ID: 1073372963

View in Genome Browser
Species Human (GRCh38)
Location 10:103007212-103007234
Sequence ACAAAGATCACATGCTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1582
Summary {0: 262, 1: 328, 2: 421, 3: 253, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073372962_1073372963 0 Left 1073372962 10:103007189-103007211 CCTGTACGAACAGGGAGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1073372963 10:103007212-103007234 ACAAAGATCACATGCTTCAAAGG 0: 262
1: 328
2: 421
3: 253
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073372963 Original CRISPR ACAAAGATCACATGCTTCAA AGG Intronic
900936106 1:5767105-5767127 ACAGGGATCACATGCTTCAAGGG + Intergenic
902905061 1:19550354-19550376 ACAAGGATCACATGCTTCAAAGG + Intergenic
902996890 1:20232594-20232616 ACAAGGATCACATGCTTCAAAGG + Intergenic
903421870 1:23223618-23223640 ACAAAGATCACATGCTTCAAAGG + Intergenic
903421872 1:23223652-23223674 ACAAAGATCACATGCTTCTGAGG + Intergenic
903519710 1:23937487-23937509 ACAAAGATCACATGCTTCAAAGG + Intergenic
903519715 1:23937540-23937562 ACAAAGATCACGTGCTTCTGAGG + Intergenic
903752600 1:25636079-25636101 ACAAAGATCACATGCTTCAAAGG + Intronic
903752604 1:25636114-25636136 ACAAAGATCACATGCTTCTGAGG + Intronic
904714769 1:32459224-32459246 ACAAAGATCCCATGCTTCAAAGG - Intergenic
904893510 1:33797128-33797150 ACAAAGATCACATGCTTCTGAGG - Intronic
904893513 1:33797163-33797185 CACAAGATCACATGCTTCAAAGG - Intronic
906577171 1:46901506-46901528 ACAAAGATCACATGCTTCAAAGG - Intergenic
906577947 1:46907818-46907840 ACAAAGATCACATGCTTCAAAGG - Intergenic
906840555 1:49134178-49134200 ACAGAGATCACACATTTCAAGGG + Intronic
907600378 1:55762743-55762765 ACAAAGATCAAAAGAGTCAAAGG + Intergenic
907699604 1:56772132-56772154 CCATAGAGCTCATGCTTCAATGG + Intronic
907988784 1:59558527-59558549 CACAAGATCACATGCTTCAAAGG + Intronic
907988786 1:59558561-59558583 ACAGAGATCACATACTTCTGAGG + Intronic
908761267 1:67514090-67514112 ACAAAGATCACATGCTTCTGAGG - Intergenic
909082818 1:71134381-71134403 ACAAAGATCACATGCTTCTGAGG + Intergenic
909262541 1:73511184-73511206 ACAACCAACACATCCTTCAATGG + Intergenic
909352497 1:74671322-74671344 ACAAAGATCAAATGCTTCTGAGG - Intronic
909352499 1:74671357-74671379 ACAAAGATCATATGCTTCAAAGG - Intronic
909578517 1:77204486-77204508 ACAGAGATCACATGCTTCAAGGG - Intronic
909749296 1:79138538-79138560 ACAGAGATCACATGCTTCAAGGG - Intergenic
909824545 1:80110857-80110879 CATAATATCACATGCTTCAAAGG + Intergenic
909824548 1:80110892-80110914 ACAAAGATCACATGCTTCTGAGG + Intergenic
910073768 1:83251585-83251607 ACAAAGATTACATGCTTTAAAGG + Intergenic
910162395 1:84287844-84287866 ACAGAGATCACATGCTTCAAGGG - Intergenic
910287976 1:85576115-85576137 ACCAAGATGACCTGCTTCAATGG + Intronic
910378684 1:86601594-86601616 ACAAAGGACAAATGCTTCAGGGG - Intergenic
910605617 1:89080485-89080507 ACAGAGATCACATGCTTCAAGGG - Intergenic
910638803 1:89438696-89438718 ACAAAGATCACATGCTTTTGAGG - Intergenic
910638806 1:89438731-89438753 ACAAAGATCACGTGCTTCAAAGG - Intergenic
910957617 1:92724118-92724140 ACAAGGATCACATGCTTTAAAGG - Intronic
911030197 1:93479250-93479272 ACAAAGATCACATGCTTCAAAGG + Intronic
911030199 1:93479284-93479306 ACAAAGATCACATGCTTCTGAGG + Intronic
911071234 1:93833257-93833279 ACAGAGATCACATGCTTCCAAGG + Intronic
911249349 1:95557508-95557530 ACAAAGATCACATGCTTCTGAGG - Intergenic
911249351 1:95557543-95557565 ACAAAGATCACATGCTTCAAAGG - Intergenic
911487938 1:98525916-98525938 ACAAAGATCACATGCTTCAAAGG + Intergenic
911591992 1:99759108-99759130 ACAAAGATCACATGCTTCTGAGG - Intronic
911591996 1:99759161-99759183 ACAAAGATCACACGCTTCAAAGG - Intronic
911638655 1:100264550-100264572 ACAAAGATCACATGCTTCTGAGG - Intergenic
911688421 1:100803550-100803572 ACAAAGATCACATGCTTCTGAGG - Intergenic
911688424 1:100803585-100803607 ATAAAGATCACATGTGTCAAAGG - Intergenic
911826880 1:102498208-102498230 ACAAAGATCACATGCTTGAAAGG - Intergenic
911831345 1:102554364-102554386 ACAAAGATCACATGCTTTAAAGG - Intergenic
912038410 1:105351926-105351948 ACAAAGATCACATGGTTCTGAGG - Intergenic
912038415 1:105351979-105352001 ACAAAGATCACATGCTTCAAAGG - Intergenic
912112332 1:106358439-106358461 ACAAAGATCACGTGCTTTAAAGG + Intergenic
912297697 1:108486387-108486409 ACAGGGATCACATGCTTCAGAGG - Intergenic
912439085 1:109684905-109684927 ACAAAGATCACATGCTTCTGAGG - Intronic
912439087 1:109684940-109684962 ACGAAGATCACATGCTTTAAAGG - Intronic
912441608 1:109703358-109703380 ACAAAGATCACATGCTTCTGAGG - Intronic
912441610 1:109703393-109703415 ACGAAGATCACATGCTTTAAAGG - Intronic
912442394 1:109709361-109709383 ACAGAGATCACATGCTTCTGAGG - Intronic
912442396 1:109709396-109709418 ACAAAGATCACATGCTTTAAGGG - Intronic
912688766 1:111787816-111787838 ACAAAGTTCACAGGGTTCATGGG - Intronic
913355973 1:117922703-117922725 ACAGAGATCACATGCTTCAAGGG + Intronic
913996705 1:143656638-143656660 ACAAAGATCACATGCTTCTGAGG + Intergenic
914212780 1:145596075-145596097 AAAAAACTTACATGCTTCAAAGG - Intergenic
914214917 1:145616901-145616923 ACAGAGATCACATGCTGCAAAGG + Intronic
914466861 1:147937295-147937317 ACAGAGATCACATGCTGGAAAGG + Intronic
914505549 1:148286163-148286185 ACAAAGATCACATGCTTCTGAGG - Intergenic
914507013 1:148297988-148298010 ACAAAGATCACATGCTTCTGAGG + Intergenic
915097321 1:153472503-153472525 ACAAAGATCACAGGCTTCTGAGG - Intergenic
915097325 1:153472538-153472560 CACAAGATCACATACTTCAAAGG - Intergenic
915403601 1:155642413-155642435 ACAAAGATCACATGCTTCAAAGG + Intergenic
915403605 1:155642455-155642477 ACAAAGATCACATGCTTCTGAGG + Intergenic
915410461 1:155697599-155697621 ACAGAGGTCACATGCTTCAGAGG + Intronic
915725336 1:158013364-158013386 ACAAACATGGCATGCTTCTAGGG - Intronic
915817198 1:158980785-158980807 ACAAAGATCACATACTTCTGAGG - Intergenic
915817202 1:158980838-158980860 ACAAAGATAACATGCTTTAAAGG - Intergenic
916122076 1:161537520-161537542 ACAAAGATCACATGCTTCAAAGG - Intergenic
916131965 1:161618945-161618967 ACAAAGATCACATGCTTCAAAGG - Intronic
917078870 1:171236334-171236356 ACAAAGATCACATGATTCAAAGG + Intergenic
917078874 1:171236387-171236409 ACAAAGATCACATGCTTCTGAGG + Intergenic
917209867 1:172620543-172620565 ACAGAGATCACATGCTTCAAAGG + Intergenic
917278132 1:173352576-173352598 ACAGAGATCACATGCTTCAAGGG + Intergenic
917373453 1:174321345-174321367 ACAGAGATCACATGCTTCAAGGG - Intronic
917381153 1:174409993-174410015 ACAAAGATCACATGCTTCTGAGG - Intronic
917381156 1:174410028-174410050 ACAAAGATCACATGCTTCAAAGG - Intronic
917588404 1:176452094-176452116 ACAAAGATCACATGCTTCTGAGG - Intergenic
917765219 1:178208676-178208698 ACAAAGATCACATGCTTCTGAGG - Intronic
918086109 1:181246777-181246799 ACAAAGATCACATGCTTCTGAGG - Intergenic
918086113 1:181246830-181246852 ACAAAGATCACACACTTCAAAGG - Intergenic
918087088 1:181254985-181255007 ACAAAGATCACATGCTTCAAAGG - Intergenic
918175967 1:182045469-182045491 ACAAAGATCACATACTTCAAAGG + Intergenic
918175969 1:182045504-182045526 ACAAAGATCACATGCTTTTGAGG + Intergenic
918453202 1:184680773-184680795 ACAAAGATCACATGTTTCTGAGG + Intergenic
918453206 1:184680826-184680848 ACAAAGATCACATGCTTCTGAGG + Intergenic
918461780 1:184784170-184784192 ACAGAGATCACATGCTTCAAAGG - Intergenic
918536300 1:185578699-185578721 ACAAAGATCACATGCTTCTGAGG - Intergenic
918536303 1:185578734-185578756 CACAAGATCACATGCTTCAAAGG - Intergenic
918848015 1:189644179-189644201 ACAAAGATCAGACGCTTCTAAGG + Intergenic
918872329 1:189991581-189991603 AAAAAGATCACATGGTTTATTGG + Intergenic
918941433 1:191003692-191003714 ACAAAGATAAAATGCTTGAGGGG - Intergenic
918977843 1:191513552-191513574 ACAAAGATCACATGCTTTTGAGG - Intergenic
918977845 1:191513586-191513608 ACAGAGATCACATGCTTCAAAGG - Intergenic
918999606 1:191813553-191813575 AAAAAGATCACATGCTTGAAAGG + Intergenic
919025621 1:192165419-192165441 ACAGAGATCACATGCTTCAAAGG - Intronic
919035833 1:192308176-192308198 ACAAAGATCACATGCTTCAAAGG + Intergenic
919035836 1:192308211-192308233 ACAAAGATCACATGCTTCTGAGG + Intergenic
919110048 1:193207246-193207268 ACAAAGATCACATGCTTCAAAGG + Intronic
919426482 1:197438587-197438609 ACAAATCTCACTTGCTACAATGG + Exonic
919538108 1:198813753-198813775 ACAAAGACCACATGCTTCAAAGG + Intergenic
920879581 1:209867368-209867390 ACAAAGATCACATGCTTCTGAGG - Intergenic
920879584 1:209867403-209867425 ACAAAGATCACATGCTTCAAAGG - Intergenic
920908980 1:210196295-210196317 ACAAAGATCACATGCTTCAAAGG + Intergenic
920908981 1:210196329-210196351 ACAAAGATCACATGCTTCTGAGG + Intergenic
921788135 1:219257624-219257646 ACAAAGATCACATGCTTCTGAGG + Intergenic
921900484 1:220444911-220444933 ACAAAGATCACATGCTTCTGAGG - Intergenic
921900488 1:220444964-220444986 ACAAAGATCACATGCTTCAAAGG - Intergenic
922771527 1:228186586-228186608 AAAAGGATCACAGGCTTAAATGG - Intergenic
922967941 1:229707526-229707548 ACAGAGATCACATGCTTCAAAGG - Intergenic
923242579 1:232099812-232099834 ACAAAGATTACATGCTTCAAAGG + Intergenic
923242582 1:232099848-232099870 ACAAAGTTCACATGCTTCTGAGG + Intergenic
923431889 1:233930505-233930527 TCAAAGTTCACAAACTTCAATGG - Intronic
924053061 1:240096644-240096666 ATAATGATCACCTGCTTCAAAGG - Intronic
924296945 1:242597279-242597301 ACAAAGATCACATGCTTCTGAGG - Intergenic
924296948 1:242597315-242597337 ACAAAGATCACATGCTTCAAGGG - Intergenic
924598573 1:245468006-245468028 TCAAAGAGCAAATGCTTCAGGGG - Intronic
924728934 1:246694640-246694662 ACAAAGATCACATGCTTCTGAGG - Intergenic
924728936 1:246694675-246694697 ACAAAGATCACATGCTTCAAAGG - Intergenic
1063329080 10:5137899-5137921 ACAAAGATCACATGCTTCAAAGG + Intergenic
1063329084 10:5137952-5137974 AGAAAGATCACATGCTTCTGAGG + Intergenic
1063791543 10:9454291-9454313 ACAAAGATCACATGCTCCAAAGG - Intergenic
1064490492 10:15850777-15850799 GCTGAGATCACATGCTTTAAGGG - Intronic
1064522959 10:16222793-16222815 ACAAAGATCACATGCTTCAAAGG + Intergenic
1064626147 10:17263519-17263541 CACAAGATCACATGCTTCAAAGG + Intergenic
1064626150 10:17263554-17263576 ACAAAGATCACATGCTTCTGAGG + Intergenic
1064779025 10:18812772-18812794 ACAAAGATCACATGCTTCAAAGG + Intergenic
1064779027 10:18812807-18812829 ACAAAGATTACATGCTTCTGAGG + Intergenic
1065002737 10:21351918-21351940 GAGTAGATCACATGCTTCAAAGG - Intergenic
1065196752 10:23274130-23274152 ACAGAGATCACACGCTTCAAAGG + Intronic
1065475936 10:26138053-26138075 ATGAAGATCACATGCTTCTGAGG - Intronic
1065497918 10:26349211-26349233 ACAAAGATCACATGCTTCTGAGG - Intergenic
1065497920 10:26349246-26349268 ACAAAGATCACTTGCTTCAAAGG - Intergenic
1065499691 10:26367393-26367415 ACAAAGATCACATGCTTCAAAGG - Intergenic
1065512443 10:26492729-26492751 ACAGAGATCACATGCTTCAAGGG + Intronic
1065738933 10:28779238-28779260 ACTAAGAGCAAATGTTTCAAAGG - Intergenic
1066113566 10:32219612-32219634 ACAAAGATCACATGCCTCAAAGG - Intergenic
1066257098 10:33690611-33690633 ACAAAGATCACATGCTTCTGAGG - Intergenic
1066257101 10:33690646-33690668 ACAAAGATCACATGCTTCAAAGG - Intergenic
1066331426 10:34427608-34427630 ACAGAGATCACATGCTTTAAGGG - Intronic
1066621310 10:37354321-37354343 ACAGAGATCACATGTTTGAAAGG - Intronic
1066642280 10:37566687-37566709 ACAGAGATCACATGCTTCAAGGG - Intergenic
1066651125 10:37656061-37656083 ACAAAGATCACATGCTTCTGAGG + Intergenic
1066651130 10:37656114-37656136 ACAAAGATCACATGCTTCTGAGG + Intergenic
1066686067 10:37982727-37982749 ACAAAGATCACATGCTTCTAAGG + Intergenic
1066789022 10:39043016-39043038 ACAAAGATCACATGCTTCTGAGG - Intergenic
1067013957 10:42741426-42741448 ACAAAGATCACATGCTTCAAAGG + Intergenic
1067013961 10:42741478-42741500 ACAAAGATCACATGCTTTTGAGG + Intergenic
1067128233 10:43538664-43538686 ATAAAGATCACATGCTTTTGAGG - Intergenic
1067128235 10:43538699-43538721 ACAAAGATCACATGCTTCAAAGG - Intergenic
1067561714 10:47309176-47309198 ACAAAGAGCAGATGCCTAAATGG + Intronic
1067841783 10:49686861-49686883 ACAAGGACCACATGCTTCAAAGG - Intronic
1068071778 10:52205244-52205266 ACAGAGGTCATATGCTTCAAGGG - Intronic
1068097131 10:52505283-52505305 ACAAGGATCACATGCTTCAAAGG + Intergenic
1068152776 10:53155613-53155635 ACAAAGATCACATGCTTCAAAGG + Intergenic
1068423332 10:56823426-56823448 ACAAAGATCACATGCTTCTGAGG - Intergenic
1068423335 10:56823461-56823483 ACAAAGATCACATGCTTCAAGGG - Intergenic
1068537522 10:58256576-58256598 ACAAAGATCACATGCTTCAAGGG - Intronic
1068542449 10:58310517-58310539 ACAAAGAATAAATGCTTCAGGGG + Intergenic
1068568053 10:58597362-58597384 ACACAGATCACATGCTTCTGAGG + Intronic
1069094423 10:64241399-64241421 ACAAAGATCACATGCTTCTGAGG - Intergenic
1069094426 10:64241434-64241456 ACAAAGATCACATGCTTCAAAGG - Intergenic
1069104018 10:64360575-64360597 ACAAAGATCACATGCTTCAGAGG - Intergenic
1069198448 10:65583265-65583287 ACAAAGATCACATGCTTCTGAGG - Intergenic
1069198452 10:65583300-65583322 ACAAAGATCACATGCCTCAAAGG - Intergenic
1069203912 10:65658206-65658228 ACAAAGATCACATGCTTCTGAGG - Intergenic
1069297947 10:66870557-66870579 ACAAATTTCATATTCTTCAATGG + Intronic
1069570004 10:69488741-69488763 ACAAAGATCACATGCTTCAAAGG + Intronic
1069570007 10:69488776-69488798 ACAAAGATCACATGCTTCTAAGG + Intronic
1070025355 10:72626665-72626687 ACAAAAAACACATTCTTCAAGGG - Intergenic
1070088404 10:73259023-73259045 ACAGAGATCACATGCTTCAAGGG - Intronic
1070463302 10:76691408-76691430 ACAAAGATCACATGCTTCTGAGG + Intergenic
1070482425 10:76895906-76895928 ACAGAGATCACATGCTTCAAGGG + Intronic
1070694334 10:78550979-78551001 ACAAGGATCACATGCCTGAGAGG - Intergenic
1070854912 10:79599968-79599990 ACAGAGATCACATGCTTCAAGGG - Intergenic
1071189380 10:83082100-83082122 ACAGAGATCACATGCTTCAAGGG - Intergenic
1071412516 10:85410872-85410894 ACAAAGATCACATGCTTCTGAGG - Intergenic
1071599707 10:86952655-86952677 GCAAAGATCATATGCTTCTGAGG + Intronic
1071855535 10:89620678-89620700 ACAAAGATCACATGCTTGAAAGG - Intronic
1072323300 10:94271979-94272001 GCAAGGATCACATGCTTCTGAGG + Intronic
1073003251 10:100301157-100301179 ACAGAGATCACATGCTTCAAGGG + Intronic
1073353890 10:102838332-102838354 ACAAAGATCACATGCTTCAAAGG + Intergenic
1073353892 10:102838385-102838407 ACAAAGATCACATGCTTCTGAGG + Intergenic
1073354670 10:102844290-102844312 ACAAAGATCACATGCTTCAAAGG + Intergenic
1073354674 10:102844343-102844365 ACAAAGATCACATGCTTCTCAGG + Intergenic
1073372963 10:103007212-103007234 ACAAAGATCACATGCTTCAAAGG + Intronic
1073372965 10:103007247-103007269 ACAAAGATCACATGATTTTGAGG + Intronic
1073466140 10:103695543-103695565 ACAAAACTCACATGCTTGGAGGG + Intronic
1074211731 10:111341386-111341408 ACAAAGTCCACATGCTTCAAAGG + Intergenic
1074271394 10:111957285-111957307 ACGGAGATCACATGCTTCAAGGG - Intergenic
1074464860 10:113671962-113671984 GCAAAAATCACATGCTTCTGAGG + Intergenic
1074845445 10:117393348-117393370 ACAAAGATCACAATCATCAATGG + Intergenic
1075923273 10:126230792-126230814 ACAAGGAGCACATGATACAATGG - Intronic
1076085729 10:127629193-127629215 ACAAAGATCACATGCTTCAAAGG + Intergenic
1076085734 10:127629246-127629268 ACAAAGATCACATGCTTCTGAGG + Intergenic
1076181822 10:128415316-128415338 ACAAAGATAACATGCATAGAGGG - Intergenic
1076392979 10:130117547-130117569 ACAAGGATCACATGCTTCAAAGG + Intergenic
1076478460 10:130768456-130768478 ACAGAGATCACATGCTCCAAGGG + Intergenic
1077594518 11:3520258-3520280 AGAAAGATCACATGCTTCTGAGG - Intergenic
1077594522 11:3520311-3520333 ACAAAGATCACATGCTTCAAAGG - Intergenic
1077851344 11:6076877-6076899 ACAGAGATCACATGCTTCAAGGG - Intergenic
1078231994 11:9451966-9451988 ACAAAGGTCACATGTTTCAAAGG + Intergenic
1078385159 11:10884293-10884315 ACAAGGATCACATGCTTCAAAGG + Intergenic
1078804523 11:14684406-14684428 CACAAGATCACATGCTTCAAAGG + Intronic
1078804526 11:14684441-14684463 ACAAAGATCACATGCTTCTGAGG + Intronic
1079443575 11:20539198-20539220 ACAAGGATCGCATGCTTCAAAGG - Intergenic
1079666884 11:23117034-23117056 ACAAAGATCACATGCTTCAAAGG + Intergenic
1079783336 11:24637865-24637887 ACAGGGATCACATGCTTCAAAGG - Intronic
1079975818 11:27090428-27090450 ACAAAGATCACATGCTTCAAAGG + Intronic
1079975822 11:27090481-27090503 ACAAAGATCACATGCTTCTGAGG + Intronic
1079979631 11:27136207-27136229 ACAGGGATCACATGCTTCAGAGG - Intergenic
1080155462 11:29105790-29105812 ACAAAGATCACATGCTTCTGAGG - Intergenic
1080155467 11:29105825-29105847 ACAAAGATCACATGCTTCAAAGG - Intergenic
1080972920 11:37300937-37300959 ACAAAGATCACATGCTTCAAAGG + Intergenic
1080972925 11:37300990-37301012 ACAAAGATCACATGCTTCTGAGG + Intergenic
1081140600 11:39494148-39494170 ACAAAGATCACATGCTTCTGAGG - Intergenic
1081236113 11:40648998-40649020 ACAAAGATCACAGGCTTCAAAGG + Intronic
1081236116 11:40649033-40649055 ACAAAGATCACATGTTTCTGAGG + Intronic
1081328391 11:41774245-41774267 ACAAAGATCACATGCTTCAAAGG + Intergenic
1081498412 11:43639645-43639667 ACAAAAGTCACATCCTTCAGGGG + Intronic
1082062915 11:47875744-47875766 CACAAGATCACATGCTTCAAAGG + Intergenic
1082062917 11:47875776-47875798 ACAAAGATCACATGCTTCTGAGG + Intergenic
1082115924 11:48328113-48328135 ACAGAGATCACATGCTTCAAAGG + Intronic
1082143294 11:48634761-48634783 ACAAAGATCACATGCCTTAAAGG + Intergenic
1082257769 11:50051379-50051401 ACAGAGATCACATGCTTCAAAGG - Intergenic
1082282171 11:50281692-50281714 ACAAAGTTCACATGCTTCTGAGG - Intergenic
1082282173 11:50281727-50281749 ACAAAGATCACATGCTTCAAAGG - Intergenic
1082292878 11:50400653-50400675 ACAAAGATGACATGCTTCAGAGG - Intergenic
1082292881 11:50400688-50400710 ACAAAGATCACATGTTTCAAAGG - Intergenic
1082570486 11:54732126-54732148 ACAAAGATCACATGCTTTAAAGG + Intergenic
1082574144 11:54782102-54782124 ACAGAGATCTCATACATCAAGGG - Intergenic
1082733383 11:56827329-56827351 ACAAAGATCACATGCTTCAAAGG + Intergenic
1083550092 11:63581637-63581659 ACAAGGATCACATGCTTCAAAGG - Intronic
1084204143 11:67581761-67581783 ACAGAGATCACATACTTCAAGGG - Intergenic
1084223435 11:67699324-67699346 ACAAAGATCACATGCTTCAAAGG - Intergenic
1084250365 11:67893529-67893551 AGAAAGATCACATGCTTCTGAGG - Intergenic
1084250369 11:67893582-67893604 ACAAAGATCACATGCTTCAAAGG - Intergenic
1084822416 11:71701760-71701782 ACAAAGATCACATGCTTCAAAGG + Intergenic
1084822420 11:71701813-71701835 AGAAAGATCACATGCTTCTGAGG + Intergenic
1085060921 11:73446269-73446291 ACAAAGGCAACATGCTGCAAAGG + Intronic
1085480193 11:76815617-76815639 ACAAAAATCACATGCTTCAAAGG + Intergenic
1085480196 11:76815652-76815674 ACAAAGATCACATGCTTCTGAGG + Intergenic
1085529580 11:77183487-77183509 AGAAAGCTCCCATGCCTCAAAGG - Intronic
1085939115 11:81186959-81186981 ACAAAGATCACATGCTTCTGAGG + Intergenic
1085947193 11:81285752-81285774 ACAAAAATCACATGCTTCTGAGG - Intergenic
1085947196 11:81285787-81285809 ACAAAGATCACATGCTTCAAAGG - Intergenic
1085959447 11:81443347-81443369 ACAGAGATCACATGCTTCGAGGG + Intergenic
1087086044 11:94219739-94219761 ACAGAGATCATATGCTTCAGAGG + Intergenic
1087394056 11:97574044-97574066 ACAGAGATCACCTGCTTCAAAGG - Intergenic
1087438989 11:98158909-98158931 ACAGAGATCACATGCTTCAAAGG + Intergenic
1087680199 11:101211487-101211509 ACAAAGATCACATGCTTCTGAGG + Intergenic
1087681282 11:101220583-101220605 ACAAAGATCACATGCTTCTGAGG + Intergenic
1088087917 11:106003535-106003557 ACAGAGATCACATGCTTCAAAGG - Intronic
1088380529 11:109187794-109187816 ACAGAGATCACATGCTTCCAAGG + Intergenic
1088388880 11:109291195-109291217 ACAAAGATAACATATTTAAAAGG - Intergenic
1090065005 11:123495387-123495409 ACAAAGAATACATGCTTGAGGGG - Intergenic
1090223294 11:125050156-125050178 ACATAGGTCACATGCTGCCAAGG + Intergenic
1091410495 12:236161-236183 ACAAAGATCACATGCTTCTGAGG - Intronic
1091410497 12:236214-236236 ACAAAGATCTCATGCTTCAAAGG - Intronic
1091879129 12:3962556-3962578 ACCAAGATGCCGTGCTTCAAAGG + Intergenic
1091987633 12:4925431-4925453 ACAAATATCACATAATTTAATGG + Intronic
1092397611 12:8142064-8142086 ACAGAGATCACATGCTTCAAAGG - Intronic
1092420689 12:8329046-8329068 AGAAAGATCACATGCTTCTGAGG - Intergenic
1092420693 12:8329099-8329121 ACAAAGATCACGTGCTTCAAAGG - Intergenic
1092530072 12:9336558-9336580 ACAAAGATCACGTGCTTCAAAGG + Intergenic
1092852228 12:12639893-12639915 ACAAAGATCACATGCTTCAAAGG + Intronic
1092852233 12:12639946-12639968 ACAAAGATCACGTGCTTTTGAGG + Intronic
1092900313 12:13053597-13053619 ACAAAGATCACGTGCTTCAAAGG + Intronic
1093457153 12:19375917-19375939 AAAAAGAAAACAAGCTTCAATGG - Exonic
1093601695 12:21034098-21034120 ACAAAGATAAAATGCTTGAGGGG - Intronic
1093729825 12:22554691-22554713 ACAAAGATCACATGCTTCAAAGG + Intergenic
1093729829 12:22554744-22554766 ACAAAGATCACATGCTTCTGAGG + Intergenic
1093735135 12:22612677-22612699 ACAAAGGTCACATGCTTCAAAGG + Intergenic
1093735138 12:22612730-22612752 ACAAAGATCACATGCTTTTGAGG + Intergenic
1093837971 12:23859613-23859635 ACAGGGATCACATGCTTCAGAGG - Intronic
1094363384 12:29654106-29654128 AAAAAACTTACATGCTTCAAAGG + Intronic
1094377083 12:29801754-29801776 ACAGAGATCACATGCTTCAAGGG + Intergenic
1094385042 12:29885009-29885031 ACAGAGATCACATGCTTTAAGGG + Intergenic
1094399448 12:30045636-30045658 TCAAAGAACACATGAATCAATGG + Intergenic
1094578282 12:31708543-31708565 GCAAAGATCACATGCTTCTGAGG - Intronic
1094605917 12:31949016-31949038 ACAAAGATCACATGCTTCTGAGG - Intergenic
1094729055 12:33153676-33153698 ACAAAGATCACATGCTTCTGAGG - Intergenic
1095252943 12:39999767-39999789 ACAAAGATCACATGCTTCTGAGG - Intronic
1095252946 12:39999802-39999824 ACAAAGATCACATGCTTCAAAGG - Intronic
1095645238 12:44537141-44537163 ACACAGATCACTGGCTTCAGAGG + Intronic
1096035792 12:48469001-48469023 ACAGAGATCACATGCTTCAAAGG + Intergenic
1097082555 12:56443581-56443603 ACAGAGATCACATGCTTCAAAGG - Intronic
1097135804 12:56853892-56853914 ACAAAGATCACATGCTTCAAAGG - Intergenic
1097186363 12:57198550-57198572 ACCAAGATCACATGGCCCAATGG + Exonic
1097364419 12:58695698-58695720 ACAAGGATCACATGCTTCAAAGG - Intronic
1097425607 12:59440553-59440575 ACAAAGATCACATGCTTCTAAGG - Intergenic
1097425611 12:59440605-59440627 ACGAAGATTGCATGCTTCAAAGG - Intergenic
1097618655 12:61913769-61913791 AAGAAGAACATATGCTTCAAAGG + Intronic
1097664429 12:62463660-62463682 ACAAAGATCACATGCTTCTGAGG - Intergenic
1097664432 12:62463695-62463717 ACAAAGATCACATGCTTCAAAGG - Intergenic
1098467850 12:70808363-70808385 ACAGAGATCACATGCTTTAAGGG - Intronic
1098497212 12:71150360-71150382 ACAAAGATCACATGCTTCTGAGG - Intronic
1098497215 12:71150395-71150417 CACAAGATCACATACTTCAAAGG - Intronic
1098625353 12:72659449-72659471 ACATAGATCCTATGCATCAAAGG + Intronic
1098741138 12:74175030-74175052 ATAAAGATCACATGCTTCTGAGG + Intergenic
1098747206 12:74253792-74253814 ACAAGGATCACATGCTTCAAAGG + Intergenic
1098839107 12:75457894-75457916 ACAGAGATCACAGGCTTCAAAGG + Intergenic
1099318836 12:81119208-81119230 CATAAGATCACATGCTTCAAAGG + Intronic
1099318839 12:81119243-81119265 ACAAAGATCACATGCTTCTGAGG + Intronic
1099580967 12:84446438-84446460 TCAAGGATCATATGCTTCAAAGG + Intergenic
1099724561 12:86410035-86410057 ACAAAGATCACATGCTTTAAAGG + Intronic
1099800944 12:87455637-87455659 ACAAGGATCACATGCTTTAAGGG + Intergenic
1100012383 12:89969189-89969211 ACAAAAATAAAATGCTTCCAAGG + Intergenic
1100087504 12:90929602-90929624 ACAAAGATCACATGCTTCTGAGG + Intronic
1100105611 12:91168139-91168161 ACAATGATCACATGCATAAATGG - Intronic
1100418055 12:94399128-94399150 AAAAAGATCACATGCTTCAAAGG - Intronic
1100439868 12:94606784-94606806 ACAAAGATCACATGCTTCAAAGG + Intronic
1100480650 12:94975033-94975055 ACAAAGGACAAATGCTTGAAGGG + Intronic
1100757957 12:97773206-97773228 ATAAAAACCACATGCTTCACTGG - Intergenic
1100884093 12:99050521-99050543 ACACAGATGGCATGCTTCAGAGG + Intronic
1100910866 12:99361140-99361162 ACAAAGAATAAATGCTTGAAGGG + Intronic
1100970594 12:100065812-100065834 ACAAAGATCACATGCTTTTGAGG - Intronic
1100970597 12:100065847-100065869 ACAAAGATGACATGCTTCAAAGG - Intronic
1101024603 12:100588419-100588441 ACAAAGATCACATGCTTCAAAGG + Intronic
1101024607 12:100588472-100588494 ACAAAGATCACATGCTTCTGAGG + Intronic
1101480828 12:105095309-105095331 ACAAGGATCACATGCTTCAAAGG + Intergenic
1101644706 12:106620474-106620496 ACAAAGATCACATGCTTCAAAGG + Intronic
1101644708 12:106620509-106620531 ACAAAGATCACATGCTTCTGAGG + Intronic
1102436296 12:112926592-112926614 ACAGAGAACACATGATTCAAGGG + Intronic
1102826983 12:115956020-115956042 AAAAAAATCACATACTTCAAAGG + Exonic
1104127972 12:125865255-125865277 ACAAAGATCACATGCTTCAGTGG + Intergenic
1104159561 12:126165228-126165250 CCAAGGAGCACAAGCTTCAAGGG + Intergenic
1104277891 12:127346702-127346724 ACAAAGATCACATGCGTCAAAGG + Intergenic
1104277893 12:127346743-127346765 ATCAAGATCACATGCTTCTGAGG + Intergenic
1104339143 12:127930920-127930942 ATAAAAATCTCAGGCTTCAAGGG - Intergenic
1104405049 12:128510234-128510256 AAAGAGATCACATAATTCAAAGG - Intronic
1105244430 13:18636029-18636051 ACAAAGATCACATGCTTTAAAGG - Intergenic
1105305212 13:19163746-19163768 ACAGAGATCACATGCTTCAAGGG + Intergenic
1105620161 13:22058809-22058831 ACAAAGGCCACATCCTCCAAAGG - Intergenic
1105804105 13:23939683-23939705 ACAGAGATCACATGCTTCAAAGG + Intergenic
1105897744 13:24731505-24731527 ACAAAGATCACATGCTTCTGAGG + Intergenic
1105958608 13:25307759-25307781 ACAAAAATCACATGCACAAAAGG - Intronic
1106537396 13:30659502-30659524 AGAAAGATTACATGCTTCATGGG - Exonic
1107239200 13:38211753-38211775 ACAAAGATCACATGCTTCAAAGG + Intergenic
1107239203 13:38211788-38211810 ACAAAGATCACATGTTTCTGAGG + Intergenic
1108088628 13:46822295-46822317 ACAAGTCTCACATTCTTCAAAGG - Intergenic
1108156144 13:47586662-47586684 GGTAAGATCACATTCTTCAAAGG + Intergenic
1108161788 13:47647836-47647858 ACAATTAACACATGCTACAATGG + Intergenic
1108218299 13:48207187-48207209 ACAAGGATCACATGCTTCAAAGG + Intergenic
1108633471 13:52309824-52309846 TACAAGATCACATGCTTGAAAGG + Intergenic
1108653218 13:52502713-52502735 TACAAGATCACATGCTTGAAAGG - Intergenic
1108916798 13:55623910-55623932 ACAAGGATCACATGCTTCAAAGG + Intergenic
1109159130 13:58950066-58950088 ACAGAGATCCCATGCTTCAAAGG - Intergenic
1109377679 13:61519165-61519187 ACAGAGATCACATGCTTCAAGGG + Intergenic
1109608512 13:64731726-64731748 ACTAAGTTCACATTGTTCAAGGG + Intergenic
1109643979 13:65228259-65228281 ACAAAGATCAATTACTCCAAAGG - Intergenic
1109644626 13:65237252-65237274 ACAGAGATCACATGCTTCAAAGG - Intergenic
1109647205 13:65274231-65274253 ACAAAGATCACATGCTTCTGAGG - Intergenic
1109647207 13:65274284-65274306 ACAAAGATCACATGCTTCAAAGG - Intergenic
