ID: 1073358704

View in Genome Browser
Species Human (GRCh38)
Location 10:102878909-102878931
Sequence GTAAATAACTTGGCATCTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073358704_1073358708 -6 Left 1073358704 10:102878909-102878931 CCAAGAGATGCCAAGTTATTTAC 0: 1
1: 1
2: 1
3: 33
4: 254
Right 1073358708 10:102878926-102878948 ATTTACAATGGAGGAATTACAGG 0: 1
1: 0
2: 2
3: 18
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073358704 Original CRISPR GTAAATAACTTGGCATCTCT TGG (reversed) Exonic
902406545 1:16187030-16187052 GTCAAGAACTTGGCATATCCGGG + Intergenic
902486967 1:16754287-16754309 GTGAATAACTGGGTTTCTCTAGG + Intronic
903020812 1:20392627-20392649 GAATATAATTTGGCATCTGTAGG - Intergenic
903551606 1:24161047-24161069 GTAAATGAATGGGCATCGCTGGG - Intronic
904355618 1:29937073-29937095 GCAAATCACTTGGCTTCTCTGGG + Intergenic
904723081 1:32525391-32525413 GTAAATATCTTGGGCTCTGTGGG + Intronic
904798409 1:33074957-33074979 GCAAATCACTTGGCTTCGCTGGG + Intronic
905743264 1:40390771-40390793 GCAAATGACTTGACCTCTCTAGG + Intronic
907617178 1:55937432-55937454 ATTAATAATTTGGCTTCTCTAGG - Intergenic
910159099 1:84254433-84254455 GGAAATGAAGTGGCATCTCTTGG + Intergenic
911542060 1:99168858-99168880 GTTAATTTCTTGTCATCTCTAGG + Intergenic
913130287 1:115832925-115832947 GAAAAAGACTTGGCCTCTCTGGG + Intergenic
916745102 1:167679224-167679246 GTAACTTACTTAGCAACTCTAGG + Intronic
918031918 1:180822791-180822813 ATAAATAATTTGGCATCGCTAGG + Intronic
919488669 1:198176417-198176439 TTAAATAACTTGGCATTTGGAGG + Intronic
920872917 1:209808913-209808935 GTAAATCACTTGACCTCGCTGGG - Intergenic
923516942 1:234705981-234706003 GTACATAACTTGTCATATTTTGG - Intergenic
924149475 1:241113694-241113716 GAAAATAATTTAGCCTCTCTGGG + Intronic
1062912301 10:1219332-1219354 GGAAATTACTTGGGATCTTTAGG - Intronic
1064177289 10:13086076-13086098 CTAAATAACAAGGCCTCTCTTGG - Intronic
1064198857 10:13267692-13267714 GTAAATTACTTGACTTCTCTGGG - Intergenic
1064765519 10:18666950-18666972 GTAAATAAATTGATAGCTCTAGG + Intronic
1065171690 10:23036564-23036586 GCAAGGGACTTGGCATCTCTGGG - Intronic
1068517233 10:58039578-58039600 GCAATTTACTTAGCATCTCTGGG + Intergenic
1068956947 10:62826990-62827012 GTAAGTCACTTGGCCCCTCTGGG - Intronic
1069075044 10:64030471-64030493 GTGAATAACTTGTTATCTTTGGG + Intergenic
1069294793 10:66830430-66830452 GTAAATAACTTAACCTCTGTCGG - Intronic
1069991410 10:72318929-72318951 GCAAATCTCTTGGCCTCTCTGGG - Intergenic
1070321414 10:75357676-75357698 GCAAATTACTTAACATCTCTGGG - Intergenic
1073358704 10:102878909-102878931 GTAAATAACTTGGCATCTCTTGG - Exonic
1073479556 10:103777819-103777841 GCAAATGGCTTGGCCTCTCTGGG + Intronic
1076326707 10:129629194-129629216 GTAAATAATTTGGCATCATATGG + Intronic
1076480279 10:130780297-130780319 GTGACTAACTTAGCACCTCTTGG - Intergenic
1077363941 11:2153983-2154005 GAAAGTCACTTAGCATCTCTGGG - Intronic
1077398751 11:2341633-2341655 GGAAAAAACTTGGCATTCCTTGG + Intergenic
