ID: 1073364514

View in Genome Browser
Species Human (GRCh38)
Location 10:102927551-102927573
Sequence GGAGTTCCAGACTGACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073364502_1073364514 29 Left 1073364502 10:102927499-102927521 CCTGTAATCCCGGCACTTTGGGA 0: 2597
1: 291113
2: 263247
3: 150751
4: 129523
Right 1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1073364511_1073364514 3 Left 1073364511 10:102927525-102927547 CCAGGGAGGTGGATCACTTGAGG 0: 2
1: 147
2: 1000
3: 2436
4: 3662
Right 1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1073364506_1073364514 20 Left 1073364506 10:102927508-102927530 CCGGCACTTTGGGAGGCCCAGGG 0: 54
1: 6241
2: 214722
3: 263657
4: 170438
Right 1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1073364510_1073364514 4 Left 1073364510 10:102927524-102927546 CCCAGGGAGGTGGATCACTTGAG 0: 52
1: 7220
2: 38930
3: 83269
4: 99941
Right 1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 138
1073364504_1073364514 21 Left 1073364504 10:102927507-102927529 CCCGGCACTTTGGGAGGCCCAGG 0: 56
1: 6573
2: 218218
3: 269934
4: 173798
Right 1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073364514 Original CRISPR GGAGTTCCAGACTGACAGTC TGG Intronic
902146344 1:14403679-14403701 GCAGTTCCAGACTGTGAGTGAGG - Intergenic
907475812 1:54704650-54704672 GGAGTTCGAGACCACCAGTCTGG - Intronic
912919299 1:113850169-113850191 GGAGTTTCACACTGTCACTCAGG - Intronic
913225599 1:116695573-116695595 GGAGACCCAGACTGAAAGTCAGG - Intronic
916572061 1:166036698-166036720 AGAGCTCCAGAGTGCCAGTCAGG + Intergenic
920119387 1:203644449-203644471 TGAGTTCCAGACTGGAAGTTGGG + Intronic
920574777 1:207051262-207051284 GGAGTTCCTGAATGAAGGTCTGG + Intronic
924506175 1:244686496-244686518 GGAGTTTCAGAGTGAAAGACTGG + Intronic
1067148873 10:43713303-43713325 CGAGTTCCAGATTTACAGGCAGG - Intergenic
1068211552 10:53925956-53925978 GGTGTTCAAGACTGACAGGTAGG - Intronic
1069686143 10:70320074-70320096 GGACTTCCAGACTGAGAGCACGG + Intronic
1069779143 10:70943910-70943932 GGAGTTCCAGAGGGGCAGTCTGG - Intergenic
1069944278 10:71975129-71975151 GGAGATTCAGACTGACGGGCAGG + Intronic
1072108292 10:92293754-92293776 GGAGTTCCACTCTGTCACTCAGG - Intronic
1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG + Intronic
1075007243 10:118839882-118839904 GGAGGGCCAGAGTGACGGTCAGG - Intergenic
1077602343 11:3582230-3582252 GGAGCTCCACACTGACACTAAGG - Intergenic
1079327264 11:19504985-19505007 GGAGTTCGAGACTGAAACCCAGG + Intronic
1079576107 11:22004632-22004654 GGAGTTCCAGGCAGAGAGACAGG - Intergenic
1080694327 11:34588193-34588215 GGATTTCCAGTCTGACAGACTGG + Intergenic
1080869553 11:36225512-36225534 GGAGTTCCAGGGTGAAGGTCTGG - Intronic
1082817010 11:57515589-57515611 GGAGCTTCAGCCTGACAGCCCGG + Exonic
1090424436 11:126597246-126597268 GGAGCTGCAGAGTGACAGGCGGG - Intronic
1092106494 12:5925307-5925329 GGAGTTTGAGGCTGACATTCAGG + Intronic