1109682574 13:65772123-65772145 ACAAAGATCATATGCTTCTGAGG - Intergenic
1109682577 13:65772158-65772180 CACAAGATCACATGCTTCAAAGG - Intergenic
1109755998 13:66761101-66761123 GCAGAGATCACATGCTTCCAAGG - Intronic
1109911859 13:68923088-68923110 ACAGAGATCACATGCTTCAAGGG + Intergenic
1109918081 13:69018143-69018165 ACAAATATCACATGCTTCAAAGG + Intergenic
1109918085 13:69018196-69018218 ACAAAGATCACATGCTTCTGAGG + Intergenic
1109963386 13:69660594-69660616 ACAAAGATCACATGCTTCTGAGG - Intergenic
1109963389 13:69660629-69660651 ACAAGGATCACATGCTTCAAAGG - Intergenic
1110080096 13:71298744-71298766 ACAAAGATCACATGCTTCAAAGG + Intergenic
1110080099 13:71298778-71298800 ACAAAGATCACTTGCTTCTGAGG + Intergenic
1110263702 13:73514708-73514730 AGAAAGAGCACATGCTTGCAGGG + Intergenic
1110409022 13:75184010-75184032 ACAAAGATCACATGCTTCTGAGG - Intergenic
1110463987 13:75780045-75780067 ACAGAGATCACATGCTTCAAGGG + Intronic
1110529128 13:76576039-76576061 ACAAAGATCATATGCTTCTGAGG - Intergenic
1110529130 13:76576074-76576096 AAGTAGGTCACATGCTTCAAGGG - Intergenic
1110579999 13:77110548-77110570 ACAAAGATCACATGCCTTAAAGG - Intronic
1110660698 13:78056795-78056817 ACAAAGATCACATGCTTCAAAGG + Intergenic
1110660702 13:78056830-78056852 ACAAAGATCACATGCTTCGGAGG + Intergenic
1110934926 13:81276087-81276109 ACAGAGATCACATGTTTCAAAGG - Intergenic
1110953694 13:81525355-81525377 ACAAAGATCATATGCTTCTGAGG - Intergenic
1110953697 13:81525390-81525412 ACAAAGATCACATGCTTCAACGG - Intergenic
1111011207 13:82317406-82317428 GAGTAGATCACATGCTTCAAAGG + Intergenic
1111031724 13:82608646-82608668 ACAAAGATCACATGCTTTTGAGG - Intergenic
1111031727 13:82608681-82608703 ACAAAGATCACATGCTTCAAAGG - Intergenic
1111034886 13:82659453-82659475 ACAAAGACCCCAAGCTTCACTGG + Intergenic
1111452321 13:88435349-88435371 GAGTAGATCACATGCTTCAAAGG - Intergenic
1112053604 13:95669885-95669907 GAGTAGATCACATGCTTCAAAGG + Intergenic
1112093574 13:96108464-96108486 ACAGAGATCACATGCTTCAAGGG - Intronic
1112252324 13:97793474-97793496 GCAGAGATCACATGCTTCTGAGG + Intergenic
1113131752 13:107044576-107044598 ACCAAGTTCACTTGATTCAAAGG - Intergenic
1113214081 13:108017757-108017779 ACAAAGATCACATGCTTCAAAGG - Intergenic
1113216159 13:108043008-108043030 ACAAAGATCACATGCTTCTGAGG - Intergenic
1113216161 13:108043042-108043064 ACAAAGATCACAGGCTTCAAAGG - Intergenic
1113259347 13:108544497-108544519 ACAAAGGACAAATGCTTGAAGGG - Intergenic
1113536578 13:111071391-111071413 ACAAAGATCACATGCTTCAAAGG + Intergenic
1113536580 13:111071426-111071448 ACAAAGATCACATGCTTCTGAGG + Intergenic
1114394427 14:22344164-22344186 CATATGATCACATGCTTCAAGGG + Intergenic
1114750508 14:25199600-25199622 ACAAAGATCACATGCTTCAAGGG + Intergenic
1114750512 14:25199653-25199675 ACAAAGATCATGTGCTTCTGAGG + Intergenic
1115085151 14:29506655-29506677 ACAAAGATCACACACTTCAAAGG + Intergenic
1115125854 14:29992898-29992920 ACAAAGAATAAATGCTTGAAGGG + Intronic
1115280189 14:31653063-31653085 ACAAAGATTACATACTTCAAAGG + Intronic
1115280191 14:31653097-31653119 ACAAAGATCACATGCTTCTGAGG + Intronic
1115386529 14:32804484-32804506 ACAAAGATCACATGCTTCAAAGG + Intronic
1115386531 14:32804519-32804541 ACAAAGATCACATGCTTCTGAGG + Intronic
1115525981 14:34281172-34281194 ACAAAGATCACATGCTTCAAAGG + Intronic
1115525985 14:34281207-34281229 ACAAAGATCACATGCTTCTGAGG + Intronic
1115810950 14:37106639-37106661 ACAAAGATCACATGCTTCTGAGG - Intronic
1115810954 14:37106692-37106714 ACAAAGATCACATGCTTCAAAGG - Intronic
1116200730 14:41792210-41792232 ACAAAGATCACATGCTTCAAAGG + Intronic
1116200732 14:41792245-41792267 ACAAAGATCACATGCTTCTGAGG + Intronic
1116470675 14:45282187-45282209 ACAGAGATCACATGCTTCAAAGG - Intergenic
1116554693 14:46288195-46288217 ACAAAGATCACATGCTTCAAAGG + Intergenic
1116582448 14:46659615-46659637 ACAAGGATCACATGCTTCAAAGG + Intergenic
1116725943 14:48561774-48561796 ATAGAGATCACATGGTTCAAAGG - Intergenic
1116789090 14:49320308-49320330 ACAAAGAACTCAGGCTTCCAAGG + Intergenic
1116840503 14:49816394-49816416 ACAAAGATCACATGCTTCTGAGG - Intronic
1116840506 14:49816429-49816451 ACAAAGATCACATGCTTCAAAGG - Intronic
1117098577 14:52322320-52322342 ACAAAGATCACATGCTTCAAAGG + Intronic
1117098581 14:52322355-52322377 ACAAAGATCACATGCTTCTGAGG + Intronic
1117924465 14:60763380-60763402 ATAAAGAGCATATGATTCAAAGG - Intronic
1118216321 14:63811844-63811866 ACAAAGATCACATGCTTCAAAGG + Intergenic
1118216323 14:63811878-63811900 ACAAAGATCATAAGCTTCTAAGG + Intergenic
1119007830 14:70948186-70948208 ACAGAGATCACATGCTTCAAGGG - Intronic
1119014937 14:71040656-71040678 ACAAAGAACAAATGCTTGAGGGG - Intronic
1119101912 14:71887837-71887859 ACAAAGATCACATGCTTCTGAGG - Intergenic
1119101916 14:71887890-71887912 ACAAAGATCACATGTTTCAAAGG - Intergenic
1119128906 14:72153738-72153760 ACAAAGATCACATGCTTCAAAGG + Intronic
1119128911 14:72153773-72153795 ACAAAGATCATATGCTTCTGGGG + Intronic
1119299842 14:73562967-73562989 ACAAAGATCACATGCTTCTGAGG - Intergenic
1119869290 14:78001635-78001657 ACAAAGATCACATGCTTCTGAGG - Intergenic
1119869292 14:78001670-78001692 ACAAAGATCACATGCTTCAAAGG - Intergenic
1120109729 14:80540102-80540124 ACAAAGATCACATGCTTCTGAGG - Intronic
1120109733 14:80540155-80540177 ACAAAGATCACATGCTTCAAAGG - Intronic
1120120929 14:80679705-80679727 ACAAAGATCACATGCTTCTGAGG - Intronic
1120120933 14:80679740-80679762 ACAAAGATCACCTGCTTCAAAGG - Intronic
1120201002 14:81538150-81538172 ACAAGGATCACATGCTTCAAAGG + Intergenic
1120295415 14:82634058-82634080 ACAGAGATCACATGCTTCAAGGG - Intergenic
1120628147 14:86855151-86855173 ACAACTATCACATGATACAAAGG - Intergenic
1120637154 14:86966645-86966667 ACAAAGATCACATGCTTCAAAGG - Intergenic
1121064935 14:90953933-90953955 ACAAAGATCACATGCTTTTGAGG - Intronic
1121064938 14:90953968-90953990 ACAAAGATCACATGCTTCAAAGG - Intronic
1122645806 14:103192933-103192955 ACAAAGATCACATGCTTCTGAGG + Intergenic
1122844227 14:104481964-104481986 ACAAAGATCACATGCATCAAAGG + Intronic
1122844230 14:104481999-104482021 ACAAAGATCACATGCTTCTGAGG + Intronic
1123098610 14:105778448-105778470 ACAAAGATCACATGCTTCAAAGG + Intergenic
1123098613 14:105778500-105778522 ACAAAGATCACATGCTTCTGAGG + Intergenic
1123137504 14:106043039-106043061 ACAAAGATCACATGCTTTAAGGG - Intergenic
1123151546 14:106186230-106186252 AGAAAGATCTCATGCATCACTGG + Intergenic
1202905051 14_GL000194v1_random:66438-66460 ACAAAGGAAACATGCTTAAAGGG - Intergenic
1202889766 14_KI270722v1_random:144987-145009 ACAAGGGTCACATGCTTCAAAGG + Intergenic
1124225806 15:27893894-27893916 ACAAAGATCACATGCTTCTGAGG - Intronic
1124949587 15:34304866-34304888 ACAGAGATCACATGATGAAAGGG - Intronic
1125005022 15:34807298-34807320 ACAAAGATCACATGCTTCAAAGG + Intergenic
1125005024 15:34807333-34807355 ACAAAGATCACATGCTTCCGAGG + Intergenic
1125654608 15:41345906-41345928 ACAAAGATCACTAGCATTAAGGG - Intronic
1125874092 15:43128891-43128913 ACAAAGATCACATGCTTCAAAGG - Intronic
1126059967 15:44771142-44771164 ACAAAGATCACATGCTTCTGAGG - Intergenic
1126059970 15:44771177-44771199 ACAAAGATCACATGCTTCAAGGG - Intergenic
1126256720 15:46635948-46635970 GCAAAAATCACATGGTTAAAAGG - Intergenic
1126267201 15:46768687-46768709 ACAGAGATCACATGCTTTAGGGG - Intergenic
1127092391 15:55480041-55480063 ACAAAGATCACATACTTCTGAGG - Intronic
1127092395 15:55480094-55480116 ACAAAGATCATATGCTTCAAAGG - Intronic
1129043266 15:72709056-72709078 ACAAAGATCACATGCTTCTGAGG - Intronic
1129043270 15:72709091-72709113 ACAAAGATCACATGCCTCAAAGG - Intronic
1130583980 15:85165149-85165171 ACAAGGATCACATGATTCAAAGG - Intergenic
1130728485 15:86465889-86465911 ACAGAGATCACATGCTTCAAAGG - Intronic
1131000297 15:88934389-88934411 ATAGAGATCACATGCTTCAAGGG + Intergenic
1133065806 16:3206412-3206434 ACAGAGATCACAGGTGTCAAAGG - Intergenic
1133359399 16:5162095-5162117 ACAAAGATCACATGCTTCTGAGG - Intergenic
1133359406 16:5162148-5162170 ACAAAGATCACATGCTTCCAAGG - Intergenic
1133361615 16:5178358-5178380 ACAAAGATCACATGCTTCTGAGG + Intergenic
1133603603 16:7364273-7364295 AAACAGATCTCATACTTCAAAGG - Intronic
1133918326 16:10129337-10129359 TCAAAGGACACATGCTTTAATGG + Intronic
1133989379 16:10692708-10692730 ACAAAGAGCAGAAGCATCAATGG - Intronic
1134793325 16:17011248-17011270 ACAAAGGACAAATGCTTCAGGGG - Intergenic
1135093704 16:19543955-19543977 ACAAAGATCACATGCTTCTGAGG - Intronic
1135093707 16:19543990-19544012 ACAAAGATCACATGCTTCAAAGG - Intronic
1135202853 16:20454036-20454058 ACAAGGATCACATGCTTCAAAGG - Intronic
1135216244 16:20573830-20573852 ACAAGGATCACATGCTTCAAAGG + Intronic
1135593515 16:23723035-23723057 ACAAAGATCACATGCTTCTGAGG - Intergenic
1135593518 16:23723070-23723092 ACAAAGATCACATGCTTCAAAGG - Intergenic
1136361567 16:29783793-29783815 ACAGAGATCACATGCTTCTGAGG - Intergenic
1137248392 16:46724277-46724299 AAAAAAATCTCATACTTCAAAGG - Intronic
1137335070 16:47540397-47540419 ACAAAGATCACATGCTTCTGAGG - Intronic
1137335073 16:47540432-47540454 CACAAGATCACATGCTTCAAAGG - Intronic
1137498073 16:48986282-48986304 GCAAAGATCACATGCTTCTGAGG + Intergenic
1137691052 16:50428038-50428060 ACAAAGGACAAATGCTTCAAGGG - Intergenic
1139014160 16:62669560-62669582 ACAAAGATCACATGCTTCTGAGG - Intergenic
1139014162 16:62669595-62669617 ACAAAGATCATATGCTTCAAAGG - Intergenic
1139016077 16:62690426-62690448 ACAGAGATCACATGCTTCCTAGG - Intergenic
1139106854 16:63836206-63836228 TCAAAGAACAGATACTTCAAAGG + Intergenic
1140060134 16:71561873-71561895 ACAAGGATCACATGCTTCAAAGG + Intronic
1140292349 16:73671945-73671967 AGAAAGATGACACTCTTCAATGG - Intergenic
1140573644 16:76138086-76138108 ACAAAGATCGCACGCTTCAAAGG + Intergenic
1140573647 16:76138121-76138143 ACAAAGATAACATGCTTCTGAGG + Intergenic
1140589725 16:76337497-76337519 ACAGGGATCACATGCTTCAGAGG + Intronic
1140954182 16:79847142-79847164 ACACAGATCACAGGCAGCAAGGG - Intergenic
1142936153 17:3333441-3333463 ACAAAGATCACATGTTTCTGAGG - Intergenic
1143936069 17:10485199-10485221 ACAGAGATCATATGCTTTAAGGG + Intergenic
1143964758 17:10749211-10749233 ACAAATGTCAAATGCCTCAAAGG - Intergenic
1144666523 17:17105801-17105823 ATAAAGATCAAATCCTTGAAAGG - Intronic
1145801204 17:27686316-27686338 ACAGAGATCACATGCTTCATAGG + Intergenic
1145802242 17:27695192-27695214 ACAGAGATCACATGCTTCATAGG + Intergenic
1149175014 17:53859154-53859176 ACAAGGATCACATGCATCAAAGG - Intergenic
1149182440 17:53955687-53955709 ACAAAGATCCCATGCTTCTGAGG + Intergenic
1149619841 17:58035830-58035852 AAAACCATCACAGGCTTCAAAGG + Intergenic
1149670831 17:58408326-58408348 ACAATGATCACATTCTCAAAGGG + Intronic
1149857190 17:60093017-60093039 ACAAAGATCACATGCTTTAAAGG + Intergenic
1149915776 17:60607749-60607771 AGAAAGATGACATTCTGCAAAGG + Intronic
1150289643 17:63973883-63973905 ACAATGCTCACAGGCATCAAAGG - Intergenic
1150628213 17:66857510-66857532 ACATTGATCACATGCTGAAATGG - Intronic
1151246615 17:72799867-72799889 ACAAAGATCACATGCTTCAAAGG - Intronic
1151917747 17:77131053-77131075 ACACAGATCCCATTCTTCTACGG + Intronic
1152415255 17:80155943-80155965 ACAAAGATCACATGCTTCAAAGG - Intergenic
1152746381 17:82041743-82041765 ACAGAGATCACATGCTTCAAAGG + Intergenic
1152995776 18:405299-405321 ACAAAGATCACATGCTTCTGAGG - Intronic
1152995778 18:405349-405371 ACAAAGATCACACGCTTCAAAGG - Intronic
1153074193 18:1143982-1144004 ACAAAGATCACATGCTTCAAAGG + Intergenic
1153074196 18:1144016-1144038 AATAAGATCACATGCTTCTAAGG + Intergenic
1153237662 18:3004232-3004254 ACAAGGATCCCATGCTTCAAAGG - Intronic
1153656683 18:7289056-7289078 CCAAAGATCACAGGATTCTAGGG - Intergenic
1153889908 18:9503275-9503297 ACAAAGATCACATGCTTCTGAGG - Intronic
1153889911 18:9503310-9503332 ACAAAGATCACATACTTCAAAGG - Intronic
1154081742 18:11264050-11264072 GCAAAGATCACATGCTTCTGAGG + Intergenic
1154089277 18:11342457-11342479 ACAAAGATCACATGCTTCTGAGG + Intergenic
1154444504 18:14423873-14423895 ACAAAGATCACATGCTTTAAAGG + Intergenic
1155323441 18:24642391-24642413 GAGTAGATCACATGCTTCAAAGG + Intergenic
1156173630 18:34516293-34516315 ACAGAGATCACATGCTTCGAGGG + Intronic
1156452184 18:37273183-37273205 AAAAATATCACGTGCTTCCAGGG + Intronic
1156526854 18:37775877-37775899 TCAAAGGTAACATGCATCAAAGG - Intergenic
1156590381 18:38481440-38481462 GCAAAGTGCACATGTTTCAAAGG + Intergenic
1156603613 18:38639641-38639663 ACAAAGATCACATGCTTCAAAGG + Intergenic
1156615216 18:38775095-38775117 ACACAGAGCACATGCCTAAAGGG + Intergenic
1156883927 18:42112396-42112418 ACAGAGATCACATGCTTCAAGGG - Intergenic
1157461846 18:47904311-47904333 GCAAAGATCCCCTGCCTCAAAGG + Intronic
1157466883 18:47955044-47955066 AAAAAGACCACATGATTCTAAGG - Intergenic
1157595549 18:48861562-48861584 ACAAACCCCACATGCTTCAGGGG - Exonic
1157643790 18:49245719-49245741 ACAAAGATCACATGCTTCAAAGG - Intronic
1157706166 18:49808675-49808697 ACAAAGATCATATGCTTCAAAGG + Intronic
1157706169 18:49808710-49808732 ACAAAGATCACATGCTTCTGAGG + Intronic
1157756256 18:50220374-50220396 ACAAAGATCACATGCTTCAAAGG + Intergenic
1157756262 18:50220427-50220449 ACAAAGATCACATGCTTCTGAGG + Intergenic
1157758612 18:50241729-50241751 ATAAGGATCACATGCTTCAAAGG + Intronic