1078156371 11:8803461-8803483 GGAAGTAACTTGACTTCTCTAGG - Intronic
1080311932 11:30904580-30904602 GTGAATGAGGTGGCATCTCTTGG + Intronic
1080504202 11:32896148-32896170 GTAAATACCTTTGCATAGCTTGG + Intronic
1081649188 11:44812239-44812261 GCAAATGACTTAGCCTCTCTGGG + Intronic
1082703799 11:56467405-56467427 GAAAATAATTTGGCATATCAAGG + Intergenic
1084118372 11:67055022-67055044 GTCAACAACTTAGCCTCTCTGGG + Intergenic
1085301861 11:75463319-75463341 GCAAGTCACTTGGCCTCTCTGGG - Intronic
1085398250 11:76218614-76218636 GTAAGTCACTTGCCCTCTCTGGG - Intergenic
1085555772 11:77420257-77420279 GTAAATAACTTGGTCCTTCTTGG + Intronic
1085657060 11:78325360-78325382 GCAAATCACTTTGCCTCTCTGGG - Intronic
1087033973 11:93737449-93737471 GTACATATCTTGTCATGTCTGGG + Intronic
1088915656 11:114225951-114225973 GCAAATCACTTAGTATCTCTGGG - Intronic
1090766778 11:129883099-129883121 GTAAATGACTGGGCCCCTCTAGG - Intronic
1093915902 12:24802259-24802281 GTCAATAATTTTGCTTCTCTAGG - Intergenic
1094334733 12:29336259-29336281 GTAATTAACTTAGTATCTCAAGG + Intronic
1094414120 12:30200655-30200677 GTAATTTGCTTGGCATCTCCCGG + Intergenic
1097707122 12:62879846-62879868 CTAATTAAATTGGAATCTCTGGG + Intronic
1099584418 12:84498766-84498788 GTAAATAACTAAACATCACTGGG - Intergenic
1100144062 12:91655535-91655557 GTAAGTATGTTGGCATCTCTTGG - Intergenic
1101132240 12:101700841-101700863 GAAAGTCACTTGACATCTCTGGG - Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102352882 12:112207536-112207558 GAAAATTACTTAACATCTCTGGG - Intronic
1102998434 12:117366953-117366975 GGAAACTCCTTGGCATCTCTGGG + Intronic
1103436842 12:120933303-120933325 GTGAGTAGCTTGGCCTCTCTGGG - Intergenic
1104095015 12:125548956-125548978 GAAAATAACTTGGGAGATCTGGG + Intronic
1105540718 13:21313923-21313945 GCAAATAACTTGGCTGGTCTTGG + Intergenic
1106235162 13:27855285-27855307 GTAAGTTACTTAACATCTCTGGG - Intergenic
1107724157 13:43280937-43280959 TTAAATAACTTGGAAACTTTGGG - Intronic
1108668285 13:52653988-52654010 GGAATTAACTTGGAAGCTCTGGG + Intronic
1109191974 13:59335988-59336010 GTAAATAAATAGGCATCAGTTGG - Intergenic
1111832997 13:93353619-93353641 GTATATTACTTGGCATTTTTTGG + Intronic
1112367346 13:98766644-98766666 GAGTATAACTTGGGATCTCTTGG - Intergenic
1113019939 13:105873657-105873679 GTAAATAACATAGCATCCATAGG + Intergenic
1113119245 13:106908685-106908707 GTAAACAACTTGCCAGCTCCAGG - Intergenic
1115083180 14:29481925-29481947 GTGAATAACTTGCCATGTTTGGG - Intergenic
1115534802 14:34363037-34363059 GAAATTAAATTGGCATCTCTCGG - Intronic
1115868482 14:37774556-37774578 GTAAACAACCTTGCATCTCAGGG + Intronic
1118368594 14:65116625-65116647 GTAAGTCACTTAACATCTCTGGG - Intergenic
1119163169 14:72470358-72470380 GAAAATAACTGGAAATCTCTTGG - Intronic
1119534867 14:75394824-75394846 GTAAATTACTTACCATCTCTGGG + Intergenic
1119935461 14:78588570-78588592 GCAAATCTCTTGGCCTCTCTGGG + Intronic
1120718739 14:87868052-87868074 GTAAATAACTTGGCATTTCTAGG - Intronic
1121787533 14:96673650-96673672 GGAAATCTCTTGGCCTCTCTGGG + Intergenic
1121867798 14:97379081-97379103 GTAACTTACTTGCTATCTCTAGG - Intergenic
1122078323 14:99249676-99249698 GTAAATAACTTAACATCTCTGGG + Intronic
1124936565 15:34178070-34178092 GTTAGTTACTTGACATCTCTGGG - Intronic
1126053787 15:44711179-44711201 GCAAGTCACTTAGCATCTCTGGG + Intronic
1126183659 15:45810308-45810330 GTGATTAAATTGGAATCTCTGGG + Intergenic
1126965359 15:54046257-54046279 GTAAATACCTAGGGATTTCTGGG + Intronic
1127230559 15:56989060-56989082 GTCAATAAATAGTCATCTCTTGG - Intronic
1127615661 15:60682954-60682976 GCAAATAATTTAGCTTCTCTGGG + Intronic
1128153069 15:65375671-65375693 GCAAGTCACTTGACATCTCTGGG - Intronic
1129930754 15:79408705-79408727 ATAAATCACTTGACCTCTCTAGG + Intronic
1130408620 15:83625173-83625195 GTAAATAACACAGCTTCTCTGGG - Intergenic
1130795661 15:87206726-87206748 GTATATAACTTGGGCACTCTGGG + Intergenic
1132488594 16:211509-211531 TTAAAGAACTTGGCAGCTCTTGG - Intronic
1133760766 16:8796814-8796836 GTAAATATCTTACCCTCTCTGGG - Intronic
1135770622 16:25215590-25215612 GCACATGACTTGGCCTCTCTGGG - Intergenic
1135844304 16:25904721-25904743 GTTAGTAACTGTGCATCTCTGGG + Intronic
1138033317 16:53578521-53578543 GTAATTAACTTGGCATCAGATGG + Intergenic
1138130397 16:54474608-54474630 GTAAATCACTTAACTTCTCTGGG + Intergenic
1138152619 16:54672726-54672748 GTAAATATTTTGCCATCACTAGG - Intergenic
1138172834 16:54868906-54868928 GTATATTACCTGGCAACTCTGGG + Intergenic
1139136331 16:64208716-64208738 TGAAATATCTTGGTATCTCTTGG + Intergenic
1139601905 16:67992423-67992445 GTGACTAACTTGTGATCTCTGGG + Intronic
1140132075 16:72171710-72171732 GTAAGTCACTTAGCCTCTCTGGG - Intronic
1141108120 16:81250171-81250193 GTAAGTGACTTGGCCTCTCTGGG - Intronic
1143894001 17:10122642-10122664 GTAAATAACTTGCCATATGGAGG - Intronic
1144378134 17:14665822-14665844 GTCATTCACTTGGCCTCTCTAGG + Intergenic
1144545806 17:16194116-16194138 CCAGATAACTTGGCATGTCTTGG - Intronic
1147625103 17:41895115-41895137 CTCAATCATTTGGCATCTCTGGG - Intronic
1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG + Intronic
1148813260 17:50308413-50308435 GGAAAGGACTTGGAATCTCTAGG - Intergenic
1148902898 17:50891902-50891924 GCAAATAACTTTGCCTCTCTGGG - Intergenic
1149203349 17:54214284-54214306 GAAAATAACTTCTGATCTCTAGG + Intergenic
1150015114 17:61548867-61548889 GTATATATCTAGGCACCTCTTGG + Intergenic
1151397349 17:73832417-73832439 GTAAATAATTAGGGATCTCCAGG - Intergenic
1159010334 18:63053130-63053152 GTAAATTTCCTGGCTTCTCTAGG + Intergenic
1162426084 19:10596799-10596821 GTAAATTACTTCACCTCTCTGGG + Intergenic
1163149061 19:15400500-15400522 GTAAATAACTGGGCTACTCTGGG - Intronic
1164003170 19:21124761-21124783 CTAAATACCTTGGCATCTGATGG + Intronic
1166802117 19:45464529-45464551 GTGAATAACTTAACCTCTCTGGG + Intronic
1168286514 19:55337425-55337447 GGAAGTGACTTGCCATCTCTGGG - Intergenic
1202704238 1_KI270713v1_random:9951-9973 GTGAATAACTGGGTTTCTCTAGG - Intergenic
927835009 2:26388908-26388930 GTCAATAAATTGTTATCTCTAGG + Intronic