1092288123 12:7141638-7141660 GGAGTTACAGAGAGAGAGTCTGG - Intronic
1092428486 12:8391582-8391604 GGAGCTCCACACTGACACTAAGG - Intergenic
1092429571 12:8397734-8397756 GGAGCTCCACACTGACACTAAGG - Intergenic
1094578168 12:31707413-31707435 GCAGTTGCAGAATGACATTCAGG - Intronic
1101122371 12:101596345-101596367 GGACTCCCTGCCTGACAGTCAGG - Intronic
1104417968 12:128611184-128611206 GGACTTCCTGACTCACAGCCTGG - Intronic
1106885459 13:34179790-34179812 GGAATTTCAGACTGAGACTCAGG + Intergenic
1109728914 13:66384688-66384710 GGAGTTTCACTCTGACACTCAGG + Intronic
1113434174 13:110276661-110276683 GGAGTACCACACTGAAAGTAGGG - Intronic
1113902508 13:113804771-113804793 TTAGTTCCAGCCTGAGAGTCGGG + Intronic
1114736956 14:25051472-25051494 GGAGCCACAGACTGACAGTCAGG - Intergenic
1122231344 14:100307510-100307532 GGAGGTCCAGACTGTCAGGTTGG + Intergenic
1123917851 15:25050394-25050416 TGAGTTCCAGACTGACGTGCTGG + Intergenic
1128233857 15:66053927-66053949 GGAGTTCAAGACCAACAGCCTGG - Intronic
1128721515 15:69954072-69954094 GCAGGTCAAGACTGACAGTGTGG - Intergenic
1129635926 15:77317631-77317653 GGAGTGAAAGACTGAGAGTCAGG - Intronic
1133903829 16:10002535-10002557 GGAGTTCCAGGCTTACTGTGAGG - Intronic
1134689272 16:16180516-16180538 GGAGTTCCACTCTGACACCCAGG + Intronic
1136408856 16:30065113-30065135 CGAGTTCCAGGCTGGCAGGCCGG - Intronic
1140261801 16:73386780-73386802 GGAGTTGCTGAGTGACAATCAGG + Intergenic
1140452505 16:75082086-75082108 GGAGTTCAAGACCGCCAGCCTGG - Intronic
1141072615 16:80971987-80972009 GGAGAACAAGACTGACAGTAGGG - Exonic
1143645134 17:8225064-8225086 GGAGTTCCAGACCAGCAGCCTGG - Intergenic
1144010168 17:11140210-11140232 TAAGTCCCAGGCTGACAGTCTGG + Intergenic
1144529905 17:16027210-16027232 GGAGTTCCAGCCTGTCAGATGGG + Intronic
1148682003 17:49479526-49479548 GGAGTCACGGACTGACAGCCGGG - Intergenic
1151280803 17:73072745-73072767 GGAGTGCCAGGCCAACAGTCAGG + Intronic
1152440905 17:80309048-80309070 GCAGTTTCAGACACACAGTCAGG - Exonic
1156379290 18:36543111-36543133 GGAGTTGAAGACTGTCAGGCTGG - Intronic
1157171777 18:45413535-45413557 AGAGTGCCACACTGAAAGTCAGG - Intronic
1160714530 19:570365-570387 GGAGTTCAGGACTGGCAGCCTGG - Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1162918611 19:13887429-13887451 GGGGATCCAGACAGACAGCCAGG - Intronic
1163137668 19:15324470-15324492 GGAGGTCCTGACTGGGAGTCTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168316528 19:55486955-55486977 GAAGCTACAGACTGACAGCCAGG + Exonic
928407072 2:31022935-31022957 GGAGCTCAGCACTGACAGTCTGG + Intronic
929387546 2:41427683-41427705 GGAGCTTCAGAGTGACAATCTGG - Intergenic
930243636 2:48961332-48961354 TGAGTTCTAGACTGAGGGTCAGG + Intergenic
934152408 2:89159992-89160014 GGAGTCACAGACTGAAAGTCTGG + Intergenic
934214839 2:90021922-90021944 GGAGTCACAGACTGAAAGTCTGG - Intergenic
937123831 2:119460317-119460339 GGAGTTCTAGACAGAGAGCCAGG - Intronic
938869920 2:135464406-135464428 GAAGTTGCAAACTCACAGTCTGG + Intronic
