639288-68639310 AGCTGGGATTACAGGCTCACAGG - Intronic
1071173740 10:82898851-82898873 AGTTGGGACTGCAGGCACCCCGG + Intronic
1072698497 10:97622148-97622170 ACTAGCGACCACAGACTCACAGG + Intronic
1073220711 10:101870805-101870827 AGCTGGGACTACAGGCTACCAGG - Intronic
1073357752 10:102870399-102870421 ACTTGGGACTACAGGCTCACTGG - Intronic
1075750116 10:124761796-124761818 AGCTGGGACTACAGGCGCACAGG - Intronic
1078228500 11:9416065-9416087 AACTGGGATTACAGGCTTACAGG - Intronic
1081348002 11:42014061-42014083 ACTTTGGACTAGAGAATCACTGG - Intergenic
1084092583 11:66888386-66888408 TCTTGGGCAGACAGGCTCACAGG - Intronic
1085701255 11:78747908-78747930 ACTTGGGACTCCAGGTTCTCTGG + Intronic
1088713981 11:112532621-112532643 ACATGTGACCAGAGGCTCACAGG - Intergenic
1091062292 11:132474798-132474820 ACTTTGGAAGACAGGCCCACAGG - Intronic
1091360568 11:134975795-134975817 ACATATGACTACAGGCTCAGTGG + Intergenic
1091663389 12:2400953-2400975 ACTTGGGAGAAAAGGCTCAGAGG - Intronic
1096560353 12:52431662-52431684 ACTTGGGGCTGCAGACTCAAAGG - Intronic
1097443663 12:59642904-59642926 AATTGGGAATACAGGCACAAAGG + Intronic
1100515088 12:95319789-95319811 AAATGGGACTACAGGGTGACTGG + Intergenic
1103869234 12:124079267-124079289 ACTTGGGACTCCTGCCTCAGTGG + Intronic
1104773455 12:131379040-131379062 ACGTGGGACTACAGACACCCGGG - Intergenic
1104939005 12:132386187-132386209 AATTGGGGCTAGAGGCACACGGG + Intergenic
1105050011 12:133040487-133040509 ACTTTGAACTCCAGGCTCAAGGG - Intronic
1105390121 13:19968372-19968394 AGCTGGGACTACAGGTGCACTGG + Intronic
1106669275 13:31887765-31887787 ACTAGAGACTCCAGGTTCACTGG + Intergenic
1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG + Intergenic
1107978442 13:45712895-45712917 AACTGTGACCACAGGCTCACAGG + Intronic
1108207125 13:48101688-48101710 ACTTGGGATTAAAGGCTCTGAGG - Intergenic
1109475574 13:62876695-62876717 ATTTGATAATACAGGCTCACAGG - Intergenic
1110227677 13:73136652-73136674 AGCTGGGACTACAGGCACACAGG + Intergenic
1110356299 13:74571776-74571798 AGCTGGGACTACAGGCACACAGG - Intergenic
1110443061 13:75546920-75546942 TATTGTGACCACAGGCTCACAGG - Intronic
1111949492 13:94699487-94699509 AATTGGGACTACAGGCTATTTGG + Intergenic
1114287768 14:21261092-21261114 AGTTGTGACTACAGGCTTACAGG + Intronic
1114528756 14:23382182-23382204 ACGTGGGACCACAGGATCCCTGG - Intronic
1116105252 14:40494569-40494591 CCTTGAGTCTTCAGGCTCACAGG + Intergenic
1118287846 14:64492870-64492892 ACTCAAGATTACAGGCTCACAGG + Intronic
1118356764 14:65020555-65020577 AGCTGGGACTACAGGCATACAGG + Intronic
1120763268 14:88305231-88305253 TGTTGTGACTAGAGGCTCACAGG + Intronic
1120980602 14:90285762-90285784 AGATGGGACCAAAGGCTCACAGG + Intronic
1121659993 14:95627650-95627672 AGCTGGGACTACAGGCGCACAGG - Intergenic
1122086518 14:99311034-99311056 AGCTGGGATTACAGGCTTACAGG + Intergenic
1126846608 15:52766309-52766331 ACTTGGGCCTCCAGCTTCACTGG + Intronic
1127858987 15:62977304-62977326 ACATGGGACTATAGGGTCCCTGG + Intergenic
1128070553 15:64793541-64793563 AGCTGGGACTACAGGCATACAGG - Intergenic