928051645 2:28003324-28003346 ATAAATAAATTGAAATCTCTGGG - Intronic
928892583 2:36221329-36221351 GTAATTAACTCCCCATCTCTGGG + Intergenic
929224572 2:39499913-39499935 GAAAATAACCTGGTATCTTTGGG + Intergenic
929942523 2:46345534-46345556 GTAAATTACTTGGCCTCTATGGG + Intronic
934963265 2:98696301-98696323 GAAAAGCACTTGCCATCTCTGGG + Intronic
935918169 2:107981384-107981406 GAAAATAACTTGGCATTTGTTGG + Intergenic
937104769 2:119300117-119300139 GCAAATAACTTTACCTCTCTGGG + Intergenic
938269356 2:129955646-129955668 GTAAGTAGCTTGCCATTTCTGGG + Intergenic
939161791 2:138599077-138599099 GTATATAATTTGGCGTCTCAGGG - Intergenic
939165842 2:138640463-138640485 CCAAATACCCTGGCATCTCTTGG - Intergenic
939613258 2:144334492-144334514 GTAAACAACTTACCCTCTCTGGG - Intergenic
940825217 2:158403985-158404007 GTAAATTACTTAACCTCTCTTGG + Intronic
941601501 2:167548453-167548475 GGAAATAGCTTGCCATTTCTAGG + Intergenic
941753869 2:169163981-169164003 GTAAATTACATGGCCACTCTGGG - Intronic
941833845 2:169994241-169994263 GTAAATAACTCAGCTTTTCTTGG + Intronic
942306089 2:174608932-174608954 GTAAATAGCTCTGCACCTCTGGG + Intronic
942342396 2:174961944-174961966 GTAATTTCCTTGGCATATCTAGG + Intronic
943122308 2:183751979-183752001 GCAATTAAGTTGGAATCTCTAGG + Intergenic
943154161 2:184151335-184151357 GTAGATTAATTGGCCTCTCTGGG + Intergenic
943356686 2:186864908-186864930 ATAAAGAACTTGGCAGCTCAAGG + Intergenic
943461583 2:188175430-188175452 GTAAAGAACTTTGCATTTCCAGG + Intergenic
943812863 2:192211480-192211502 GCAAGTAACTTGACCTCTCTGGG - Intergenic
944130607 2:196343963-196343985 GGAAAGAAGATGGCATCTCTGGG + Intronic
945183752 2:207118635-207118657 GCAAATTACTTGACTTCTCTGGG + Intronic
945485427 2:210389944-210389966 GTAAATTGCTTGACATCTCTGGG + Intergenic
945689537 2:213016264-213016286 GGAAATTACTTAACATCTCTGGG - Intronic
946936643 2:224728695-224728717 GTAACTCACTTGGCAGCTCATGG + Intergenic
948158163 2:235801243-235801265 GCAAATTACTTGACCTCTCTGGG + Intronic
948239611 2:236419013-236419035 GTAGATAACATGGTTTCTCTAGG + Intronic
1169200646 20:3707545-3707567 GTGAGTAACTGGGCATCTCTGGG - Intergenic
1170542107 20:17399674-17399696 TTAAATAACATGGCATCGCACGG - Intronic
1172114152 20:32563717-32563739 ATAAGTCACTTGGCCTCTCTGGG - Intronic
1172979356 20:38929222-38929244 GCAAATAATTTGGCATCTATCGG - Intronic
1172980206 20:38935850-38935872 GTAACTATCTTGACATCTTTGGG - Intronic
1173029743 20:39343896-39343918 GTAAATTACTTAGCAATTCTGGG + Intergenic
1173427425 20:42955250-42955272 TTAAATAACTTGGTTACTCTAGG + Intronic
1173570649 20:44073600-44073622 GCAAGTACCTTGGCCTCTCTGGG - Intergenic
1173595454 20:44256159-44256181 GTAGATTACTTGCCATCTCTGGG + Intronic
1174000270 20:47369444-47369466 GTAAGTAACTTAACCTCTCTGGG + Intergenic
1174463558 20:50699853-50699875 GCAAGTAACTTGGCCTCTCTGGG + Intergenic
1174962566 20:55174776-55174798 TTAAATAACTTGGCAACACCTGG - Intergenic
1175358867 20:58391231-58391253 TGATATAACTTGGCTTCTCTGGG - Intronic
1181904330 22:26181617-26181639 GTAAATTACTTAACCTCTCTAGG + Intronic
1181925582 22:26355972-26355994 GCAAGTAACTTGCCCTCTCTGGG + Intronic
1181953701 22:26572979-26573001 GTAAATCACTTAACCTCTCTGGG + Intronic
1182903060 22:33914857-33914879 GAATATTTCTTGGCATCTCTGGG - Intronic
1183237947 22:36634103-36634125 GTAAGTTACTTAGCATCTCTGGG + Intronic
949391233 3:3564788-3564810 TTCAATTACTTGGCATGTCTAGG + Intergenic
950915200 3:16637561-16637583 GTAAGTTACTTAGCCTCTCTGGG + Intronic
951119501 3:18908563-18908585 GTGAATAACTGGGTTTCTCTAGG + Intergenic
951249275 3:20375346-20375368 ATAAATTACTCAGCATCTCTAGG - Intergenic
951390855 3:22101886-22101908 GTAAATCACTTTGCCTCCCTGGG - Intronic
951431211 3:22609169-22609191 GCAAATAACTTTTCCTCTCTAGG + Intergenic
951812670 3:26717903-26717925 GCAAGTAACTTAGCATCTCTGGG - Intergenic
954920370 3:54185633-54185655 GTAAATATTTTGGGCTCTCTAGG + Intronic
956644291 3:71441164-71441186 GTAAATAACTTTGCAAATCATGG + Intronic
957138279 3:76318063-76318085 GTAAATAACATGAAATCTCAGGG - Intronic
958882728 3:99691377-99691399 GTAAATCACTTTGCTTTTCTAGG + Intronic
959764981 3:110015116-110015138 ATACATAACTTGTCATTTCTTGG - Intergenic
961867297 3:129963006-129963028 GTACATCACTTAACATCTCTAGG - Intergenic
961947509 3:130708350-130708372 GTAATTGACTTGGCAGCTTTAGG - Exonic
962165521 3:133043740-133043762 GTAAATTATTTTGCCTCTCTGGG - Intronic
966240043 3:177745759-177745781 GTAAATAGCTTAGCCTCTCTGGG - Intergenic
966249108 3:177842273-177842295 GTAAATCACTTCACAACTCTGGG + Intergenic
967262282 3:187654606-187654628 GTAAATAACTAGGCATGGCTAGG + Intergenic
967407530 3:189134195-189134217 GTAAATCACCTGCCATCTCTGGG + Intronic
967437061 3:189459541-189459563 GCAAATCACTTAGCACCTCTGGG + Intergenic
969498330 4:7539045-7539067 GGAAACAACTTGGCCTCTCTGGG - Intronic
971648457 4:29238871-29238893 ATAAATATCGTGGCATTTCTTGG + Intergenic
971882335 4:32393203-32393225 GTAAATAACTATGTTTCTCTAGG - Intergenic
973027921 4:45296430-45296452 GTAAATAACTTTGCATTCTTTGG - Intergenic
973191039 4:47386254-47386276 TTAAATATCTTGGAATTTCTTGG - Intronic
974165883 4:58201473-58201495 GTAAATATCTTGGAGTCACTGGG - Intergenic
975414118 4:74088128-74088150 GTAAACAAATTGGCATCCCCAGG - Intergenic
977119789 4:93084764-93084786 GCAAATCACTTGGCTTCTCTTGG - Intronic
981257419 4:142678462-142678484 GAAAATCACTTCGCACCTCTTGG + Intronic
981354216 4:143768539-143768561 GTAAATAACTTAACATCTTTGGG + Intergenic
981576464 4:146211315-146211337 GTAAATCACTTAACTTCTCTGGG - Intergenic
981935340 4:150233624-150233646 GAAAAAAAAATGGCATCTCTTGG - Intronic
984188840 4:176580214-176580236 ATAAGTCACTTGTCATCTCTGGG + Intergenic
984817833 4:183854661-183854683 GTAAATTATTTGACATCTCATGG + Intronic
985293264 4:188407555-188407577 CTCAATATCTTGGCATCACTAGG + Intergenic
985656412 5:1133822-1133844 GGAAATAACTTGGCTCCCCTGGG - Intergenic
989051979 5:37330540-37330562 GTAAATTACTTGACTTCTCTGGG - Intronic
991925451 5:71701007-71701029 GCAAATTACTTAGCCTCTCTGGG + Intergenic