941645337 2:168034210-168034232 GGAGGTGGAGACTGACACTCTGG + Intronic
944398861 2:199302475-199302497 GGAGTTCCTGACTGTCAGTGAGG - Intronic
944788243 2:203095961-203095983 GGAGTTCCAGACCGGCAGCCTGG - Intronic
948260261 2:236599152-236599174 GGAAGTCCAGAATGAGAGTCTGG - Intergenic
948924256 2:241083804-241083826 GGATATCTAGTCTGACAGTCTGG + Intronic
1169563798 20:6830444-6830466 TGATTTCCAGCCTGATAGTCAGG + Intergenic
1172270250 20:33651204-33651226 GGAATTTCAGGCTGCCAGTCCGG + Intergenic
1172973702 20:38891197-38891219 GGATGTCAGGACTGACAGTCAGG + Intronic
1173225957 20:41162602-41162624 GGAGTGCCAGTCAGGCAGTCAGG - Intronic
1179950757 21:44707669-44707691 GGAGTCCCAGAGTGACCGCCTGG + Intronic
1180618441 22:17144136-17144158 GGAGTTCCAGACTTACTGGCTGG - Intronic
1181264432 22:21622555-21622577 GGAGTTTCAAACGGACATTCTGG - Exonic
1182285100 22:29241814-29241836 GGAGTTCCAGAAGGACATACTGG - Intronic
1184632016 22:45789054-45789076 GGAGATGCAGATTGACAGTAAGG + Intronic
1184914949 22:47562992-47563014 GGAGTTCCAGACCACCAGGCTGG - Intergenic
1185205918 22:49538697-49538719 GGAGATCCAGAAAGACAGGCTGG + Intronic
950797336 3:15520847-15520869 GGGGTTCCACAGTGACAGCCAGG - Intronic
951043234 3:18011284-18011306 AGAGTTACAGAGTGACAGTGGGG + Intronic
953166340 3:40468347-40468369 GGAGTTCAAGACTGCCAGGCAGG - Intergenic
957073190 3:75581297-75581319 GGAGCTCCACACTGACACTAAGG - Intergenic
961280893 3:125765483-125765505 GGAGCTCCACACTGACACTAAGG + Intergenic
961501069 3:127336472-127336494 AGAGTTGCAGACAGACAGGCTGG + Intergenic
969250885 4:5968023-5968045 TGAGATCCAGGCTGCCAGTCTGG - Intronic
969737174 4:8999724-8999746 GGAGCTCCACACTGACACTAAGG + Intergenic
969796365 4:9531312-9531334 GGAGCTCCACACTGACACTAAGG + Intergenic
971388128 4:26160348-26160370 GGAGTTTCAGCCTGACACTTGGG - Intergenic
981264215 4:142762176-142762198 GGAGTTGCAGAATGAGAGCCAGG - Intronic
985006333 4:185538253-185538275 GAATATCCAGACTGGCAGTCTGG - Intergenic
987115714 5:14725155-14725177 GGAGTGCCAGCCCGGCAGTCAGG - Intronic
992430703 5:76708656-76708678 GAGGTTCCAGCCTGAGAGTCTGG - Intergenic
994190732 5:96866854-96866876 GGAGTTCCATACTGCCTCTCTGG + Intronic
994654986 5:102581431-102581453 GGAACTCCAGAATGACAGCCAGG - Intergenic
996094397 5:119382808-119382830 GGAGTACAAGACAGGCAGTCAGG - Intronic
996542922 5:124648607-124648629 GGAGTTCGAGCCTGACAGTGAGG - Exonic
998557766 5:143142346-143142368 GGAGTTCGAGACTAGCAGCCTGG - Intronic
999177868 5:149644320-149644342 GGAGTTCCTGAGTGGCAGTTGGG + Intergenic
1000397185 5:160788178-160788200 AGAGTTAGAGACAGACAGTCTGG + Intronic
1002311009 5:178313776-178313798 AGAGCTCCAGACTGAAGGTCTGG - Intronic
1007139230 6:39554720-39554742 GGAGTTCCAGAATGCCTGTAGGG - Intronic
1013194971 6:107837080-107837102 GGAGAACAAGACTGAGAGTCAGG - Intergenic
1013562511 6:111319807-111319829 GGAGTTCCCAACTGAGAGTGAGG - Intronic
1015362995 6:132362471-132362493 TAAGAACCAGACTGACAGTCTGG - Intronic
1027383330 7:77634899-77634921 GGAGTTCCACTCTGTCACTCAGG + Intronic