1158386178 18:56994400-56994422 ACAAAACTCACATGTTTCCAAGG - Intronic
1159136310 18:64341058-64341080 TCAATAATCACATGCTTCAAAGG + Intergenic
1159347748 18:67228525-67228547 ACAAAGATCACCTGCTTCTGAGG - Intergenic
1159347751 18:67228560-67228582 ACAAAGATCACATGCTTCAAAGG - Intergenic
1159549421 18:69879084-69879106 ACAGAGATCACATGCTTCAAGGG + Intronic
1159636521 18:70811157-70811179 ACAAAAATGACCTCCTTCAAAGG - Intergenic
1159815732 18:73072015-73072037 ACAAAGATCACATGCTTCTGAGG - Intergenic
1159815735 18:73072050-73072072 ACAAAGATCACATGCTTCAAAGG - Intergenic
1159930482 18:74307897-74307919 ACAAAGATCACATGCTGCAAAGG + Intergenic
1160249208 18:77186302-77186324 ACAGAGATCACATGCTTCAAGGG + Intergenic
1160288447 18:77568540-77568562 ACAAAGATCACATGCTTCAAAGG - Intergenic
1160620162 18:80164909-80164931 ACAAAGATCACATGCTTCTGAGG + Intronic
1160737285 19:669318-669340 ACAAAGATCACTTGCTTCTGAGG - Intergenic
1162684107 19:12367344-12367366 ACAAAGATCACATGCCTCAAAGG + Intergenic
1162689522 19:12417691-12417713 ACAAAGATCACATGCTCCAAAGG - Intronic
1163791331 19:19307982-19308004 ACAAAGATCAGAAGTATCAAAGG + Intronic
1163942620 19:20508975-20508997 ACAAAGATCACATGTTTCTAAGG + Intergenic
1164025553 19:21348534-21348556 ATAAGGATCACATACTTCAAAGG + Intergenic
1164091874 19:21961331-21961353 ACAAAGATCACATGCTTCAAAGG + Intronic
1164091876 19:21961365-21961387 ACAAAGATCACATGCTTCTGAGG + Intronic
1164237387 19:23349187-23349209 ACAGAGGTCACATGCTTCAAAGG - Intronic
1164288681 19:23847551-23847573 ACAAAGATCACGTGCTTCAAAGG + Intergenic
1164289800 19:23856848-23856870 ACAAAGATCACGTGCTTCAAAGG + Intergenic
1164314570 19:24075553-24075575 ACAGAGATCACATGCTTCAAAGG + Intronic
1164326419 19:24196473-24196495 ACAAAGATCACATGCTTCAAAGG + Intergenic
1164392322 19:27835679-27835701 ACAAATATCAAAATCTTCAATGG + Intergenic
1165254898 19:34570557-34570579 ACAAAGATCACATGCTTCTGAGG - Intergenic
1165300567 19:34965852-34965874 ACAGAGATCACATGCTTTAAGGG - Intergenic
1165306100 19:35003861-35003883 ACAAAGAACACATGTGGCAAAGG - Intronic
1165685430 19:37815986-37816008 ACAAAGATCACATGCTTCAAAGG - Intronic
1166426848 19:42686580-42686602 CACAAGATCACATGCTTCAAAGG + Intronic
1166426851 19:42686615-42686637 ACAAAGATCACATGCTTCTGAGG + Intronic
1166912637 19:46170969-46170991 ACAGAGATCACATGCTTCAAGGG - Intergenic
1168712206 19:58508052-58508074 ACAAAGATCACATGCTTCAAAGG - Intronic
1202665170 1_KI270708v1_random:111809-111831 ACAAGGGTCACATGCTTCAAAGG + Intergenic
925350645 2:3198763-3198785 ACAGAGATCACATGCTCCAAGGG + Intronic
925393474 2:3515599-3515621 ACAAAGATCACATGCTTCTGAGG - Intronic
925393478 2:3515652-3515674 ACAAATATCACAGGCTTCAAAGG - Intronic
925456066 2:4017606-4017628 ACAAAGATCACATGCTTCAAAGG + Intergenic
925576327 2:5363999-5364021 ATGAACATCACATGCTTAAATGG - Intergenic
925660641 2:6198783-6198805 ACAAGGATCACATGCTTCAAAGG - Intergenic
925974698 2:9133663-9133685 ACAAAGATCACATGCTTCAAAGG + Intergenic
926528277 2:14009889-14009911 ACAAGGATCACATGCTTCAAAGG + Intergenic
926586480 2:14691378-14691400 ACAAAGATCACATGCTTCAAAGG + Intergenic
926643103 2:15258792-15258814 ACAAAGATCACATGCTTCTGAGG - Intronic
926643106 2:15258827-15258849 ACAAAGATCACATGCTTCAAAGG - Intronic
926978121 2:18535162-18535184 ACAAGGATCCCGTGCTTCACAGG + Intergenic
927079708 2:19615339-19615361 ACAAAGATCACATGCTTCTGAGG + Intergenic
928491064 2:31783890-31783912 ACAAAGATCACATGCTTCAAAGG - Intergenic
928729116 2:34210321-34210343 ACAGAGATCACATGCTTCAAAGG + Intergenic
928805567 2:35147766-35147788 ACAATGATAGCATGCTTCCAAGG - Intergenic
928897234 2:36279892-36279914 ACAGAGATCACATACTTCAAGGG - Intergenic
929350242 2:40942052-40942074 ACAAAGATCACATGCTTCTGAGG - Intergenic
930057441 2:47262920-47262942 AAAAAGAGCACATGCTTCCTGGG + Intergenic
930300691 2:49612024-49612046 ACAAAGATCTCATGCTTCTGAGG - Intergenic
930423206 2:51179190-51179212 ACAAAGATCACATGATTCTGAGG - Intergenic
930423209 2:51179225-51179247 ACAACGATCACATGTTTCAAAGG - Intergenic
931578524 2:63746878-63746900 ACAGAGATCACATGCCTCAAGGG - Intronic
931599462 2:63989290-63989312 ACAGAGATCACGTGCTTCAAGGG - Intronic
931600389 2:63996890-63996912 ACAGAGATCACATGCTTCAAGGG - Intronic
932010612 2:67974005-67974027 ACAAAGGTTAAATGCTTGAAGGG - Intergenic
932071924 2:68629089-68629111 CACAAGATCCCATGCTTCAAAGG + Intronic
932071929 2:68629124-68629146 ACAAAGATCACATGCTTCTGAGG + Intronic
932375607 2:71233012-71233034 ACAGAGATCACATGCTTCAAAGG + Intergenic
932395603 2:71445314-71445336 CCAAAGTTCACATGCTTCTGAGG - Intergenic
932395607 2:71445350-71445372 ACAAAGATCACATGCTTCAAAGG - Intergenic
932489583 2:72112162-72112184 ACAGAGATCACGTACTTCACAGG - Intergenic
932535602 2:72591226-72591248 ACAAACATCACTAGCTTCATTGG - Intronic
933015157 2:77114823-77114845 ACAAAGATCACGTGCTCCAAAGG + Intronic
933401888 2:81808999-81809021 ATAGGGTTCACATGCTTCAAAGG + Intergenic
933598523 2:84306318-84306340 ACAGAGATCACATGCTTCAAAGG + Intergenic
934501587 2:94864034-94864056 ACAAAGGATACATGCTTGAAGGG + Intergenic
934930009 2:98414568-98414590 ACAGAGATCATATGCTTCAAGGG - Intergenic
934932233 2:98436030-98436052 ACAGAGATCACATGCTTCAAGGG - Intergenic
935018347 2:99205882-99205904 ACAGAGATCACATGCTTCAAGGG - Intronic
935481185 2:103592266-103592288 ACAAAGATCACATGCTTCTAAGG - Intergenic
935481189 2:103592301-103592323 ACAAAGATCACATGCTTCAAAGG - Intergenic
935486139 2:103656683-103656705 AAAAAGATCAAATGCTTCAGAGG + Intergenic
935716146 2:105940589-105940611 ACAAAGAACACCTGCATCAAGGG + Intergenic
935743151 2:106168594-106168616 AGCAAAATCACATGGTTCAAAGG - Intronic
935751189 2:106235241-106235263 CGCAAGATCACATGCTTCAAAGG + Intergenic
935751192 2:106235276-106235298 ACAAAGATCACATCCTTCTGAGG + Intergenic
935762099 2:106330538-106330560 TCAAAGATCACATGCTTCAAAGG + Intergenic
935762102 2:106330591-106330613 ACAAGGATCACATGCTTCTGAGG + Intergenic
935824149 2:106926747-106926769 ACAAAGATCACATGCTTCAACGG + Intergenic
935824154 2:106926800-106926822 ACAAAGATCACATGCTCCTGAGG + Intergenic
936694402 2:114929161-114929183 ACAAAGATCCCATGCTTGAACGG + Intronic
936816771 2:116469858-116469880 GCAAAGATCACATGCTTCTGAGG + Intergenic
937069849 2:119054710-119054732 CACAAGATCACATGCTTCAAAGG + Intergenic
937069852 2:119054745-119054767 ACAAAGATCACATGCTTCTGAGG + Intergenic
937112067 2:119374036-119374058 ACAAAGATGACATGCTTCTGAGG + Intergenic
937163730 2:119792908-119792930 ACAGAGATCACATGCTTCAAAGG + Intronic
937591510 2:123618591-123618613 ACAAGGATCACATGCTTCAAAGG + Intergenic
937606347 2:123806062-123806084 ACAAAGATCACATGCTTCTGAGG + Intergenic
937613346 2:123890595-123890617 ACAGAGATCACATGCTTCAAGGG - Intergenic
937794701 2:126003064-126003086 ACAGAGATCACATGCTACAAGGG - Intergenic
937838344 2:126497110-126497132 ACAGAGATCACATGCTTCTGAGG + Intergenic
938507472 2:131901475-131901497 ACAAAGATCACATGCTTCAAAGG + Intergenic
938507474 2:131901510-131901532 ACAAAGATCACATGCTTCTGAGG + Intergenic
938616494 2:133004559-133004581 ACAGAGATCACATGCTTCATAGG + Intronic
938634354 2:133207091-133207113 ACAAGGATCACATGCTTCAAAGG - Intronic
938842585 2:135177368-135177390 ACAAAGATCACATGCTTCCAAGG + Intronic
938858592 2:135342017-135342039 ACAGAGATCACATGCTTCAAGGG - Intronic
939133192 2:138262492-138262514 ACAAAGATCACATGCTTCTGAGG - Intergenic
939146930 2:138426517-138426539 ACAGAGATCACATGCTTCAAAGG - Intergenic
939306202 2:140415310-140415332 ACAAAGATCACGTGCTTCTGAGG - Intronic
939306206 2:140415363-140415385 ACAAAGATCACATGCTTCAAAGG - Intronic
939708969 2:145491371-145491393 ATAAAGATCATTTGTTTCAATGG - Intergenic
939822053 2:146969648-146969670 ACAAAGATCACATGCTTCAAAGG + Intergenic
939826574 2:147022915-147022937 CACAAGGTCACATGCTTCAAAGG + Intergenic
939826577 2:147022950-147022972 ACAAAGATCACATGCTTCTGAGG + Intergenic
939964166 2:148594232-148594254 ACCAAGAGCACAGACTTCAATGG - Intergenic
940276166 2:151943007-151943029 ACAAAGATCACATGCTTCTAAGG - Intronic
940276168 2:151943042-151943064 ACAAAGATCTCATGCTTCAAAGG - Intronic
940299678 2:152164009-152164031 ATAAAGATCACATGCTTCTGAGG - Intronic
940436603 2:153663983-153664005 ACAAAGATCACATGCTTCAAAGG + Intergenic
941073983 2:160986801-160986823 ACAAAGATCACATGCTTCAAAGG + Intergenic
941073985 2:160986836-160986858 ACGAAGATCACATGCTTCTGAGG + Intergenic
941511481 2:166416283-166416305 ACAAAGATCACATGCTTCTGAGG - Intronic
941849130 2:170161560-170161582 AAAAAGAGCACTTGCTTCACTGG + Intergenic
942094700 2:172526018-172526040 ACAAAGATCACATGCTTCAAAGG - Intergenic
942108711 2:172658983-172659005 ACAAAGATCACATGCTTCTGAGG - Intergenic
942108714 2:172659018-172659040 ACAGAGATCACATGCATCATAGG - Intergenic
942582264 2:177431275-177431297 ACAAAGATCACATGCTTCAAAGG + Intronic
942777609 2:179602818-179602840 ACAAACATTACATACTTGAAAGG + Intronic
942802234 2:179889101-179889123 ACAAAGATCACATGCTTCTGAGG - Intergenic
942808393 2:179963977-179963999 ACCAAATTCACATCCTTCAAAGG + Intronic
942997200 2:182277109-182277131 ACAAAGATCACATGCTTCTGAGG - Intronic
942997203 2:182277145-182277167 ACAAAGATCACATGCTTCAAAGG - Intronic
943171557 2:184407419-184407441 ACAAAGACCACATGCTTCAAAGG - Intergenic
943213966 2:185006530-185006552 GAAGAGATCACATGCTTCAAAGG + Intergenic
943750819 2:191507715-191507737 ACAGAGATCACATGCTTCAAGGG - Intergenic
943846837 2:192660561-192660583 ACAAAGATCACATGCTTCAAAGG + Intergenic
943873021 2:193026022-193026044 ACAAAGATCACATGCTTGAAAGG - Intergenic
943942988 2:194022813-194022835 ACAAAGGTCACATGCTTCAAAGG + Intergenic
943942993 2:194022865-194022887 ACAAAGATCACATGCTTCTAAGG + Intergenic
944151298 2:196561465-196561487 ACAAAGATCACATGCTTCAAGGG - Intronic
944174729 2:196817051-196817073 GCAAAGATTACATGCTTCAAAGG + Intergenic
944174732 2:196817086-196817108 ACAAAGATCACATGCTTCTGAGG + Intergenic
944395642 2:199263243-199263265 ACAAAGATCACATGCTCCTGAGG - Intergenic
944395645 2:199263278-199263300 ACAAAGATCACATGCTTCAAGGG - Intergenic
944637696 2:201690688-201690710 ACACAGCTCACATGCTGCACAGG - Intronic
944753290 2:202733199-202733221 ACAAAGATCACATGCTATAAAGG + Intronic
945066639 2:205953179-205953201 ACAGAGATCACGTGCTTCACAGG + Intergenic
945357238 2:208855127-208855149 ACAGAGATCACATGCTTCAAGGG - Intergenic
945371117 2:209018992-209019014 ACAGAGATCACATGCTTCGAGGG - Intergenic
945472828 2:210246866-210246888 ACAGAGATTACATGCTTCAAAGG + Intergenic
945611509 2:212010469-212010491 ACAAAGATCACATGCTTCAAAGG + Intronic
945611511 2:212010504-212010526 ACAAAGATCACATGCTTCTGAGG + Intronic
945723688 2:213449345-213449367 ACAAAGATCACATGCTTCTGAGG - Intronic
946125817 2:217561814-217561836 ACAAAAATCACATGCTTCAAAGG - Intronic
946636714 2:221736697-221736719 ACAAACCTCTCATTCTTCAACGG - Intergenic
946978444 2:225179195-225179217 AAAAAAAACACATGCCTCAAGGG - Intergenic
947071388 2:226291766-226291788 ACAAAGATCACATACTTCAAAGG - Intergenic
947276462 2:228397336-228397358 ACAGGGATCACATGCTTCAAGGG + Intergenic
947731346 2:232433251-232433273 CCAAACATCACATGCTGCAGGGG - Intergenic
948986246 2:241526224-241526246 ACAAAGATCGCATGCTTCTGAGG - Intergenic
948986249 2:241526259-241526281 ACAAAGATCACATGCTTCAAAGG - Intergenic
1168876729 20:1177010-1177032 CAAAGGATCACATGCCTCAAAGG - Intronic
1170256447 20:14349370-14349392 ACAAAGGACAAATGCTTGAAGGG - Intronic
1172188330 20:33045754-33045776 ACAGAGATCACGTGCTTCAAAGG - Intergenic
1172298726 20:33832736-33832758 ATAAAGAGCACAGGATTCAAAGG - Intronic
1172470398 20:35189547-35189569 ACAGAGATCACTTGTTTCAAGGG - Intergenic
1172678759 20:36695827-36695849 ACAGAGATCACATGCTTCAAGGG - Intronic
1172811415 20:37650796-37650818 ACATAGATAATATGCTACAATGG + Intergenic
1173500557 20:43549699-43549721 ACACACATCACATGATTGAAGGG - Intronic
1175093127 20:56520900-56520922 ACAGAGATCACATGCTTCAAAGG + Intronic
1175303337 20:57958629-57958651 TCAAAGATCCCTTGCTACAAAGG - Intergenic
1176210223 20:63916475-63916497 CACAAGATCACATGCTTCAAAGG + Intronic
1176451478 21:6865988-6866010 ACGAAGATCACATGCTTTAAAGG - Intergenic
1176458175 21:6930872-6930894 ACAGGGATCACATGCTTCAAAGG + Intergenic
1176624414 21:9081196-9081218 ACAAAGGAAACATGCTTAAAGGG - Intergenic
1176786156 21:13258816-13258838 ACAAAGATCACATGCTTCTGAGG - Intergenic
1176786158 21:13258851-13258873 ACAAAGATCACATGCTTCAAAGG - Intergenic
1176829646 21:13731039-13731061 ACGAAGATCACATGCTTTAAAGG - Intergenic
1176836349 21:13795967-13795989 ACAGGGATCACATGCTTCAAAGG + Intergenic
1176879974 21:14180297-14180319 ACAAAGATCACATGCTTCAAAGG - Intronic
1176885462 21:14250015-14250037 GCAAAGATCACATGCTTCCGAGG - Intergenic
1176885465 21:14250050-14250072 ACAAAGATCACATGCTTCAAAGG - Intergenic
1176914663 21:14610503-14610525 ACAGAGATCACATGCTTCAAGGG - Intronic
1177460488 21:21402562-21402584 GCAAAGATCACATGCTTTTGAGG - Intronic
1177984763 21:27960844-27960866 GCAAAGATCACATGCTTCTGAGG - Intergenic
1177984765 21:27960879-27960901 ACAAAGATCACATGCTTCAAAGG - Intergenic
1177993985 21:28073020-28073042 ACAGAGATCACAAGCTTCAAGGG - Intergenic
1178858241 21:36267893-36267915 ACAGAGATCACATGCTTCAAAGG + Intronic
1178858245 21:36267946-36267968 ACAAAGATCACATACTTTTGAGG + Intronic
1179445930 21:41430236-41430258 ACAAAGATCACATGGCTCTCGGG + Intronic
1180234407 21:46448755-46448777 ACAAAGATCACATGCTTCAAAGG + Intergenic
1180234411 21:46448790-46448812 ACAAAGATTACGTGCTTCTGAGG + Intergenic
1180331892 22:11488729-11488751 ACAAGGGTCACATGCTTCAAAGG + Intergenic
1180990896 22:19935489-19935511 GCAAAGATCACATGCTTCTGAGG - Intronic
1180990899 22:19935524-19935546 ACAAAGATCACATGCTTCAAAGG - Intronic
1181536253 22:23547650-23547672 ACAAAGATCACATGCTTCAAAGG - Intergenic
1181758795 22:25043564-25043586 ACAGAGATCAGAAGCTTCAAAGG - Intronic
1181876026 22:25941500-25941522 ACAGAGATCAGATCCTTCAGTGG - Intronic
1182601595 22:31469323-31469345 GCAAACATCACAGGCTGCAAAGG - Intronic
1183174054 22:36209553-36209575 ACAAAGATCACATGCTTCAAAGG + Intergenic
1183174058 22:36209606-36209628 ACAAAGATCACATGCTTCTGAGG + Intergenic
1183701231 22:39452353-39452375 GCCAGGAACACATGCTTCAAGGG + Intergenic
1184632689 22:45796428-45796450 ACAGAGATCACATGCTTCAAAGG - Intronic
949213639 3:1537252-1537274 ACAAAGATCACATGCTTCAAAGG - Intergenic
949217538 3:1587720-1587742 ACAAAGATCATATGCTTCTGAGG - Intergenic
949217542 3:1587773-1587795 ACAAAGATCACATGCTTCAAAGG - Intergenic
949231302 3:1754160-1754182 ACAAAGATCACATGCTTCAAAGG + Intergenic
949231305 3:1754195-1754217 AACAAGATCACATGCTTCTGAGG + Intergenic
949366953 3:3292169-3292191 ACAAAGATCACATGCTTCAAAGG - Intergenic
949638923 3:6013685-6013707 ACAGAGATCACATGCTTCAAGGG - Intergenic
950073249 3:10169157-10169179 CCAGAGATCACATTCTTCAAAGG + Intronic
950198580 3:11026978-11027000 ACAGAGATCACATGCTCACAAGG + Intronic
950231241 3:11277620-11277642 ACAAAGATCACATGCTTCTGAGG + Intronic
950807543 3:15619944-15619966 ACAAAGATCACATGCTTCAAAGG + Intronic
950807548 3:15619997-15620019 ACAAAGATCACATGCTTCTGAGG + Intronic
951080987 3:18449553-18449575 ACAAAGATCACCTGCTTCAAAGG + Intergenic
951080991 3:18449588-18449610 GCAAAGATCACATGCTTCTGAGG + Intergenic
951240723 3:20283257-20283279 ACAAAGATCACATGCTTCTGAGG - Intergenic
951240727 3:20283310-20283332 ACAAAGATCACATGCTTCAAAGG - Intergenic
951302031 3:21009867-21009889 ACAGAGATCACATGCTTCAAGGG - Intergenic
951805215 3:26636311-26636333 AAAAAAATCACATCCTTCTATGG - Intronic
951842775 3:27051951-27051973 ACAAGGATCACATGCTTCAAAGG - Intergenic
951859549 3:27236702-27236724 ACAAAGATCACATGCCTTAAAGG + Intronic
951978475 3:28540668-28540690 ACAAAGTTCACATTCTTTAAAGG + Intergenic
952051850 3:29393863-29393885 ACAAAGATCACATGCTTGAAAGG + Intronic
952259143 3:31722612-31722634 GAAAAGTTCACATCCTTCAAAGG + Intronic
952293757 3:32042775-32042797 CACAAGATCACATGCTTCAAAGG + Intronic
952293760 3:32042810-32042832 ACAAAGATCACATGCTTCTGAGG + Intronic
952399811 3:32953066-32953088 TCAAAGAACACCTGCTTGAAAGG + Intronic
953119476 3:40025805-40025827 ACAAAGATCACATGCTTCAAAGG + Intronic
953119480 3:40025840-40025862 ACAAAGATCACATGCTTCTGAGG + Intronic
953509262 3:43518937-43518959 AGAGAGATCACATGCTTCAAGGG - Intronic
953846581 3:46432271-46432293 ACAAAGATCACATGCTCCTGAGG - Intergenic
953846584 3:46432306-46432328 ACAAAGATCACATGCTTCAAAGG - Intergenic
953987910 3:47459645-47459667 CACAAGATCACATGCTTCAAAGG + Intronic
953987913 3:47459680-47459702 ACAAAGATCACATGCTTCTGAGG + Intronic
954738685 3:52729076-52729098 ACAAATATCACATGCTTCTGAGG - Intronic
954738688 3:52729111-52729133 ACAAAGATCACATGCTTCAAAGG - Intronic
954814281 3:53268309-53268331 ACAAAGATCACAAATTGCAATGG - Intergenic
955029723 3:55204630-55204652 ACACAGAGCAGAAGCTTCAAGGG - Intergenic
955514826 3:59716195-59716217 ACAGAGATCACATGCTTCAAGGG + Intergenic
956220591 3:66898585-66898607 GCAAAGATCACATGTTTCTGAGG - Intergenic
956220594 3:66898620-66898642 ACAAAGATCACATGCATCAAAGG - Intergenic
956315424 3:67930353-67930375 ACAAGGATCACATGCTTCAGAGG + Intergenic
956328084 3:68075254-68075276 TCAGAGGTCACAGGCTTCAATGG - Intronic
956552666 3:70479138-70479160 ACAGAGATCACATGCTTCAAAGG - Intergenic
956568810 3:70670983-70671005 ACAAAGATGAGATGATTCAAGGG + Intergenic
956715447 3:72075796-72075818 ACAGAGATCACATGCTTCCTAGG + Intergenic
957064652 3:75511605-75511627 ACAAAGATCACATGCTTCTGAGG - Intergenic
957064656 3:75511658-75511680 ACAAAGATCACATGCTTCAAAGG - Intergenic
957124029 3:76134619-76134641 AAAAAGATCATAAGCTTCACAGG + Intronic
957353205 3:79052490-79052512 ACAGAGATCACATACTTCAAAGG - Intronic
957354165 3:79060342-79060364 ACAGAGATCACATGCTTCAAAGG - Intronic
957623052 3:82620678-82620700 ACAGAGATCACATGTTTCATAGG + Intergenic
957778970 3:84793563-84793585 AGAGAGATCACATACTTTAAGGG - Intergenic
958193982 3:90219332-90219354 ACAAAGATCACATGCTTCTGAGG - Intergenic
958417339 3:93890387-93890409 CCAAAGATCACATGCTTCTGAGG - Intronic
958424416 3:93964669-93964691 ACAAAGATCACATGCTTCAAAGG - Intronic
958497209 3:94860693-94860715 ACAAAGATCACATACTTCAAAGG - Intergenic
958621877 3:96572968-96572990 ACAAAGATCACATACTTCAAAGG + Intergenic
958621880 3:96573003-96573025 ACAGAGATCACATGCTTCTGAGG + Intergenic
959005224 3:101012244-101012266 ACAAAGATCACATGCTTCTGAGG + Intergenic
959220029 3:103506587-103506609 ACAAAGACCACATGCTTCAAAGG + Intergenic
959220033 3:103506622-103506644 ACAAAGACCACATGTTTCTGAGG + Intergenic
959261696 3:104090333-104090355 ACAAAGATCACATGCCTCTGAGG - Intergenic
959729444 3:109584147-109584169 ACAAGGATCACATGCTTCAAAGG - Intergenic
959797550 3:110449656-110449678 ACAGAGAGCACATACTGCAAAGG - Intergenic
959813621 3:110649311-110649333 ACACAGGAAACATGCTTCAAAGG - Intergenic
959888011 3:111524871-111524893 ACAAAGATTACATGCTTCTGAGG - Intronic
959888013 3:111524906-111524928 ACAAAGATCACATGCTTCAAAGG - Intronic
959888672 3:111530176-111530198 ACAAAGATCACTTGCTTCTGAGG - Intronic
959888674 3:111530211-111530233 ACAAAGATCACATGCTTCAAAGG - Intronic
959936773 3:112037577-112037599 ACAGAGATCACGTGCTTCAAAGG - Intronic
960011944 3:112842999-112843021 ACAAAGATCACATGCTTCTGAGG - Intronic
960083615 3:113567613-113567635 ACAAATATCAGTTGCTGCAAGGG - Exonic
960334888 3:116404718-116404740 AGACAGATCACATGATTCTAAGG + Intronic
960646384 3:119889068-119889090 ACAAAGATCACATGCTTGTGAGG - Intronic
960646388 3:119889103-119889125 CCCAAGATCACATGTTTCATAGG - Intronic
960666776 3:120117056-120117078 ACAAAGTTCACATGCTTCTGAGG - Intergenic
960666779 3:120117092-120117114 ACAAAGGTTACATGCTTCAAAGG - Intergenic
961264693 3:125632389-125632411 TCATAGAGCACAGGCTTCAAGGG - Intergenic
961288696 3:125827736-125827758 ACAAAGATCACATGCGTCAAAGG + Intergenic
961288700 3:125827789-125827811 AAAAAGATCACATGCTTCTGAGG + Intergenic
961898369 3:130188247-130188269 AGAAAGATCACATGCTTCTGAGG - Intergenic
961898373 3:130188300-130188322 ACAAAGATCATATGCTTCAAAGG - Intergenic
961919232 3:130408581-130408603 ACAGAGATCATATGCTTCAAAGG - Intronic
962497552 3:135957188-135957210 ACAGAGATCACATGCTTCAAAGG + Intergenic
962556535 3:136557982-136558004 ACAAAAATCCCTTCCTTCAAAGG + Intronic
962758490 3:138486324-138486346 ACAAAGATCACATGCTTCAGAGG + Intergenic
962758493 3:138486359-138486381 ACAAAGATCACATGCTTCTAAGG + Intergenic
962764159 3:138546023-138546045 ACGAAGATCACATGCTTTAAAGG - Intronic
963343996 3:144071809-144071831 ACAAAGATCACATGCTTTAGAGG + Intergenic
963473250 3:145771149-145771171 ACAAAGATCACATGCTTCAAAGG + Intergenic
964180219 3:153874524-153874546 ACAAAGATCACATGCTTCTGAGG + Intergenic
964609501 3:158596252-158596274 ACACATACCTCATGCTTCAAGGG + Intronic
964612974 3:158633400-158633422 ACAAGGATCACATGCTTCAAAGG + Intergenic
964840060 3:160983928-160983950 ACAGAGATCACTTGCTTTAAGGG + Intronic
965089758 3:164147852-164147874 GCAAAGATCATATGCTTCTGAGG - Intergenic
965089760 3:164147886-164147908 AAGTAGGTCACATGCTTCAATGG - Intergenic
965791986 3:172399249-172399271 AAAAATATAACATGCTACAAGGG - Exonic
966511745 3:180771990-180772012 ACAAAGATCACATGCTTCAAAGG + Intronic
967265327 3:187686375-187686397 ACGAGGATCACATGCTTCAAAGG - Intergenic
967300850 3:188010593-188010615 ACAAAGATCACATGCTTCAAAGG + Intergenic
967317972 3:188167558-188167580 ACAAAGATAACATTTTTCAGTGG - Intronic
967376711 3:188811954-188811976 ACAAAGGACAAATGCTTGAAGGG - Intronic
967701966 3:192603699-192603721 ACAAAGATCACATGCCTCAAAGG + Intronic
967701969 3:192603734-192603756 ACAAAGATCACATGCTTCTGAGG + Intronic
967778853 3:193413901-193413923 ACAAAGATCACATGCTTCTGAGG - Intronic
968041068 3:195589756-195589778 ACAAAGATCACATGCCTCTGAGG + Intergenic
968342396 3:197967500-197967522 ACAAAGATCACATGCTTCTGAGG + Intronic
968396877 4:247145-247167 ACAGAGATCACATGCTTCAAAGG + Intergenic
969008552 4:4041711-4041733 ACAAAGATCACATGCTTCTGAGG - Intergenic
969008556 4:4041764-4041786 ACAAAGGTCACATGCTTCAAAGG - Intergenic
969343246 4:6555667-6555689 ACAAGCATCACATCATTCAAAGG - Intronic
969745127 4:9064612-9064634 ACAAAGGTCACATGCTTCAAAGG + Intergenic
969745131 4:9064665-9064687 ACAAAGATCACATGCTTCTGAGG + Intergenic
969804418 4:9595626-9595648 ACAAAGATCACATGCTTCAAAGG + Intergenic
969804422 4:9595679-9595701 ACAAAGATCACATGCTTCTGAGG + Intergenic
969885722 4:10213590-10213612 ACAAAGATCACATGCTTCTGAGG + Intergenic
970448645 4:16145424-16145446 GAGTAGATCACATGCTTCAAAGG - Intergenic
970719566 4:18970672-18970694 ACAAGGATCACATGCTTCAAAGG + Intergenic
970722308 4:19002188-19002210 ACAAAGATCACATGCTACAAAGG + Intergenic
970848855 4:20577486-20577508 ACAAAGATCACATCTGTTAATGG + Intronic
970956515 4:21817953-21817975 ACAAAGATCACATGCTTCTGAGG - Intronic
970956519 4:21818007-21818029 ACAAAGATCACATGCTTCAAAGG - Intronic
970980120 4:22086343-22086365 ACAAAGATCACATGCTTCAACGG + Intergenic
970980123 4:22086379-22086401 ACAAAGTTCACATGCTTCTGAGG + Intergenic
971319901 4:25597064-25597086 ACAGAGATCACATGCTTCTGAGG + Intergenic
971332243 4:25691479-25691501 ACAGAGATCACATGCTTCAGTGG + Intergenic
971332245 4:25691506-25691528 CAAAAGATCACATGCTTCAGTGG + Intergenic
971405144 4:26315483-26315505 ACAAAGATCACATGCTTCTGAGG + Intronic
971603828 4:28631409-28631431 ACAGAGATCACATGCTTCAAAGG + Intergenic
971753822 4:30682747-30682769 ACAAAGATCACACGCTTCAAAGG + Intergenic
971846749 4:31928494-31928516 GAGTAGATCACATGCTTCAAAGG - Intergenic
972362366 4:38338893-38338915 ACAAGGATCACATGCTTCAAAGG + Intergenic
972362431 4:38339474-38339496 ACAAAGATAACATGATTAAGAGG + Intergenic
972897227 4:43638348-43638370 ACAGAGATCACATGCTTCAAAGG - Intergenic
973040236 4:45460543-45460565 ACAGAGATCACATGCTTCAAGGG - Intergenic
973223294 4:47753231-47753253 ACAAAGATCACATGCTTTAAAGG + Intronic
973244014 4:47990580-47990602 ACAAGGATTACATGCTTCAACGG - Intronic
973307472 4:48668912-48668934 ACAAAAATCAAATGCTATAAAGG - Intronic
973659080 4:53083886-53083908 ACAAAGATCACATGCTTCTCAGG + Intronic
973799927 4:54467383-54467405 ATAAAGATCACATGCTTCTGAGG - Intergenic
974164621 4:58185430-58185452 ACAAATATCACATGCTTTAAAGG + Intergenic
974185490 4:58440349-58440371 ACAAAGATCACATGCTTAAAAGG + Intergenic
974185492 4:58440384-58440406 ACAAAGATCACATGCTTTTGAGG + Intergenic
974230862 4:59111914-59111936 ACAAAGATCACATGCTTCTGAGG - Intergenic
974230865 4:59111949-59111971 ACAAAGATCATATGCTTCAAAGG - Intergenic
974605734 4:64147268-64147290 ACAAAGATCACATGCTTCAAAGG + Intergenic
974605738 4:64147303-64147325 ACAAAGATCACATGCTTCTGAGG + Intergenic
974645632 4:64687539-64687561 GAGTAGATCACATGCTTCAAAGG - Intergenic
974741431 4:66013181-66013203 ACAAAGATCACATGTTTCTGAGG - Intergenic
974741437 4:66013234-66013256 ACAAAGATCCCATATTTCAAAGG - Intergenic
974961237 4:68703602-68703624 ACAAGGATCACATGCTTCAAAGG - Intergenic
974986588 4:69034658-69034680 ACAGAGATCACACGCTTCAAAGG - Intronic
974998369 4:69192063-69192085 ACAAAGATCACATGCTTCTGAGG - Intronic
974998371 4:69192098-69192120 ACAAAGATCACATGCTTCAAAGG - Intronic
974999192 4:69198944-69198966 ACAAAGATCACATGCTTCTGAGG - Intronic
974999195 4:69198979-69199001 ACAAAGATCACATGCTTCAAAGG - Intronic
975006592 4:69296269-69296291 ACAACGATCACATGCTTCAAAGG + Intronic
975006594 4:69296304-69296326 ACAAAGATCACATGCTTCTGAGG + Intronic
975016262 4:69424618-69424640 ACAAAGATCACATGCTTCATAGG + Intergenic
975016265 4:69424653-69424675 ACAAAGATCACATGCTTCTCAGG + Intergenic
975228686 4:71905777-71905799 AAAAAGATCACATGCTTCTGAGG - Intergenic
975228690 4:71905829-71905851 ACAAAGATCACATGCTTCAAAGG - Intergenic
975307666 4:72867478-72867500 ACAAAGATCACATGTTTCTGAGG + Intergenic
975721542 4:77253253-77253275 ACTAAGATCATAGGCTTCACAGG - Intronic
975722749 4:77264095-77264117 ACAAAGATCACACACTTCAAAGG + Intronic
975722754 4:77264147-77264169 ACAAAGATCACATACTTCTCAGG + Intronic
975724858 4:77281953-77281975 ACTAAGATCATAGGCTTCACAGG - Intronic
975729097 4:77320197-77320219 ACAAAGATCACATGTTTCAAAGG + Intronic
975790600 4:77945795-77945817 ACAAAGATCACATGCTTCAAAGG + Intronic
975790603 4:77945830-77945852 ACAAAGATCACATGCTTCTGAGG + Intronic
975819222 4:78252832-78252854 ACAAAGACCACATGCTTCAAAGG + Intronic
975897931 4:79117474-79117496 ATAAAAATCACATGCTTCAAAGG - Intergenic
976363386 4:84206271-84206293 ACAAGGATCACATGCTTCAAAGG + Intergenic
976453267 4:85216963-85216985 GCAAAGATCGCATGCTTCTGAGG - Intergenic
976645644 4:87384824-87384846 ACAAAGATCACATGCTTCAAAGG - Intronic
976649353 4:87418571-87418593 ACAAAGATCACATGCTTCTGAGG - Intergenic
976649356 4:87418606-87418628 ACAAAGATCACATGCTTCAAAGG - Intergenic
976741793 4:88364208-88364230 ACAAAGATTACATGCTTCAGAGG + Intergenic
976741796 4:88364243-88364265 ACAAAGATCACATGCTTTTGAGG + Intergenic
976902668 4:90197947-90197969 ACAAAGAATAAATGCTTGAAGGG + Intronic
976971156 4:91104282-91104304 ACAAATATCACATGCTTCAAAGG - Intronic
976983082 4:91256424-91256446 ACAGAGATCACATGCTTCAAGGG - Intronic
977354368 4:95926705-95926727 ACAAAGTTCACATGCTTCAAAGG - Intergenic
977533635 4:98230422-98230444 ACAAAGAAGACCTGATTCAATGG + Intergenic
977548370 4:98412871-98412893 ACAAAGATCACGTGCTTTACAGG + Intronic
977720192 4:100230783-100230805 GAGTAGATCACATGCTTCAAAGG + Intergenic
977720195 4:100230818-100230840 ACAAAGATCACATGCTTCAAAGG + Intergenic
977927622 4:102718918-102718940 ACAAAGATCACATGCTTCAAAGG + Intronic
978023999 4:103849353-103849375 ACAAAGATCACATGCTTCTGAGG - Intergenic
978024003 4:103849406-103849428 ACAAAGATCACATGCTTCAAAGG - Intergenic
978193758 4:105946670-105946692 CGCAAGATCACATGCTTCAAAGG + Intronic
978193761 4:105946705-105946727 ACAAAGATCACATGCTTCTGAGG + Intronic
978467302 4:109022056-109022078 ACAAAGATCACATGCTTCAAGGG - Intronic
978505593 4:109453145-109453167 ACAGAGATCCCATGCTTTAAGGG + Intronic
978734796 4:112073587-112073609 ACAAGGATCACATACTTCAAAGG - Intergenic
978855311 4:113387636-113387658 ACTAAATTCACATGCTGCAAGGG + Intergenic
979027238 4:115592971-115592993 ACAAAGATCACATGCTTCTGAGG - Intergenic
979027242 4:115593006-115593028 CACAAGATCACATGCTTCAAAGG - Intergenic
979075124 4:116261219-116261241 ACAAAGATCACATGCTTCTGAGG - Intergenic
979075127 4:116261272-116261294 ACAAAGATCACATGCTTCAAAGG - Intergenic
979400583 4:120244924-120244946 ACAAAGATCACATGCTTCAAAGG + Intergenic
979400586 4:120244959-120244981 ACAAAGGTCACATGCTTCTGAGG + Intergenic
979458015 4:120948377-120948399 ACAGAGATCACATGCCTCAAGGG + Intergenic
979503580 4:121467848-121467870 ACAAAGATCACATGCTTTAAAGG + Intergenic
979661690 4:123263127-123263149 ACAGTGATCACATTTTTCAATGG - Intronic
979765615 4:124462012-124462034 ACAAAGATCACATGCTTCTGAGG - Intergenic
979765618 4:124462047-124462069 CCAAAGATCGCATGCTTCAAAGG - Intergenic
979793165 4:124812073-124812095 ACAAAGATCACATGCTTCAAAGG + Intergenic
979810850 4:125033965-125033987 ACAAAGATCACATGCTTCTGAGG - Intergenic
979810852 4:125034000-125034022 ACAAAGATCACATGTTTCAAAGG - Intergenic
979993859 4:127407884-127407906 ACAGAGATCACATGCTTCAAAGG - Intergenic
980046633 4:127996475-127996497 ACAAGGATCACATGCTTCAAAGG + Intronic
980073257 4:128265486-128265508 ACAGAGATCACATGCTTCAAAGG + Intergenic
980158167 4:129131738-129131760 ACAAAGATCACATGCTTCAAAGG - Intergenic
980180915 4:129399499-129399521 ACAAAGATCACATGCTTCAAAGG + Intergenic
980180918 4:129399534-129399556 ACAAAGATCACATGTTTTTGAGG + Intergenic
980298581 4:130957525-130957547 CACAAGATCACATGCTTCAAAGG + Intergenic
980298585 4:130957560-130957582 ACAAAGATCACATGCTTCTGAGG + Intergenic
980337600 4:131496225-131496247 ACAAAGGTCACATGCATCAAAGG + Intergenic
980473360 4:133277898-133277920 ACAAAGATCACGTGCTTCTGAGG + Intergenic
980486632 4:133465417-133465439 AAACAAATCAAATGCTTCAAAGG + Intergenic
980539280 4:134172366-134172388 TCAAAGATCACATGTTTGTAGGG - Intergenic
980574913 4:134673336-134673358 ACAAAGATATCATGCTACAAAGG - Intergenic
980577233 4:134699125-134699147 GCAGAGATCACATGCTTCAAAGG - Intergenic
980600487 4:135018592-135018614 ACAAAGATCACATGCTTCAAAGG + Intergenic
980600493 4:135018645-135018667 ACAAAGATCACATGCTTCTGAGG + Intergenic
980782130 4:137504627-137504649 ATTCAGATCACATTCTTCAAAGG + Intergenic
980796389 4:137689317-137689339 ACAAAGCTCACTTTCTTCAGTGG + Intergenic
980853160 4:138408250-138408272 AAATAGATCACCTGTTTCAATGG - Intergenic
980954535 4:139415010-139415032 ACAAAGATCACATGCTTCTGAGG - Intronic
980954537 4:139415045-139415067 ACAAAGATCACATGCTTCAAAGG - Intronic
980978365 4:139632932-139632954 AACAAGATCACATGCTTCTGAGG - Intergenic
980978368 4:139632966-139632988 CACAAGATCACATGCTTCAAAGG - Intergenic
980979090 4:139638793-139638815 CACAAGATTACATGCTTCAAAGG - Intergenic
981190401 4:141855849-141855871 ACAAGGATCACATGCTTCAAAGG - Intergenic
981401182 4:144315212-144315234 AAATAGATCACATGCTTCAAAGG + Intergenic
981424520 4:144587823-144587845 ACAAGGATCACATGCTTCAAAGG + Intergenic
981424523 4:144587859-144587881 ACAAAGTTCATATGCTTCTGAGG + Intergenic
981754195 4:148123415-148123437 ACAAAGATCACATGCTTCTGAGG - Intronic
981754200 4:148123468-148123490 ACAAAGATCACATGCTTCAAAGG - Intronic
981773061 4:148332717-148332739 ACAAAGAGCACATGGTGCAATGG + Intronic
982322817 4:154097403-154097425 TGAAAGACCACATTCTTCAAGGG - Intergenic
982479407 4:155891046-155891068 TCAAAGATCACATGCTTCAAAGG + Intronic
982480105 4:155898325-155898347 ACAAAGATCACATGCTTCAAAGG + Intronic
982480110 4:155898378-155898400 ACAAAGATCACATGCTTCTGAGG + Intronic
982513637 4:156317157-156317179 ACAAAGATCACATGTTTCAAAGG + Intergenic
982727481 4:158920811-158920833 ACAAAGATCACATGCTTCTGAGG - Intronic
982727483 4:158920846-158920868 ACAAAGATCACATGCTTCAAAGG - Intronic
982887335 4:160798096-160798118 ACAAAGATCACATGCTTCAAAGG + Intergenic
982887339 4:160798131-160798153 ACAAAGATCACATGCTTCTGAGG + Intergenic
983032269 4:162817778-162817800 CACAAGATCACATGCTTCAAAGG - Intergenic
983189626 4:164741155-164741177 ACAAATATCACATGCTTCAAAGG - Intergenic
983190955 4:164752963-164752985 ACAAAGATCACATGCTTATGAGG - Intergenic
983190957 4:164752998-164753020 GAAAAGATCACATGCTTCAAAGG - Intergenic
983191694 4:164760961-164760983 ACAAAGATCTCATGCATCCTTGG - Intergenic
983303395 4:165956052-165956074 ACAAAGATCACATGCTTCAAAGG + Intronic
983303397 4:165956087-165956109 ACAAAGATCACATGCTTCTGAGG + Intronic
983304340 4:165966747-165966769 ACAGAGATCACATGCCTCCAGGG + Intronic
983759497 4:171387469-171387491 AAAAAGATCACATGCTTGTGAGG + Intergenic
983863498 4:172735992-172736014 ACAGAGATCACATGCTTCAAAGG + Intronic
983884928 4:172970089-172970111 ACAAAGATCACATGCTTCAAAGG + Intronic
983884931 4:172970125-172970147 ACAAAGTTCACATGCTTCTAAGG + Intronic
984548068 4:181130260-181130282 ACAGAGATCACGTGCTTCAAAGG + Intergenic
984905936 4:184625835-184625857 ACAGAGATCACATGCTTCAAGGG + Intergenic
985037719 4:185857986-185858008 ACAGAGATCACATACTTCAAAGG - Intronic
985115059 4:186582488-186582510 ACAAAGATCACATGCTCCTGAGG - Intergenic
985115063 4:186582541-186582563 ACAAAGATCACATGCTTCAAAGG - Intergenic
985332302 4:188851613-188851635 ACAAAGATCACATGCTTCTGAGG - Intergenic
985362370 4:189189277-189189299 TCAAAGATCACATGCTTCAAAGG + Intergenic
985362374 4:189189330-189189352 ACAAAGATCACATGCTCCTGAGG + Intergenic
986950127 5:13072852-13072874 ACAAAGATCACATGCTTTAAAGG + Intergenic
987689772 5:21251866-21251888 ACAGAGATCACATGCTTCAAGGG - Intergenic
987800106 5:22684797-22684819 ACACAGATCACTTGAGTCAATGG + Intronic
987902570 5:24031654-24031676 ACAAAGATCACATGCTTCTGAGG - Intronic
987978239 5:25044105-25044127 ACAAAGATCACATGCTTCAAAGG + Intergenic
987978242 5:25044140-25044162 ACAAAGATCACATGCTTCTGAGG + Intergenic
988047002 5:25969419-25969441 AAAGGGATGACATGCTTCAAGGG - Intergenic
988092039 5:26555654-26555676 TCAAAGATCAAGTGCTCCAATGG - Intergenic
988396646 5:30704430-30704452 ACAAAGATCACATGCTTTAAGGG + Intergenic
988396649 5:30704465-30704487 ACAAAGATCACATGCTTCTTAGG + Intergenic
988720181 5:33869651-33869673 ACAGAGATCACATGCTTCAAAGG + Intronic
988723942 5:33906682-33906704 ACAAAGATCACATGCTTCTGAGG - Intergenic
988734873 5:34010295-34010317 ACAAAGATCACATGCTTCAAAGG + Intronic
988734875 5:34010331-34010353 ACAAAGATCACATGCTTCTGAGG + Intronic
989387122 5:40865156-40865178 ACAAAGATCACATGCTTCTGAGG - Intergenic
989387124 5:40865185-40865207 AGAAAGATCACATGCTTCAAAGG - Intergenic
989420296 5:41230656-41230678 ACAAGGATCATATGCTTCAAAGG - Intronic
989513893 5:42319547-42319569 ACAGAGATCACATGCTTCAAAGG + Intergenic
989828637 5:45889412-45889434 ACAGAGATCACATGCTTCAAGGG + Intergenic
989830766 5:45915505-45915527 ACAGAGATCACATGCTTCAAGGG + Intergenic
990046636 5:51440810-51440832 ACTAAGATCACATGCTTCTTGGG + Intergenic
990704574 5:58514117-58514139 ACAAAGATCACATGCTTTAAAGG - Intergenic
990748748 5:58988297-58988319 TCAAATATCACATGCCTCAAGGG + Intronic
991252462 5:64578734-64578756 ACACAGATCACATTCATCACAGG - Intronic
991264130 5:64696917-64696939 ACAAAGATCACAAGCGTCAAAGG - Intronic
991431056 5:66547550-66547572 ACAAAGAACAAATGCTTCAGGGG - Intergenic
991542593 5:67746216-67746238 ACAAAGATCACATGCTTCTGAGG + Intergenic
992205521 5:74427002-74427024 AAAAGGATCACATGGATCAAAGG - Intergenic
992820773 5:80493859-80493881 ACAAGGATCACATGCTTCAAAGG - Intronic
992984008 5:82208737-82208759 AAAAAGATCAAATGCTTTATTGG + Intronic
993172453 5:84436183-84436205 ACAAGGATCACATGCTTCAAAGG - Intergenic
993294428 5:86117080-86117102 ACAACGAACACATGCAGCAAAGG + Intergenic
993367215 5:87048977-87048999 ACAGAAATCACATGCTTCAAGGG + Intergenic
993411320 5:87576680-87576702 ACAGAGATCACTTGCTTCAAGGG - Intergenic
993427883 5:87792519-87792541 ATCAAAATCAAATGCTTCAAAGG - Intergenic
993533359 5:89050477-89050499 ACAAAGATCACATGCTTTTGAGG - Intergenic
993750354 5:91658217-91658239 ACAAAGACCACATGCTTTAAAGG - Intergenic
993834102 5:92795572-92795594 ACAAAGATCACATGCTTCAAAGG + Intergenic
994068735 5:95573841-95573863 ACAAAGGACAAATGCTTCGAGGG - Intronic
994355420 5:98788862-98788884 AACAAGAGCACATGTTTCAAAGG - Intronic
994386897 5:99143383-99143405 ACAAAGATCACATGCTTCAAAGG + Intergenic
994386901 5:99143436-99143458 ACAAAGATCACATGCTTCTGAGG + Intergenic
994615417 5:102098740-102098762 CACAAGATCACATGCTTCAAAGG + Intergenic
994615420 5:102098775-102098797 ACAAAGATCACATGCTTCTGAGG + Intergenic
994813035 5:104547293-104547315 ACAAGGATCACATGCTTCAAAGG - Intergenic
994875792 5:105419256-105419278 ACAAAGATCACATGCTTCAAAGG + Intergenic
994877019 5:105436831-105436853 ACAAAGATCTCATGCTTCAAAGG + Intergenic
994877021 5:105436884-105436906 ACAAAGATCACATGCTTCTGAGG + Intergenic
995019045 5:107346515-107346537 ACAGAGATCACATGCTTCAAAGG + Intergenic
995187390 5:109286548-109286570 ACAAAGATCACATGCTTCAAAGG + Intergenic
995187393 5:109286583-109286605 ACAAAGATCACGTGTTTCTGAGG + Intergenic
995974209 5:118011185-118011207 ACAAATAGCACATGCTTCTTTGG + Intergenic
996044187 5:118851482-118851504 ACAAAGATTACATGCTTCAAAGG + Intronic
996044189 5:118851514-118851536 ACAAAGATCACATGCTTCTGAGG + Intronic
996054982 5:118972866-118972888 ACAAAAACCACATGATTCTAAGG + Intronic
996097486 5:119414296-119414318 GAGTAGATCACATGCTTCAAAGG - Intergenic
996101625 5:119450714-119450736 ACAAACATCACATGCTTCAAAGG + Intergenic
996101627 5:119450749-119450771 ACAAAGATCATATGCTTCTGAGG + Intergenic
996146829 5:119987016-119987038 ACAGAGATCACATGCTTCATAGG + Intergenic
996517147 5:124383325-124383347 GAGTAGATCACATGCTTCAAAGG - Intergenic
996667218 5:126073616-126073638 ACAAAGATCACATGTTTTTGAGG - Intergenic
996667221 5:126073651-126073673 ACAAAGATCACATGCTTCAAAGG - Intergenic
997004179 5:129799290-129799312 ACAAAGATCACATGCTTCAAAGG + Intergenic
997115744 5:131124087-131124109 CACAAGATCACATGCTTCAAAGG - Intergenic
997313225 5:132908313-132908335 ACAAAAATATAATGCTTCAAAGG + Intronic
997491877 5:134284387-134284409 ACAAAGATCACATGCTTGAAAGG + Intergenic
997737022 5:136220701-136220723 ACAAAGATCATATGCCTCTGAGG - Intronic
997737023 5:136220727-136220749 CACAAGATCACATGCTTCAAAGG - Intronic
998487426 5:142515170-142515192 ACAGAGGTCACATGATTCACTGG + Intergenic
998647694 5:144081771-144081793 ACAAGGATCACATGCTTCAAAGG - Intergenic
998970014 5:147580829-147580851 ACAAAGATTACATGCTTCAAAGG - Intergenic
999412816 5:151367021-151367043 ACAAAGTTCACATGCTTCTGAGG + Intergenic
999457488 5:151729609-151729631 ACAAGGATCACATGCTTCAAAGG + Intergenic
1000018759 5:157301084-157301106 ACAAAGATCAAGTTCTTCCAAGG - Intronic
1000104101 5:158042358-158042380 ACAAACATCACATGAAGCAAAGG - Intergenic
1000237920 5:159379994-159380016 ACAAAGATCACATGCTTCAAAGG + Intergenic
1000400994 5:160827012-160827034 ACAAAGATCACGTGCTTCTGAGG - Intronic
1000691511 5:164327110-164327132 ACAAAGATCACATGCTTGAAAGG + Intergenic
1000735381 5:164893011-164893033 ACAGAGATTACATGCTTCAAGGG + Intergenic
1000880607 5:166692793-166692815 ACAAAGATCAGATGCTTCAGAGG + Intergenic
1000880610 5:166692828-166692850 ACAAAGATCACATGCTTCTGAGG + Intergenic
1001341661 5:170852172-170852194 ACATGGATCACATCATTCAAAGG - Intergenic
1002666448 5:180829165-180829187 ACAAAGATCACATGCTTCTGAGG - Intergenic
1002666454 5:180829214-180829236 ACAAAGATCACATGCCTCTGAGG - Intergenic
1002666460 5:180829263-180829285 ACAAAGATCACATGCCTCTGAGG - Intergenic
1002666465 5:180829312-180829334 ACAAAGATCACATGCTTCTGAGG - Intergenic
1002666468 5:180829347-180829369 ACAAAGATCATATGCTTCAAAGG - Intergenic
1003802006 6:9680725-9680747 ACAGAGATCACATGCTTCAAGGG + Intronic
1003923327 6:10854195-10854217 ACAAAGATCACATGCTTCTGAGG - Intronic
1003923328 6:10854230-10854252 ACAAAGATCACATGCTTCAAAGG - Intronic
1004086418 6:12453743-12453765 ACAAAGATCACATGCTTCAAAGG + Intergenic