1128303561 15:66582708-66582730 AGCTGGGACTACAGGCACATGGG + Intronic
1132609173 16:806708-806730 AACTGGGACTACAGGCGCGCAGG - Intronic
1134505099 16:14798859-14798881 ACCTGGGATTACAGGTTTACAGG - Intronic
1134861258 16:17562443-17562465 AGCTGGGACTACAGGCACCCAGG + Intergenic
1135178222 16:20250498-20250520 AGCTGAGACTACAGGCGCACAGG + Intergenic
1135851946 16:25971797-25971819 AGCTGGGATTACAGGCCCACTGG - Intronic
1136276328 16:29181253-29181275 ACGTGGGACTCCAGTCTCCCTGG - Intergenic
1136405419 16:30043353-30043375 GGCTGGGACTACAGGCTCTCAGG + Intronic
1136615810 16:31397759-31397781 GCTAGGGACTCCTGGCTCACAGG + Intronic
1137061301 16:35793618-35793640 ACTTGGGACTCGATTCTCACTGG + Intergenic
1142080712 16:88147313-88147335 ACGTGGGACTCCAGTCTCCCTGG - Intergenic
1143762239 17:9113389-9113411 TGTTGTGACTAAAGGCTCACAGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144686623 17:17230262-17230284 TGTTGGGATTACAGGCTCATGGG - Intronic
1146080162 17:29772787-29772809 ACTTGGGACTCCAGGCTCTCTGG + Intronic
1146303515 17:31710424-31710446 AGTTGGGATTACAGGCGCAGAGG - Intergenic
1146549640 17:33769252-33769274 CTTTGGGGCTTCAGGCTCACAGG + Intronic
1147202749 17:38814410-38814432 AGCTGGGACTACAGGCACCCAGG + Intronic
1147343494 17:39770538-39770560 ACTTGGAAGTACAGAATCACAGG + Intronic
1151633816 17:75329943-75329965 ACATGTGACTACATGCTTACGGG + Intronic
1152816096 17:82408893-82408915 ACATGGGACGACAGCCCCACAGG + Intronic
1155155841 18:23156632-23156654 ACGTGTGACCAGAGGCTCACAGG - Intronic
1156508033 18:37611153-37611175 ATTTGGTCCAACAGGCTCACAGG - Intergenic
1160061813 18:75535710-75535732 ACTTAGGACTACAGGCAGAAAGG + Intergenic
1162189713 19:8935320-8935342 ACTAGAGACTACAGGCTTACTGG - Exonic
1163092972 19:15034146-15034168 AGCTGGGACTACAGGCATACAGG - Intergenic
1163706118 19:18814365-18814387 ATTTAGGACTCCAGGCTCAGGGG + Intergenic
1165461524 19:35946724-35946746 ACATGGGACTCCAGGCCCACAGG - Intergenic
1165483006 19:36076613-36076635 AATTGGGACTTCAGAATCACAGG + Intronic
1167679727 19:50911951-50911973 AGTTGGAAAAACAGGCTCACAGG - Intergenic
1167744135 19:51340944-51340966 ACCTGGGAGTTCAGGCTCCCAGG + Intronic
929434670 2:41919302-41919324 ACTTGGGCCTGCAGGCTCCGTGG - Intergenic
929979057 2:46662055-46662077 ATTTGGGAATTCAGACTCACAGG + Intergenic
931249360 2:60516319-60516341 ACTTGGCTCTGCTGGCTCACAGG + Intronic
932706452 2:74029266-74029288 ACTTGGCACTAAAGGCTGAATGG - Intronic
934729026 2:96644749-96644771 ATTTGGGACTCCAGGCTCACAGG + Intergenic
935535099 2:104284779-104284801 ATTTGGGTCAACAGGCTCATGGG + Intergenic
935714171 2:105925246-105925268 AGTCAGGGCTACAGGCTCACAGG + Intergenic
936770604 2:115908252-115908274 AAATAGGACTACAGGCTCACTGG + Intergenic
938882268 2:135603111-135603133 AGCTGGGACTACAGGCTTGCAGG + Intronic
939165085 2:138631929-138631951 AATTGTGACCAGAGGCTCACAGG - Intergenic
941653087 2:168114576-168114598 CCTTGAGATTACAGCCTCACTGG - Intronic
946314299 2:218899295-218899317 AGTTGGGACTACAGGACTACAGG + Intronic
1169029001 20:2393892-2393914 AGTTGGGACCAGAGGCTCACAGG + Intronic