992031057 5:72721854-72721876 GTAGATCACTTGGCCTCTCAGGG - Intergenic
992299889 5:75367196-75367218 GTAAGTTACTTGGCTTGTCTGGG - Intergenic
994012441 5:94921413-94921435 GTAAATCAGTTGCTATCTCTTGG + Intronic
995575080 5:113521241-113521263 GAAAATTACTTAACATCTCTAGG - Intronic
996034703 5:118745588-118745610 TTAAATAACTTTGAATCACTTGG - Intergenic
996504991 5:124258713-124258735 TTAAATAACTTTGCAGGTCTTGG + Intergenic
997933445 5:138090556-138090578 GCAAATGTCATGGCATCTCTGGG + Exonic
998183635 5:139962466-139962488 GGAAATGGTTTGGCATCTCTAGG + Intronic
998660761 5:144234695-144234717 TTAAATAAAATGGCATCTATGGG + Intronic
999665338 5:153906877-153906899 GCAAGTCACTTGGCATCTCTGGG + Intergenic
1000815058 5:165910683-165910705 GAAAATAAGTTGGCATATTTGGG - Intergenic
1001082094 5:168674974-168674996 GTAAATCACTTAACCTCTCTGGG - Intronic
1001203354 5:169739210-169739232 AATAATAACTTGGCATTTCTTGG + Intronic
1001220556 5:169896434-169896456 GTAAATTACTTAACCTCTCTGGG + Intronic
1003412503 6:5877898-5877920 GCAAATAACTTGGCTAGTCTTGG - Intergenic
1006814659 6:36841789-36841811 GTAAGTTACTTAGCCTCTCTGGG - Intergenic
1007449205 6:41930434-41930456 GTAAATGACTTGGCATCCTTGGG + Intronic
1007507140 6:42344420-42344442 GTAAATAACTCATCTTCTCTGGG - Intronic
1008368939 6:50712164-50712186 GAAAATAACTAATCATCTCTGGG - Intergenic
1008917723 6:56807607-56807629 TGAATTAACTTGGCACCTCTGGG - Intronic
1009307545 6:62109156-62109178 GTAAACAACTTTGCATTTCTAGG - Intronic
1009786403 6:68345466-68345488 GTAAAAAACTTACCATCTCGTGG - Intergenic
1011513403 6:88126252-88126274 GTTAATCATTTGGCATCCCTTGG - Intergenic
1012382109 6:98632328-98632350 GTAAAGCACTTGGCCTTTCTTGG + Intergenic
1013093805 6:106925592-106925614 GAAAATAAATTGGATTCTCTTGG + Intergenic
1014308318 6:119769130-119769152 GTAAATAACAAGGTAACTCTAGG - Intergenic
1014658909 6:124142001-124142023 GCAACTAACATGGCATCTATGGG - Intronic
1014697650 6:124643666-124643688 GTAACTAACTTGATAACTCTAGG + Intronic
1015638357 6:135303528-135303550 GTAAACCACTTAGCCTCTCTTGG + Intronic
1016093739 6:140010876-140010898 GTAAATAAGTTAACATCTTTGGG - Intergenic
1016738345 6:147505034-147505056 GTAAGGAACTTGACCTCTCTGGG + Intergenic
1016751738 6:147637541-147637563 GTAAATACCTTGGCACATCTGGG - Intronic
1017600294 6:156073085-156073107 GTAAATCACTTTTCTTCTCTGGG + Intergenic
1017948114 6:159113111-159113133 GTAAGTCAATTGGCCTCTCTGGG - Intergenic
1019550444 7:1599669-1599691 GGAAGTCACTTGGCCTCTCTGGG + Intergenic
1021369293 7:19821378-19821400 GGAAACATCTTTGCATCTCTGGG + Intergenic
1021603439 7:22387384-22387406 GTAATTAACTTGAGATCTATGGG + Intergenic
1023335171 7:39161552-39161574 GCAAATCACTTGACCTCTCTGGG - Intronic
1024167770 7:46751652-46751674 GTAACTTACTTGACATTTCTGGG - Intronic
1025251359 7:57353493-57353515 GCAAATTACCTGGCCTCTCTGGG + Intergenic
1025984686 7:66439008-66439030 GTAAGTAATTTAACATCTCTTGG + Intergenic
1026030031 7:66783947-66783969 GTAAGTAATTTAACATCTCTTGG - Intronic
1026680976 7:72466410-72466432 GTAAATACCTTATGATCTCTTGG - Intergenic
