ID: 1073364383

View in Genome Browser
Species Human (GRCh38)
Location 10:102926335-102926357
Sequence AAGTAGGAGCTGGATGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073364375_1073364383 2 Left 1073364375 10:102926310-102926332 CCCTAGTTAAATACCAGCCCTGA 0: 1
1: 0
2: 1
3: 4
4: 86
Right 1073364383 10:102926335-102926357 AAGTAGGAGCTGGATGAAGCGGG No data
1073364376_1073364383 1 Left 1073364376 10:102926311-102926333 CCTAGTTAAATACCAGCCCTGAC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1073364383 10:102926335-102926357 AAGTAGGAGCTGGATGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073364383 Original CRISPR AAGTAGGAGCTGGATGAAGC GGG Intronic
No off target data available for this crispr