1171090835 20:22284565-22284587 AGCTGGGACTGGAGGCTCACAGG - Intergenic
1172152153 20:32798184-32798206 ACTTTGGATTACAGGCCAACTGG - Intronic
1172256861 20:33526350-33526372 AAATGTGACTAGAGGCTCACAGG + Intronic
1174065189 20:47859740-47859762 ACTTGGGACTACAGGCCACGTGG - Intergenic
1177600300 21:23302321-23302343 AGCTGGGACTACAGGCCTACAGG + Intergenic
1177862766 21:26474176-26474198 AGCTGGGACTACAGGCCCACAGG + Intronic
1178077039 21:29021977-29021999 AGCTGGGACTACAGGCCTACAGG - Intergenic
1178617333 21:34145492-34145514 ACTTGGGACTGCAGACTCTCAGG - Intergenic
1178693713 21:34774161-34774183 ACTTGGGAGAACAGCCTCACAGG - Intergenic
1179940446 21:44636327-44636349 ACTTGGGTCTGCTGGCTGACGGG + Intronic
1181299552 22:21869750-21869772 AGCTGGGACTACAGGCACACCGG - Intergenic
953739230 3:45522607-45522629 GCCTGGGACTACAGGTGCACAGG - Intronic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
954689873 3:52389986-52390008 AGCTGGGATTACAGGCTTACAGG - Intronic
955944417 3:64178767-64178789 TGTTGGGACCAGAGGCTCACAGG - Intronic
956309076 3:67859200-67859222 AATTGGAAATACAGGCACACAGG + Intergenic
958935032 3:100247582-100247604 AACTGGGACTACAGACTAACTGG + Intergenic
959155446 3:102661206-102661228 ATGTGTGACTAGAGGCTCACAGG - Intergenic
959257768 3:104036583-104036605 AGCTGGGACTACAGGCGTACAGG + Intergenic
960949972 3:122992963-122992985 ACCTGGGGCCACAGGCACACCGG + Intronic
961837425 3:129674625-129674647 ACATTGGACTACAGAATCACAGG + Intronic
961902888 3:130231487-130231509 GCTTGGGTATCCAGGCTCACAGG + Intergenic
963033766 3:141006178-141006200 AGCTGGGATTACAGGCACACAGG + Intergenic
966613161 3:181888440-181888462 AGCTGGGACTACAGGCACACAGG - Intergenic
966759284 3:183402320-183402342 AGCTGGGACTACAGGCACCCGGG - Intronic
966890423 3:184403708-184403730 AGCTGGGACTACAGGTGCACAGG + Intronic
968338880 3:197937805-197937827 AGCTGGGACTACAGCCACACTGG - Intronic
970331895 4:14995150-14995172 AGTTGGGACTCCAGGAACACAGG - Intergenic
973033325 4:45372521-45372543 AACTGGGACTACAGGTGCACAGG - Intergenic
976248536 4:83027380-83027402 AGCTGGGACTACAGGCACACTGG - Intergenic
976830859 4:89312342-89312364 ACTTGGTATTACAGGCTTTCTGG + Intergenic
980044292 4:127971120-127971142 AGCTGGGACCACAGGCACACAGG - Intronic
983839010 4:172432234-172432256 ACTTGAGGAAACAGGCTCACAGG + Intronic
985879932 5:2630826-2630848 ACCTGGGACTGCAGGTGCACTGG + Intergenic
986237506 5:5925886-5925908 ACATGTAACTACAGGGTCACTGG + Intergenic
987100336 5:14585587-14585609 ACTGGGTGCTACAGGCACACAGG - Intronic
987447433 5:18037642-18037664 AGTTGGCATTAGAGGCTCACAGG + Intergenic
991024037 5:62010686-62010708 ACTTGGGAATTCAGGTTAACAGG + Intergenic
992952515 5:81874403-81874425 AGTTGGGATTACAGGATTACAGG - Intergenic
995516792 5:112962297-112962319 AGCTGGGATTACAGGCTTACAGG - Intergenic
995560298 5:113374026-113374048 AGCTGGGACCACAGGCCCACAGG + Intronic
998091892 5:139376008-139376030 AATTGGGACTACCGGTGCACAGG - Intronic
999448767 5:151663070-151663092 TTTTGGGACTAGAGGCTCAGTGG - Exonic
1001495247 5:172183577-172183599 AGCTGGGATTACAGGCTTACAGG + Intronic