1027207891 7:76117596-76117618 GTAAGTAATTTAACATCTCTTGG + Intergenic
1030137890 7:106275411-106275433 GTAAAGAATGTGGCATCTTTAGG + Intronic
1030410396 7:109170794-109170816 GTAAATAAATGGGCATAACTGGG - Intergenic
1030659272 7:112203127-112203149 GTAAATCACTTAGCCTTTCTGGG - Intronic
1032260613 7:130333422-130333444 GTAAAGAGCTTGGAAACTCTTGG + Intergenic
1034752804 7:153586735-153586757 GTAAATTACTTAACCTCTCTGGG + Intergenic
1034994161 7:155567649-155567671 GTAAACAACTCGGCATGTCTGGG - Intergenic
1035944392 8:3944596-3944618 GTGAATATGTTGGCATATCTGGG - Intronic
1036693251 8:10958063-10958085 GTAAGTCACTTGCCCTCTCTGGG + Intronic
1039331154 8:36538532-36538554 GTAAATGACTTTGCATCCTTGGG - Intergenic
1040622049 8:49102062-49102084 GTGAATAAGTTGGCATTCCTTGG + Intergenic
1040635056 8:49263563-49263585 GTAAAGCAGTTGGCCTCTCTTGG + Intergenic
1042008953 8:64217414-64217436 TTAAACAACTTTGCATTTCTGGG - Intergenic
1042455367 8:68995769-68995791 GAAAAGAATATGGCATCTCTGGG - Intergenic
1043109374 8:76159484-76159506 GTTAATGTCTTAGCATCTCTAGG - Intergenic
1044181152 8:89196803-89196825 GTAAATAACTAGGCATATAATGG - Intergenic
1044747068 8:95380969-95380991 GTAAATCACTTTGCTTCTCTGGG + Intergenic
1046477836 8:114771365-114771387 GAAAATAAATTGCCTTCTCTTGG - Intergenic
1046717625 8:117584989-117585011 ATAAATAACATTGCATCTTTGGG + Intergenic
1047929380 8:129711709-129711731 GCAAGTTACTTGACATCTCTAGG + Intergenic
1048400578 8:134065056-134065078 GTAAATAAATATGCATCTCCTGG + Intergenic
1050919038 9:11175874-11175896 ATAAATAACCTGCTATCTCTGGG + Intergenic
1051184783 9:14448761-14448783 GTAAAGAACTTGTCATCCCATGG + Intergenic
1055336994 9:75242587-75242609 GCAAATAATTTAGCTTCTCTGGG - Intergenic
1056058579 9:82857941-82857963 TTAAATAACCTTGCATTTCTGGG - Intergenic
1056196729 9:84236390-84236412 GTAAGTTACTTAGCATCTGTTGG + Intergenic
1056326366 9:85482229-85482251 GCAAATAGCTTGGCATCTTGTGG + Intergenic
1057404395 9:94755813-94755835 GCAAATTACTTTGCCTCTCTGGG + Intronic
1058138364 9:101332597-101332619 GTAAATAATTTGCCATTACTAGG - Intergenic
1059415373 9:114158927-114158949 GCAAGTAACTTGCCCTCTCTGGG + Intronic
1059505147 9:114791870-114791892 CTAGATAAATTGGCAACTCTGGG + Intronic
1060252045 9:121994508-121994530 ACAAATTACTTGACATCTCTGGG - Intronic
1187795835 X:23003384-23003406 GGAAATCACTTGCCTTCTCTAGG + Exonic
1187824976 X:23325724-23325746 GCACAGAACTTGGCATTTCTAGG - Intergenic
1195423676 X:104703770-104703792 GCAAATGACTTAACATCTCTCGG - Intronic
1196025813 X:111040591-111040613 GTAAATCACTTGGCCTCTTGAGG + Intronic
1196119258 X:112030988-112031010 GTAAATAGCTTGACATCACATGG + Intronic
1196253992 X:113494351-113494373 GTAAATATCCTGTCATTTCTAGG + Intergenic
1196654245 X:118200354-118200376 GCAAAGTACTTGACATCTCTAGG + Intergenic
1197145362 X:123166336-123166358 GTAAATCACTTAGTCTCTCTTGG + Intergenic
1197156940 X:123280962-123280984 GTAAGTCACTTAGCATCTCTAGG - Intronic
1198439764 X:136651766-136651788 GTAAATAACTTCACCTTTCTGGG + Intronic