ID: 1073359856

View in Genome Browser
Species Human (GRCh38)
Location 10:102889664-102889686
Sequence CGGGGGGGGTGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14329
Summary {0: 1, 1: 0, 2: 33, 3: 767, 4: 13528}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073359856_1073359875 26 Left 1073359856 10:102889664-102889686 CCTTCCTCCCTCCACCCCCCCCG 0: 1
1: 0
2: 33
3: 767
4: 13528
Right 1073359875 10:102889713-102889735 TCGCCCAGGCTGGAGTGCAGTGG 0: 62339
1: 213994
2: 245652
3: 160170
4: 93749
1073359856_1073359869 -2 Left 1073359856 10:102889664-102889686 CCTTCCTCCCTCCACCCCCCCCG 0: 1
1: 0
2: 33
3: 767
4: 13528
Right 1073359869 10:102889685-102889707 CGCCCCTTTCAGATGGAATCTGG 0: 1
1: 0
2: 0
3: 1
4: 56
1073359856_1073359873 12 Left 1073359856 10:102889664-102889686 CCTTCCTCCCTCCACCCCCCCCG 0: 1
1: 0
2: 33
3: 767
4: 13528
Right 1073359873 10:102889699-102889721 GGAATCTGGCTCTGTCGCCCAGG 0: 39
1: 2060
2: 37422
3: 94105
4: 141177
1073359856_1073359862 -9 Left 1073359856 10:102889664-102889686 CCTTCCTCCCTCCACCCCCCCCG 0: 1
1: 0
2: 33
3: 767
4: 13528
Right 1073359862 10:102889678-102889700 CCCCCCCCGCCCCTTTCAGATGG 0: 1
1: 0
2: 1
3: 24
4: 211
1073359856_1073359874 16 Left 1073359856 10:102889664-102889686 CCTTCCTCCCTCCACCCCCCCCG 0: 1
1: 0
2: 33
3: 767
4: 13528
Right 1073359874 10:102889703-102889725 TCTGGCTCTGTCGCCCAGGCTGG 0: 1687
1: 49225
2: 143194
3: 197819
4: 176370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073359856 Original CRISPR CGGGGGGGGTGGAGGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr