ID: 1073371462

View in Genome Browser
Species Human (GRCh38)
Location 10:102993640-102993662
Sequence AAAGCCATACAGGATTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073371462_1073371467 27 Left 1073371462 10:102993640-102993662 CCTGTGGAATCCTGTATGGCTTT No data
Right 1073371467 10:102993690-102993712 TTTCTTGACTTAAAGGTTTCAGG No data
1073371462_1073371466 20 Left 1073371462 10:102993640-102993662 CCTGTGGAATCCTGTATGGCTTT No data
Right 1073371466 10:102993683-102993705 TTGTTAATTTCTTGACTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073371462 Original CRISPR AAAGCCATACAGGATTCCAC AGG (reversed) Intronic