ID: 1073371462 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:102993640-102993662 |
| Sequence | AAAGCCATACAGGATTCCAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073371462_1073371467 | 27 | Left | 1073371462 | 10:102993640-102993662 | CCTGTGGAATCCTGTATGGCTTT | No data | ||
| Right | 1073371467 | 10:102993690-102993712 | TTTCTTGACTTAAAGGTTTCAGG | No data | ||||
| 1073371462_1073371466 | 20 | Left | 1073371462 | 10:102993640-102993662 | CCTGTGGAATCCTGTATGGCTTT | No data | ||
| Right | 1073371466 | 10:102993683-102993705 | TTGTTAATTTCTTGACTTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073371462 | Original CRISPR | AAAGCCATACAGGATTCCAC AGG (reversed) | Intronic | ||