1004230521 6:13829037-13829059 ACAAAGATCACATGCTTCAAAGG + Intergenic
1004230525 6:13829090-13829112 ACAAAGATCACATGCTTCTGAGG + Intergenic
1004672146 6:17807615-17807637 GCAAAGATCACATGCTTCTGAGG - Intronic
1004672148 6:17807668-17807690 ACAAAGATCACATGCTTCAAAGG - Intronic
1004935058 6:20499371-20499393 ACAAAGAGAACATGTTTAAATGG + Intergenic
1005374086 6:25164515-25164537 ACAAAGATCACATGCTTCTGAGG - Intergenic
1005985285 6:30869634-30869656 ACAAGGATCACATGCTTCGAAGG - Intergenic
1006041947 6:31263463-31263485 ACAAAGATCACATGCTTCTGAGG + Intergenic
1006286646 6:33101114-33101136 ACAGGGATCACATGCTTCAGAGG + Intergenic
1006292687 6:33152076-33152098 ACAAAGATCACATGCTTCAAAGG + Intergenic
1006400896 6:33816658-33816680 ACAAAGATCACATCCTGCAGAGG - Intergenic
1007022056 6:38530314-38530336 ACAAAGATCACATGCTTCTGAGG - Intronic
1007022060 6:38530367-38530389 ATAAAGATCACATGCTTCAAAGG - Intronic
1007038447 6:38699971-38699993 ACAAAGATCACATGCTTCAAAGG - Intronic
1007354028 6:41297314-41297336 ACAAGGATCACATGGTTCAAAGG + Intergenic
1008044985 6:46842685-46842707 ACAAAGATCACATGCTTCAAAGG - Intergenic
1008167213 6:48153040-48153062 ACAAAGATCACATGCTTCTGAGG - Intergenic
1008167218 6:48153074-48153096 ACAAAGATCACATGCTTCAAAGG - Intergenic
1008502780 6:52200020-52200042 ATAAAGATCGCATGCTTGAAAGG + Intergenic
1008860536 6:56143914-56143936 ACAAACATAACATGATTCATTGG - Intronic
1009039098 6:58156156-58156178 ACACAGATCACATGCTTCAAGGG - Intergenic
1009214991 6:60910995-60911017 ACAGAGATCACATGCTTCAAGGG - Intergenic
1009447275 6:63757516-63757538 ACAAAGATCACATGCTTCTGAGG - Intronic
1009720159 6:67458221-67458243 ACAAAGATCGCATGCTTCAAAGG + Intergenic
1009720161 6:67458256-67458278 ACAATGATCACATGATTCTGAGG + Intergenic
1009766620 6:68085583-68085605 ACAGGGATCACATGCTTCAGAGG + Intergenic
1009789678 6:68385720-68385742 GCAAAGATCACATGCTTCTGAGG - Intergenic
1009789681 6:68385755-68385777 ACAAAGATCACATGCTTCAAAGG - Intergenic
1010224929 6:73480075-73480097 AAAATGATCACATGCATCAGAGG + Exonic
1010368413 6:75079516-75079538 ACAATGATAACCTGCTTCAGTGG - Intergenic
1010465074 6:76158217-76158239 ACAAAGATCACATGCTTCAAAGG - Intergenic
1010492946 6:76495846-76495868 ACAGAGATCACATGCTTCAACGG + Intergenic
1010520252 6:76823675-76823697 ACAAAGATCACATGCTTCAAAGG + Intergenic
1010545772 6:77153696-77153718 ACAAAGAATAAATGCTTGAAAGG - Intergenic
1010796502 6:80122650-80122672 ACAAAGATCACATGCTTCAAAGG + Intronic
1010803870 6:80211993-80212015 ACAAAGAGCACATGCTTCTGAGG + Intronic
1010810616 6:80294912-80294934 ACAAAGATCACATGCTTCTGAGG - Intronic
1010816585 6:80365048-80365070 ATGAAGATCACATGCTTCAAAGG + Intergenic
1010816589 6:80365101-80365123 ACAAAGATCACATGCTTCTGAGG + Intergenic
1010902631 6:81446327-81446349 ACAAAGAACACATCCTTCTTAGG - Intergenic
1010960205 6:82137091-82137113 CCAAAGATCACATGAGACAATGG - Intergenic
1011314752 6:86018941-86018963 ACAAAGATCACATGCTTCTGAGG - Intergenic
1011357680 6:86489444-86489466 ACAGAGATCACTTGCTTCAAAGG - Intergenic
1011586550 6:88932422-88932444 ACAGGGATCACATGCTTCATAGG - Intronic
1011590847 6:88969326-88969348 ACAAAGATCACATGCTTCAAAGG + Intergenic
1011608570 6:89128566-89128588 ACAAAGATCACATGCTTCTGAGG - Intergenic
1011608572 6:89128601-89128623 ACAAAGATCACATGCTTCAAAGG - Intergenic
1011681040 6:89783605-89783627 ACAAAGATCACATGCTTCAAAGG - Intronic
1012138123 6:95584622-95584644 ACAAAGATCACATGCTTCTGGGG - Intronic
1012138128 6:95584657-95584679 CACAAGATCACATACTTCAAAGG - Intronic
1012168593 6:95990179-95990201 GCAAAGATCACATGCTTCTGAGG - Intergenic
1012380730 6:98616331-98616353 ACAGAAATCACATGCTTCAAGGG + Intergenic
1012503836 6:99921593-99921615 ACAAAGTATAAATGCTTCAAGGG - Intronic
1012607093 6:101170883-101170905 ACAAAGATCACATGCTTCAAAGG + Intergenic
1012682288 6:102197133-102197155 ACAAAAATCACATGCTTCATAGG + Intergenic
1012704419 6:102503249-102503271 CACAAGATCACATGCTTCAAAGG + Intergenic
1012704422 6:102503283-102503305 ACAAAGATCACATGCTTCTGAGG + Intergenic
1012737331 6:102965794-102965816 AGAAAAATCACATGGGTCAAAGG + Intergenic
1012746213 6:103092774-103092796 ACAAAGATCACATGCTTCTGAGG - Intergenic
1012746217 6:103092827-103092849 ACAAAGATCACATGCTTCAAAGG - Intergenic
1013500295 6:110742894-110742916 ACAAAGATCACATGCTTCAAAGG - Intronic
1013664085 6:112328788-112328810 GCAGATATCACATGCTTCATAGG + Intergenic
1013855269 6:114564759-114564781 ACAAAGATCACATGCTTGAAAGG - Intergenic
1013920929 6:115402640-115402662 ACAAAGATCACATGCTTCTGAGG + Intergenic
1013927725 6:115493342-115493364 ACAGAGATCACATGCTTGAAGGG + Intergenic
1014320701 6:119924850-119924872 CACAAGATCACATGCTTCAAAGG + Intergenic
1014352169 6:120358970-120358992 ACAGAGATCACATGCTTCAAAGG - Intergenic
1014469534 6:121798028-121798050 ACAGAGATCACATGCTTCAAGGG - Intergenic
1014559151 6:122869818-122869840 ACAAAGATTAAATGCTTAAGTGG - Intergenic
1015341833 6:132109701-132109723 ACAGAGATCACATGCTTCAAAGG + Intergenic
1015378191 6:132534684-132534706 ACAAAGATCACATGCTTTTGAGG - Intergenic
1015378193 6:132534719-132534741 ACAAAGATCACATGCTTCAAAGG - Intergenic
1015820429 6:137254793-137254815 ACAAAGATCATATGCTTCTAAGG - Intergenic
1016305124 6:142676023-142676045 AAAAAGATCAACTGCTTCACAGG - Intergenic
1016534809 6:145098049-145098071 ACAAAGATCACATGCTTCAAAGG + Intergenic
1016534811 6:145098084-145098106 ACAAAAATCACATGATTCTGAGG + Intergenic
1016855517 6:148666540-148666562 ACAAAGGTCACATGCTTCTGAGG - Intergenic
1016865770 6:148764727-148764749 ACAGAGATCACATGCTTCAAGGG + Intronic
1017177546 6:151518869-151518891 ACAAAGATCACATGCTTCAGAGG + Intronic
1017849939 6:158296500-158296522 ACAAAGATCACATGCTTCAAAGG + Intronic
1017849943 6:158296553-158296575 ACAAAGATCACATGCTTCTGAGG + Intronic
1017849987 6:158296835-158296857 GAAAAGATTACATGCTTTAAGGG + Intronic
1017849989 6:158296871-158296893 GCAAAGATCACATGCTTCTGAGG + Intronic
1017850755 6:158303446-158303468 ACAAAGATCACATGCTTCAAAGG + Intronic
1017850759 6:158303499-158303521 ATAAAGATCACATGCTTCTCAGG + Intronic
1017854603 6:158339287-158339309 ACAGAGATCACATGCTTCAAGGG + Intronic
1017855304 6:158345616-158345638 ACAAAGATCACATACTTCAAAGG + Intronic
1018102131 6:160449914-160449936 ACAAAGATCACATGCTTCAAAGG + Intronic
1018139926 6:160821115-160821137 AAAAAGACCACATGCTTCTGAGG - Intergenic
1018139929 6:160821150-160821172 CACAAGATCACATGCTTCAAAGG - Intergenic
1019072059 6:169354878-169354900 ACAAAGATCACATGCTTCAAAGG + Intergenic
1019072063 6:169354931-169354953 ACGAAGATCACATGCTTCTGAGG + Intergenic
1019853040 7:3578318-3578340 ACAAAGATCACATGCTTCAAAGG + Intronic
1019853043 7:3578353-3578375 ACTAAGATCACGTGCTTCTGCGG + Intronic
1019986337 7:4658988-4659010 AGAAATATCCCATTCTTCAAGGG - Intergenic
1020329017 7:6999504-6999526 ACAAAGATCACGTGCTTCTGAGG - Intergenic
1020603610 7:10307320-10307342 ACAGAGATCACATGCTTCAAGGG - Intergenic
1020788972 7:12602280-12602302 ACAAAGATCACATGCTTCAAAGG + Intronic
1020788975 7:12602315-12602337 ACAAAGATCACATGCTTCTGAGG + Intronic
1021020065 7:15586917-15586939 ACAGAGAACACATGCTTCAAGGG + Intergenic
1021109635 7:16678916-16678938 ACAGAGATCACATGCTTCAAAGG + Intronic
1021176769 7:17458759-17458781 ACAAAGATCACATGCTTCAAAGG + Intergenic
1021176772 7:17458794-17458816 ACAAAGATCCCATGCTTCTGAGG + Intergenic
1021283659 7:18752218-18752240 ACACAGATCACTTGCCTCCATGG - Intronic
1021738191 7:23659633-23659655 ACAAAGATAACATTCTGGAATGG - Intergenic
1022686742 7:32604095-32604117 ACAGAGATCACATGCTTCAAGGG + Intergenic
1023074105 7:36466234-36466256 ACAAAGATCACATGCTTCTGAGG - Intergenic
1023603844 7:41909164-41909186 ACGAAGATCACATGCTTCGAAGG + Intergenic
1023668883 7:42555362-42555384 ACAGAGATCACATGCTTCACAGG - Intergenic
1024403281 7:48949142-48949164 CACAAGATTACATGCTTCAAAGG + Intergenic
1024408802 7:49014848-49014870 ACAGAGATCACATGCTTCAAGGG + Intergenic
1024552051 7:50570677-50570699 ACAAAAATCACATGCTTCATAGG - Intergenic
1024553524 7:50583703-50583725 ACAGAGATCACATGCTTCATAGG - Intergenic
1024694889 7:51845840-51845862 ACAAAGATCACATGCTTCTGAGG - Intergenic
1024694894 7:51845893-51845915 ACAAAGATCACATGCTTCAAAGG - Intergenic
1024756652 7:52541317-52541339 ACAGAGATCACATGCTTCAAAGG + Intergenic
1024773459 7:52754160-52754182 ACAAAGATCACATGCTTCATAGG + Intergenic
1024773462 7:52754195-52754217 ACAAAGATCACATGCTTCTGAGG + Intergenic
1024801532 7:53085789-53085811 ACAAAGATCACATGCTTCAAAGG + Intergenic
1024801535 7:53085824-53085846 ACAAAGATCACATGCTTCTGAGG + Intergenic
1024891938 7:54213178-54213200 ACAGAGATCACATGCTTCAAGGG + Intergenic
1024946160 7:54809322-54809344 ACAGAGATCACATGGTTCAAGGG - Intergenic
1025060398 7:55800851-55800873 ACAAAGGACAAATGCTTGAAGGG + Intronic
1025108898 7:56196235-56196257 ACAAGGATCACATGCTTCAACGG + Intergenic
1025246960 7:57324799-57324821 ACAGAGATCACATGCTTCAAGGG - Intergenic
1025599463 7:62977247-62977269 ACAGAAATCACATGCTTCAAAGG - Intergenic
1025722945 7:64032925-64032947 ACAAAGATCACATTCTTCAAGGG + Intronic
1025755281 7:64332423-64332445 ACAAAGATCACATGCTTCAAAGG + Intronic
1025755283 7:64332458-64332480 ACGAAGATCACATGCTTCTGAGG + Intronic
1025870156 7:65423713-65423735 GCAGAGACAACATGCTTCAAGGG - Intergenic
1027291461 7:76716465-76716487 ACAAAGATCACATGCTTTAAAGG + Intergenic
1027342015 7:77219850-77219872 ACAGAGATCACATGCTTCAAAGG + Intronic
1027566620 7:79802425-79802447 ACAAAGATCACATGCTTCTGAGG - Intergenic
1027566624 7:79802460-79802482 ACAAAGATCACATGCTTCAAAGG - Intergenic
1027859118 7:83552957-83552979 ACAAAGATCACATGCTTCTGAGG - Intronic
1027859120 7:83553010-83553032 ACAAAGATCACATGCTTCAAAGG - Intronic
1028191509 7:87858297-87858319 ACAAAAATCACATGCTTCTGAGG - Intronic
1028191512 7:87858332-87858354 CACAAGATCACATGCTTCAAAGG - Intronic
1028330410 7:89583997-89584019 ACAGGGATCACATGCTTCAGAGG + Intergenic
1028331559 7:89601035-89601057 ACAAAGATCACATGCTTCTGAGG + Intergenic
1028439153 7:90838903-90838925 ACAGAGATCACATGTTTCAAAGG - Intronic
1028450221 7:90973779-90973801 ACAGAGATCACATGCTTCAAAGG + Intronic
1028579437 7:92391123-92391145 AAAAAAATCACAGGCTTCATAGG - Intronic
1028584867 7:92442803-92442825 TCAAAGATCACATGCTTCAAAGG + Intergenic
1029008571 7:97234626-97234648 ACAAAGATCACATGCTTCTGAGG - Intergenic
1029008575 7:97234679-97234701 ACAAAGATCACATGCTTCAAAGG - Intergenic
1030298115 7:107948846-107948868 ACAAAGATCACATGGCTTTATGG - Intronic
1030411200 7:109182445-109182467 ACAGAGATCACATGCTTCCTAGG + Intergenic
1030444525 7:109632746-109632768 CACAAGATCACATGCTTCAAAGG + Intergenic
1030444529 7:109632781-109632803 ACAAAGATCACAGGCTTCTGAGG + Intergenic
1030497759 7:110320790-110320812 ACAAAGATCCCATGCTTCTGAGG - Intergenic
1030497764 7:110320843-110320865 ACAAAGATCACATGCTTCAAAGG - Intergenic
1030763734 7:113383192-113383214 CCAAAGTTCACATGCTTAACTGG + Intergenic
1031304588 7:120110509-120110531 ACAAAGATCACATGCTTCCAAGG - Intergenic
1031416030 7:121497499-121497521 ACAAAGATCACATGCTTCAAAGG + Intergenic
1031513925 7:122679570-122679592 ACAGAGATCACATGCTTTAAGGG - Intronic
1031763013 7:125737748-125737770 ACAAGGATCACATGCTTCAAAGG + Intergenic
1031978644 7:128109728-128109750 GAGTAGATCACATGCTTCAAAGG + Intergenic
1031996986 7:128239494-128239516 GAGTAGATCACATGCTTCAAAGG - Intergenic
1032003272 7:128280376-128280398 GCAAAGATCACATGCTTCTGAGG + Intergenic
1032005379 7:128298209-128298231 ACAAAGATCACATGCTTCTGAGG - Exonic
1032005381 7:128298243-128298265 ACAAAGATCACATGCTTCAAAGG - Exonic
1033627303 7:143122934-143122956 ACAAAGATCACATGCTTTAAAGG + Intergenic
1033677062 7:143553159-143553181 ACAGAGATCACATGCTTTAAGGG + Intergenic
1033694773 7:143776278-143776300 ACAGAGATCACATGCTTTAAGGG - Intergenic
1033716738 7:144010206-144010228 ACAAAGATCACATGCTTCAAAGG + Intergenic
1033716741 7:144010241-144010263 ACAAAGATCACACACTTCTGAGG + Intergenic
1034102561 7:148462994-148463016 ACAAAGATCACATGCTTCAAAGG - Intergenic
1034251790 7:149698139-149698161 ACAAAGATCACATGCTTCAAAGG - Intergenic
1034367046 7:150560187-150560209 ACAAAGATCACATGCTTCTGAGG - Intergenic
1034367050 7:150560240-150560262 ACAAAGATCACATGCTTCAAAGG - Intergenic
1035135258 7:156697207-156697229 ACAAAGATCACATGCTTCAAAGG + Intronic
1035135261 7:156697260-156697282 ACAAAGATCACATGCTTCTGAGG + Intronic
1035342594 7:158173467-158173489 ACAGGGATCACATGCTTCAGAGG + Intronic
1035572821 8:684868-684890 ACAGAGATCACATGCTTCACGGG + Intronic
1036118399 8:5986774-5986796 ACAAGGATCACATGCTTCAGAGG + Intergenic
1036249835 8:7152368-7152390 ACAAAGATCACGTGCTTCTGAGG - Intergenic
1036249839 8:7152421-7152443 ACAAAGGTCACATGCTTCAAAGG - Intergenic
1036495934 8:9269923-9269945 ACAGAGATCACATGCTTCAAGGG + Intergenic
1036728510 8:11241525-11241547 ACAAAGATCACATGCTTCTGAGG - Intergenic
1036728512 8:11241560-11241582 ACAAAGATCACATGCTTCAAAGG - Intergenic
1037063418 8:14544872-14544894 ATAAAGATCACATGCTTCTGAGG - Intronic
1037063423 8:14544925-14544947 ACAAAGATCACATGCTTCAAAGG - Intronic
1037136922 8:15473726-15473748 CACAAGATCACATGCTTCAAAGG + Intronic
1037136924 8:15473761-15473783 ACAAAGATCACATGCTTCTGAGG + Intronic