1029075263 7:97929391-97929413 GGAGCTCCACACTGACACTAAGG - Intergenic
1029312460 7:99679833-99679855 GGAGCACCAGGCTGACAGCCAGG + Exonic
1029318346 7:99735030-99735052 GGAGTATCAGGCTGACAGCCAGG + Exonic
1029323263 7:99784018-99784040 GGAGCACCAGGCTGACAGCCAGG + Exonic
1029621786 7:101694633-101694655 GGAGTTCGAGACTGAGTTTCTGG - Intergenic
1030285022 7:107817128-107817150 GGAGTTCTAGACTAGCAGCCTGG - Intergenic
1030857134 7:114573414-114573436 GGTGTTCCAGACTACCACTCTGG - Intronic
1031121719 7:117729747-117729769 GTACTTCAAGACTGCCAGTCTGG - Intronic
1032246103 7:130214338-130214360 GGAGTTCGAGGCTGCCAGTGAGG + Intronic
1033369124 7:140693304-140693326 GGAGTTCCAGCCTGGCAGATTGG - Intronic
1033961911 7:146924154-146924176 AGAGTGCCAGGCTGACACTCAGG + Intronic
1035210743 7:157326296-157326318 GAAGTTCCAGACTGTGGGTCAGG - Intergenic
1036242261 8:7090987-7091009 GGAGCTCCACACTGACACTAAGG + Intergenic
1036258531 8:7223025-7223047 GGAGCTCCACACTGACACTAAGG - Intergenic
1036259582 8:7229169-7229191 GGAGCTCCACACTGACACTAAGG - Intergenic
1036307037 8:7610355-7610377 GGAGCTCCACACTGACACTAAGG + Intergenic
1036308090 8:7616483-7616505 GGAGCTCCACACTGACACTAAGG + Intergenic
1036310586 8:7681621-7681643 GGAGCTCCACACTGACACTAAGG - Intergenic
1036311625 8:7687739-7687761 GGAGCTCCACACTGACACTAAGG - Intergenic
1036357884 8:8058342-8058364 GGAGCTCCACACTGACACTAAGG + Intergenic
1036358946 8:8064484-8064506 GGAGCTCCACACTGACACTAAGG + Intergenic
1036830475 8:12016143-12016165 GGAGCTCCACACTGACACTAAGG - Intergenic
1036892012 8:12602468-12602490 GGAGCTCCACACTGACACTAAGG - Intergenic
1036893065 8:12608604-12608626 GGAGCTCCACACTGACACTAAGG - Intergenic
1036900625 8:12666590-12666612 GGAGCTCCACACTGACACTAAGG - Intergenic
1040812366 8:51469427-51469449 GGAGTTCCAGAAAGACAGGTAGG - Intronic
1049614192 8:143569117-143569139 GGAGGGACAGACTGACAGACTGG + Intronic
1049658599 8:143809749-143809771 GGAGCTCCCGACTCACAGGCTGG + Intronic
1050705104 9:8387657-8387679 GGAATTGAAGACAGACAGTCTGG - Intronic
1055004735 9:71492764-71492786 AGAATTCCAGAAGGACAGTCAGG + Intergenic
1055653843 9:78434575-78434597 GGAGTTCCTGACTACCAGTGTGG + Intergenic
1186179302 X:6957495-6957517 GAAGTTCAAGACTGAGAGGCTGG - Intergenic
1187844999 X:23525593-23525615 GGAGTTCCAGAGGGGCTGTCTGG - Intergenic
1188217271 X:27493679-27493701 GGAGTTTCAGTCTCCCAGTCTGG - Intergenic
1188710014 X:33384719-33384741 GGAGCACCAGACTGACAGCCAGG - Intergenic
1190247614 X:48700824-48700846 GGAGTTTCAGACACACAGTGAGG - Intronic
1190876228 X:54462134-54462156 GGCCTTCCAGACTGATTGTCTGG - Intronic
1192240659 X:69325085-69325107 GGAGCTCCAGGCTGGCAGGCTGG - Intergenic
1192434560 X:71135103-71135125 GGAGCGCCAGTCAGACAGTCTGG + Exonic
1196983689 X:121243796-121243818 GCAGCTCCAGATTTACAGTCTGG + Intergenic
1200252955 X:154563576-154563598 GGACTTCCAGGCTGAGAGGCAGG + Exonic
1200264812 X:154640839-154640861 GGACTTCCAGGCTGAGAGGCAGG - Intergenic