ID: 1073372962

View in Genome Browser
Species Human (GRCh38)
Location 10:103007189-103007211
Sequence GACCTACTCCCTGTTCGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073372962_1073372964 1 Left 1073372962 10:103007189-103007211 CCTGTACGAACAGGGAGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1073372964 10:103007213-103007235 CAAAGATCACATGCTTCAAAGGG 0: 262
1: 248
2: 523
3: 336
4: 330
1073372962_1073372963 0 Left 1073372962 10:103007189-103007211 CCTGTACGAACAGGGAGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1073372963 10:103007212-103007234 ACAAAGATCACATGCTTCAAAGG 0: 262
1: 328
2: 421
3: 253
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073372962 Original CRISPR GACCTACTCCCTGTTCGTAC AGG (reversed) Intronic
902758767 1:18567121-18567143 GACATCCTTCCTGTTCTTACCGG - Intergenic
1067807700 10:49404577-49404599 GACCTACTCCCTGTTGCTGGAGG - Intergenic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1077456272 11:2683031-2683053 GACCTTCTCCCACTTCTTACAGG + Intronic
1080008864 11:27437542-27437564 GATCTAGTCCCTGTTCTTGCAGG - Intronic
1083069889 11:59967060-59967082 TACCTACTCCATGTTCCTAAAGG - Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1092651928 12:10644169-10644191 CACCTTCTCCCTGTTCCTACTGG - Intronic
1092720957 12:11440043-11440065 GACCTGCTCTCTGTTTGTGCAGG - Intronic
1107256106 13:38428406-38428428 GTCCTAATCCCTTTTCTTACAGG + Intergenic
1121695487 14:95908862-95908884 CCCCTACTCCCTGTTAGTCCTGG + Intergenic
1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG + Intergenic
1127614418 15:60669585-60669607 AACCTGCTCTCTGTTCTTACTGG + Intronic
1138315182 16:56063832-56063854 CACAAACTCCCTGTTCGTCCAGG - Intergenic
1139431736 16:66914359-66914381 GACCTACCAGCTGTTGGTACAGG - Exonic
1140558383 16:75947733-75947755 GACTTAGTCCCTGTTCCTCCAGG - Intergenic
1142932606 17:3299599-3299621 GTCCTACTCCCTGTTCAAACAGG + Intergenic
1144520237 17:15948131-15948153 GACCTACCCCCAGTTCCTCCCGG + Intronic
1151443224 17:74147231-74147253 GACCCACTCCGTGTTATTACAGG - Intergenic
1153607789 18:6852687-6852709 GACCTAATCCTTATTCTTACAGG + Intronic
1153752450 18:8246886-8246908 GACCAAATCCCTGTGCATACTGG - Intronic
1166940864 19:46364705-46364727 GACCTACTTCCTATTTGTCCTGG - Intronic
933863283 2:86491777-86491799 GACCTACTCACAGTGAGTACAGG - Intronic
943479427 2:188399433-188399455 GACCTACTCTCTCCTAGTACAGG - Intronic
944312938 2:198254971-198254993 GACATACATCCTGTTCGTGCAGG + Intronic
1180260239 21:46663420-46663442 GACCCAGTCCCTGTCCATACAGG + Exonic
1185414265 22:50701150-50701172 GACATAGTCCCTGTGCGTGCAGG + Intergenic
949519568 3:4837489-4837511 GACATACTCCCTGATCTCACAGG + Intronic
950367652 3:12499367-12499389 GACCTAGTCCCTGTTCTTGAAGG + Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
957149146 3:76462978-76463000 GACCTACACACTGTTCAGACTGG - Intronic
982925961 4:161337355-161337377 GACCTACTTCCTGTTTGTCCTGG - Intergenic
988284512 5:29194027-29194049 CAGCAACTCCCTGTTCATACTGG - Intergenic
998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG + Exonic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1007407180 6:41641845-41641867 CCCCTACTCCCTGTTGGTCCAGG + Intronic
1007413057 6:41675899-41675921 GCCCTAATCCCTCTTCCTACAGG + Intergenic
1007624731 6:43238299-43238321 GAACTAGTGCCTGTTCCTACTGG + Intergenic
1010370544 6:75101988-75102010 GACCAACTCACTGTTCGGCCTGG + Exonic
1013301746 6:108810454-108810476 GATCTTCTCCCTGGTCTTACTGG - Intergenic
1016473674 6:144402670-144402692 GACTTCCTCCCTCTTCATACTGG - Intronic
1041609549 8:59828771-59828793 GACCTGCTCCCTGTTAAAACTGG - Intergenic
1062082109 9:134629685-134629707 GACCTGCTCCCTGTCTGGACTGG + Intergenic