1002208022 5:177577592-177577614 AGCTGGGACTACAGGCCTACAGG + Intergenic
1002984999 6:2181040-2181062 AGCTGGGACTACAGGCACCCAGG - Intronic
1004772347 6:18797981-18798003 ACTTGGGACAATAGGCCCAAGGG - Intergenic
1005661361 6:28002264-28002286 AATTGGGACTAAAAGCTTACTGG - Intergenic
1005677737 6:28173039-28173061 TATTATGACTACAGGCTCACAGG - Intergenic
1006752149 6:36385332-36385354 AGCTGGGACTACAGGCACACTGG - Intronic
1007218939 6:40263257-40263279 CTTTGGGACTACAGGATCTCTGG + Intergenic
1008770885 6:54978636-54978658 TTTTGTGACCACAGGCTCACAGG - Intergenic
1023079005 7:36510330-36510352 TGTTGAGACTGCAGGCTCACAGG + Intergenic
1027230457 7:76268892-76268914 TCTTGGGACTCCATGCCCACAGG - Intronic
1032247531 7:130225566-130225588 AGCTGGGACTACAGGCGCCCGGG - Intergenic
1033284911 7:140033082-140033104 AGCTGGGACTACAGGCGCACAGG + Intronic
1036428448 8:8667596-8667618 ACTTGGGACTTCTGGGTTACTGG + Intergenic
1038177348 8:25193181-25193203 GCTTGTGACCAGAGGCTCACAGG - Intronic
1039825092 8:41166252-41166274 AGCTGGGACTACAGGCAGACAGG + Intergenic
1041236936 8:55812553-55812575 ACCTGGGACTACAGGATTACAGG - Intronic
1042525293 8:69758316-69758338 AGCTGGGACTACAGGCGCAGTGG + Intronic
1043572133 8:81616835-81616857 AGCTGGGACTACAGGCACGCCGG - Intergenic
1045930585 8:107621052-107621074 ACTTGGAACTTAAGGCTCACTGG + Intergenic
1046428001 8:114081007-114081029 TGTTGTGACCACAGGCTCACAGG - Intergenic
1049637692 8:143697796-143697818 ACTCGGCTCTACAGGCTCACAGG - Intronic
1052309932 9:27055071-27055093 AAATGTGACTAAAGGCTCACAGG + Intronic
1057021042 9:91697805-91697827 ACTTGGGGAAACAGGCTCAGGGG - Intronic
1058817101 9:108694543-108694565 AGCTGGGACTACAGGCACACAGG - Intergenic
1058850467 9:109007101-109007123 AGTTGGGATTACAGGCACCCAGG - Intronic
1059181809 9:112222059-112222081 AGCTGGGACTACAGGCGCACAGG + Exonic
1059190521 9:112321777-112321799 CCTTAGGACTACAGGCTCTGAGG - Intronic
1060553072 9:124494837-124494859 ACCTGGGACCAGAGGCTCAGAGG + Intronic
1060805582 9:126573951-126573973 AGCTGGGACTACAGGCGCACAGG + Intergenic
1061121058 9:128642637-128642659 AGCTGGGACTACAGGCACCCAGG - Intronic
1062148338 9:135003792-135003814 AGCTGGGATTACAGGCTCACAGG + Intergenic
1186854687 X:13614670-13614692 ACTTAGGTCTTCAGGTTCACAGG - Intronic
1186978085 X:14929726-14929748 GATTGGGCCTACAGGCACACAGG - Intergenic
1186988053 X:15037733-15037755 ACTTGGGTCTACAACCTCCCAGG + Intergenic
1188661392 X:32763390-32763412 ATTTTGGCCTACAGGGTCACAGG - Intronic
1189744959 X:44159425-44159447 ACATGAGATTACAGACTCACTGG + Intronic
1190094180 X:47465673-47465695 AGCTGGGACTACAGGCACATGGG - Intronic
1190897900 X:54639454-54639476 TCTTGGGACTAGACGCTCACGGG + Intergenic
1192269077 X:69561606-69561628 AATTGGGCCTACAGGTTCATTGG - Intergenic
1195379572 X:104257511-104257533 AGCTGGTACTACAGGCTCGCGGG + Intergenic
1195732523 X:107981231-107981253 GCTTGGGTCCACAGTCTCACTGG - Exonic
1196732769 X:118957825-118957847 AGCTGGGATTACAGGCTTACAGG - Intergenic
1200788397 Y:7278566-7278588 ATTTTGAAATACAGGCTCACAGG + Intergenic