1037204276 8:16295023-16295045 ACAGAGATCACATGCTTCAAGGG - Intronic
1037312703 8:17573620-17573642 ACAAAGATCACGTGCTTCTGAGG - Intergenic
1037312705 8:17573655-17573677 ACAAAGATGACACGCTTCAAAGG - Intergenic
1037327153 8:17703855-17703877 GCAAAGATTACATGCTTCTGAGG - Intronic
1037327157 8:17703890-17703912 ACAAAGATCACATGCCTCAAAGG - Intronic
1037555814 8:20021204-20021226 ACAAAGATCACATGCTTCAAAGG + Intergenic
1038197181 8:25379048-25379070 GCAAAGATCACATGCTTCTGAGG + Intronic
1038689169 8:29745806-29745828 ACAAAGATCACTTTCTTGGAAGG - Intergenic
1038840350 8:31179147-31179169 ACACAGATCTCATGCTTAAGAGG + Intergenic
1038931930 8:32203004-32203026 ACAAAGATCAAACACATCAATGG - Intronic
1039111364 8:34043824-34043846 ACAGAGATCACATGCCTCAAGGG + Intergenic
1039183095 8:34888268-34888290 ACAAAGATCACATGCTTCAAAGG + Intergenic
1039183098 8:34888303-34888325 ACAAAGAACACATGCTTCTGAGG + Intergenic
1039185426 8:34910463-34910485 ACAAAGACCACATGCTTCAAAGG + Intergenic
1039185431 8:34910516-34910538 ACAAAGATCACATGCTTCTGAGG + Intergenic
1039501660 8:38022397-38022419 CATAAGATCACATGCTTCAAAGG + Intergenic
1039580410 8:38661616-38661638 ACAAAGATCACATGCTTCTGAGG - Intergenic
1039598463 8:38812260-38812282 ACAAAGATCACATGCTTCTGAGG - Intronic
1039669344 8:39579149-39579171 ACAAAGATCACATGCTTCTGAGG - Intergenic
1039669346 8:39579184-39579206 ACAAAGATCACATGATTCAAAGG - Intergenic
1039691201 8:39866615-39866637 ACAAAGATCACATGCTTCTGAGG + Intergenic
1040091643 8:43404751-43404773 ACAGAGATCACATGCTTCAAGGG - Intergenic
1040139418 8:43893371-43893393 ACAGAGATCACACGCTTCAAGGG - Intergenic
1040140052 8:43899111-43899133 ACAGAGATCACATGCTTCAAGGG - Intergenic
1040426022 8:47287170-47287192 ACAAAGATCACATGCTTCAAAGG + Intronic
1040426025 8:47287205-47287227 ACAAAGATCACATGCTTCTGAGG + Intronic
1040489866 8:47909973-47909995 ACAAAGATCACGTGCTTCAGAGG - Intronic
1040499414 8:47993722-47993744 ACAAAGATCACGTGCTTCAGAGG + Intergenic
1040583807 8:48720666-48720688 ACAAAGATCACCTGCTTCTGAGG - Intronic
1040583811 8:48720719-48720741 TACAAAATCACATGCTTCAAAGG - Intronic
1040795919 8:51289933-51289955 ACAAAGATCACATGCTTCTGAGG + Intergenic
1040823089 8:51586586-51586608 TTAAAGGTCACATTCTTCAATGG + Intronic
1040842688 8:51801417-51801439 ACAAAGATCACAAGCTTTAAAGG - Intronic
1040926417 8:52688638-52688660 ACAAAGATCACATGCTTCTGAGG - Intronic
1040926418 8:52688688-52688710 TACAAGATCACATGCTTCAAAGG - Intronic
1041010593 8:53538831-53538853 ACAAAGATCACATGCTTCAGAGG - Intergenic
1041210474 8:55545469-55545491 ACAGAGATCACGTGCTTCAAAGG - Intergenic
1041414989 8:57598030-57598052 ACAGAGATCGCATGCTTCAAAGG - Intergenic
1041527886 8:58828637-58828659 ACACAGATCACACTGTTCAAAGG - Intronic
1041860112 8:62503358-62503380 GCAAAGATCACATGCTTCTGAGG + Intronic
1041907761 8:63052463-63052485 ACAAAGATCATATGCTTCAAAGG - Intronic
1041941602 8:63394124-63394146 ACAAAGATCAGAAGTTTCTAGGG - Intergenic
1042190559 8:66181657-66181679 CCAAAGATCACTTTTTTCAAAGG - Intergenic
1042191369 8:66190904-66190926 ACAAAGATCATGTGCTTCAAAGG + Intergenic
1042191370 8:66190939-66190961 ACAAAGATCACATGCTTCTGAGG + Intergenic
1042191918 8:66195608-66195630 ACAAAGATCACATGCTTCAAAGG + Intergenic
1042197741 8:66247658-66247680 GAGTAGATCACATGCTTCAAAGG - Intergenic
1042197847 8:66248646-66248668 GAGTAGATCACATGCTTCAAAGG - Intergenic
1042197989 8:66249881-66249903 GAGTAGATCACATGCTTCAAAGG - Intergenic
1042355585 8:67824127-67824149 ACAGAGATCACATGCTTCATGGG + Intergenic
1042428839 8:68680612-68680634 ACAAAGATCACATACTTCTGAGG + Intronic
1042671717 8:71271255-71271277 ACAAAGGACAAATGCTTGAAGGG - Intronic
1042881488 8:73497006-73497028 TCATAGATCAAATGCTTCCATGG + Intronic
1042934129 8:74041855-74041877 ACAAAGATCACATGCTTCTGAGG - Intergenic
1042934131 8:74041887-74041909 CACAAGATCACATGCTTCAAAGG - Intergenic
1042991781 8:74648488-74648510 ACAAAGATCACATGCTTCAAGGG - Intronic
1043058636 8:75472376-75472398 ACAAAGTTTACAGGATTCAATGG - Intronic
1043144935 8:76641430-76641452 ACAAAGATCACATGCATCAAAGG + Intergenic
1043145587 8:76649442-76649464 ACAAAGAACAAATGCTTGAGGGG + Intergenic
1043281376 8:78471014-78471036 ACAAAGATCACATGCTTCAAAGG - Intergenic
1043324445 8:79033415-79033437 ACAGAGATCACACGCTTCAAGGG - Intergenic
1043369213 8:79571674-79571696 ACAAAGAGCAAAGGCTACAAAGG - Intergenic
1043750824 8:83931510-83931532 ACAAAGATCACATGCTTCTGAGG - Intergenic
1043750826 8:83931545-83931567 CACAAGATCACATGCTTCAAAGG - Intergenic
1043861597 8:85323767-85323789 ACAAAGATCACATGCTTCTGAGG + Intergenic
1043946936 8:86263925-86263947 ACCAAGAGCACATTCTTGAAAGG - Intronic
1044003434 8:86913635-86913657 ACAGAGATCACATGCTTCAAGGG + Intronic
1044039071 8:87342762-87342784 ACAAGGATCACATGCTTCAAAGG + Intronic
1044070250 8:87751482-87751504 ACAAGGATCACATGCTTCAAAGG + Intergenic
1044170378 8:89043821-89043843 ACAGAGATCACATGCTTCAAGGG - Intergenic
1044182330 8:89211346-89211368 ACAAAGATCACATGCTTCTGAGG - Intergenic
1044182335 8:89211398-89211420 ACAAAGATCACACACTTCAAAGG - Intergenic
1044307779 8:90657479-90657501 ACAAAGATCACATGCTTCTGGGG + Intronic
1044318605 8:90777228-90777250 ATAAAGATCACATGCTTCGAAGG + Intronic
1044318607 8:90777263-90777285 ACAAAGATGACATGCTTCTGAGG + Intronic
1044769523 8:95616292-95616314 ACAAATCTCACATGAATCAATGG - Intergenic
1045148658 8:99377838-99377860 ACAGAGATCACATGGTTCAAGGG + Intronic
1045593507 8:103626857-103626879 ACAAGGATCACATGCTTCAAAGG + Intronic
1045729294 8:105216719-105216741 ACAAATATCACATGCTTCAAAGG - Intronic
1045823177 8:106365869-106365891 ACATAAATCACATCCTTGAAAGG + Intronic
1045862601 8:106829909-106829931 TCTTAGATCACATGCTTCTATGG + Intergenic
1046187879 8:110746712-110746734 ACAGAGATCACATGCTTCAAGGG - Intergenic
1046191299 8:110798481-110798503 ACAGAGATCACATGCTTCAAAGG + Intergenic
1046253541 8:111666083-111666105 ACAAAGATCACACGCTTCAAAGG + Intergenic
1046253544 8:111666118-111666140 ACAAAGATCATATGCTTCTAAGG + Intergenic
1046342692 8:112879511-112879533 ACAGAGATCACATGCTTCAAAGG - Intronic
1046432493 8:114146823-114146845 ATAAAAATGTCATGCTTCAAAGG - Intergenic
1046494590 8:114997106-114997128 ACAAAGATCACATGCTTCTGAGG - Intergenic
1046749803 8:117914902-117914924 ATAAAGATCACATGCTTCTGAGG - Intronic
1046749806 8:117914955-117914977 ACAAAGATCACATGCTTCAAAGG - Intronic
1047661968 8:127047111-127047133 ACAAAGATCACATGCTTCTGAGG - Intergenic
1047661971 8:127047164-127047186 ACGAAGATCACATGCTTCAAAGG - Intergenic
1047922243 8:129647206-129647228 ACAAAGATCACATGCTTCTGAGG + Intergenic
1048081658 8:131134809-131134831 ACAAAGATCACATGCTTCAAAGG + Intergenic
1048081661 8:131134844-131134866 ACAAAGATCACATGCTTCTGAGG + Intergenic
1048239170 8:132724057-132724079 ACAAAGATCACATGCTTCAAAGG + Intronic
1048239173 8:132724092-132724114 ACAAAGATCACATGCTTCTGAGG + Intronic
1048602138 8:135929808-135929830 ACAAAGATCACATGCTTCAAAGG + Intergenic
1048602141 8:135929843-135929865 ACAAAGATCACATGCTTCTGAGG + Intergenic
1050394514 9:5180837-5180859 ACAAAGATGACATGCTTCTGAGG - Intronic
1051375133 9:16394774-16394796 ACAAAGATCGCATGCTTCTGAGG - Intergenic
1051375137 9:16394827-16394849 ACAAAGATCACATGCTTCAAAGG - Intergenic
1051658306 9:19403652-19403674 ACAAAGATCACATGCTTCTGAGG - Intergenic
1052061121 9:23962498-23962520 ACAAAGATCACATGCTTGAAAGG - Intergenic
1052456088 9:28700042-28700064 ACAAAGATCACATGCTTCAAAGG - Intergenic
1052687164 9:31771369-31771391 ACAAAGATCACATGCTTCTGAGG - Intergenic
1052687167 9:31771404-31771426 CACGAGATCACATGCTTCAAAGG - Intergenic
1052864294 9:33455745-33455767 ACAAAGCTCACAGGCTTCCTAGG + Intergenic
1053206396 9:36190188-36190210 TTAAGGATCACTTGCTTCAAAGG - Intergenic
1053652582 9:40184078-40184100 ACAAAGATCACATGCTTCAAAGG + Intergenic
1053902982 9:42813385-42813407 ACAAAGATCACATGCTTCAAAGG + Intergenic
1054532000 9:66192143-66192165 ACAAAGATCACATGCTTCAAAGG - Intergenic
1055451490 9:76435106-76435128 ACAAAGATCACATGGTTCTGAGG - Intronic
1055451495 9:76435141-76435163 ACAAAGATCACATGCTTCAAAGG - Intronic
1055622642 9:78142491-78142513 ACAAAGATCGCATGCTTCTGAGG - Intergenic
1055908021 9:81316195-81316217 ACAGAGATCACAAGCTTCACAGG + Intergenic
1056082748 9:83113882-83113904 ACAAGGATCACATGCTTCAAAGG - Intergenic
1056176567 9:84042268-84042290 ACAGAGATCACATGCTTTAAGGG - Intergenic
1056214974 9:84398102-84398124 ACAAAGATCAACAGCTTGAAGGG - Intergenic
1056484073 9:87036452-87036474 ACAAAGATGACATGCATGTAAGG - Intergenic
1057100566 9:92354963-92354985 ACAAAGATCACATGCTTCCAAGG + Intronic
1057370885 9:94471996-94472018 ACAGAGATCACATGCTTCAAGGG + Intergenic
1058137887 9:101327496-101327518 ATAAAGATCACATGCTTCAAAGG + Intergenic
1058137890 9:101327549-101327571 ACAAAGATCACATGCTTCTGAGG + Intergenic
1058143635 9:101385080-101385102 ACAAAGATCACATGCTTCAAAGG + Intergenic
1058143639 9:101385114-101385136 AACAAGATCACATGCTTCTGAGG + Intergenic
1058225482 9:102356397-102356419 ACAAAGATCACATGCTTTAAAGG - Intergenic
1058252231 9:102713348-102713370 ACAAAAACCATATGCTTCAAAGG - Intergenic
1058253234 9:102728914-102728936 ACAGAGGTCACGTGCTTCAAAGG + Intergenic
1058533786 9:105933795-105933817 ACAAAGATCACATGCTTCAAAGG - Intergenic
1058542901 9:106030518-106030540 ACAAAGATCACATGCTTCTGAGG - Intergenic
1058542905 9:106030571-106030593 ACAAAGATCACATGCTTCAAAGG - Intergenic
1058549076 9:106093899-106093921 ACAGAGATCACATGCTTCACGGG - Intergenic
1059094854 9:111401418-111401440 ACAAAGATCACATGCTTCAAAGG + Intronic
1059105964 9:111511901-111511923 ACAAAGATCACATGCTTCAAGGG - Intergenic
1059112250 9:111568541-111568563 ACAAAGATCACATGCTTCTGAGG - Intronic
1059112253 9:111568576-111568598 ACAAAGATCACATGCTTCAAAGG - Intronic
1059198365 9:112392178-112392200 ACAAAGATCACATGCTTCAAAGG + Intronic
1059198370 9:112392231-112392253 ACAAAGATCACATGCTTCTGAGG + Intronic
1059199294 9:112399315-112399337 ACAAAGATCACATGCTTCAAAGG + Intronic
1059523151 9:114962778-114962800 GAGTAGATCACATGCTTCAAAGG + Intergenic
1059523153 9:114962813-114962835 ACAAAGATCACATGCTTCTGAGG + Intergenic
1059580856 9:115546857-115546879 ACAAAGATCACATGCTTCAAAGG + Intergenic
1059580860 9:115546889-115546911 AGAAAGATCACATGCTTCTGAGG + Intergenic
1060015797 9:120085166-120085188 ACAAAGATCACATGCTTCTAAGG + Intergenic
1061394450 9:130336373-130336395 ACAAAGGTCAGCTGCTTCCATGG - Intronic
1061530937 9:131212352-131212374 ACAGAGATCACATGCTTCAAGGG - Intronic
1062728293 9:138092031-138092053 ACAAAGAGCACATGCTTCAAAGG + Intronic
1203517703 Un_GL000213v1:18529-18551 ACGAAGATCACATGCTTTAAAGG + Intergenic
1203747593 Un_GL000218v1:51627-51649 ACAAAGGAAACATGCTTAAAGGG - Intergenic
1203486867 Un_GL000224v1:64217-64239 ATAAGGATCACATGCTTCAAAGG + Intergenic
1203499487 Un_KI270741v1:6117-6139 ATAAGGATCACATGCTTCAAAGG + Intergenic
1203562148 Un_KI270744v1:66355-66377 ACAAAGGATACATGCTTAAAGGG + Intergenic
1185966675 X:4613698-4613720 ACAAAGATCACATGCTTCAAAGG + Intergenic
1185966677 X:4613733-4613755 ACAAAGATCACATGCTTCTGAGG + Intergenic
1186509378 X:10118933-10118955 ACAAAGATCACTGCATTCAAGGG - Intronic
1186568723 X:10692155-10692177 ACAAAGATCACATGCTTCAAAGG - Intronic
1186598219 X:11007454-11007476 ACAGAGATCACATGCTTCAAGGG - Intergenic
1186842928 X:13503255-13503277 ACAAAGAATAAATGCTTCAGGGG - Intergenic
1186857126 X:13637130-13637152 ATAAAGATCACGTGCTTCAAAGG + Intergenic
1186857130 X:13637165-13637187 AGAAACATCACATGCTTCTGAGG + Intergenic
1186994507 X:15105715-15105737 ACAGAGATCACATGCTTCAAGGG + Intergenic
1187015500 X:15323607-15323629 GCAAACATCTCATGTTTCAATGG + Intronic
1187685109 X:21808181-21808203 ACAAAGATCACATGCTTCAAAGG + Intergenic
1187685112 X:21808216-21808238 ACAAAGATCACTTGCTTCTGAGG + Intergenic
1188186076 X:27116081-27116103 ACAGGGATCACATGCTTCAGAGG - Intergenic
1188255798 X:27960846-27960868 ACAGAGATCACATGCTTCAAGGG - Intergenic
1188256268 X:27965316-27965338 ACAGAGATCACATGCCTCAAAGG + Intergenic
1188263741 X:28044897-28044919 ACAAAGAATAAATGCTTCAGGGG - Intergenic
1188425018 X:30036458-30036480 ACAAGGATCACATGCTTCAAAGG + Intergenic
1188434989 X:30149226-30149248 ACAAAGATCACATGCTTCAAAGG + Intergenic
1188446197 X:30255640-30255662 ACAGAGATCACATGCTTCAAGGG + Intergenic
1188606940 X:32043028-32043050 ACAAAGCACAAATGCTTGAAGGG + Intronic
1188742587 X:33804416-33804438 ACAAAGAATACATGCTTGAGTGG - Intergenic
1188753020 X:33926656-33926678 ACAGAGATCACATGCTTCAAAGG - Intergenic
1188776504 X:34226436-34226458 ACAGAGATCACATGCTTCAAGGG + Intergenic
1189207850 X:39257071-39257093 ATAAAGATCACATGTTCCAGAGG - Intergenic
1189842572 X:45096454-45096476 TTAAAGATCACATGTTTTAATGG - Intronic
1189854007 X:45204938-45204960 ACAAAGAATACATGCTTGAAGGG - Intergenic
1190152760 X:47961974-47961996 ACAGAGATCACATGCTTCAAGGG + Intronic
1191147561 X:57184228-57184250 ACAAAGATCACATGCTTCTGAGG - Intergenic
1191147565 X:57184281-57184303 ATAAAGATCACATGCTTCAAAGG - Intergenic
1191191593 X:57674055-57674077 ACAAAGATCGCATGCTTCAAAGG + Intergenic
1191191598 X:57674108-57674130 ACAAAGATCACATGCTTCTGAGG + Intergenic
1191226279 X:58047928-58047950 ACAAAGATCACATGTTTCTGAGG - Intergenic
1191226284 X:58047981-58048003 ACAAAGATCACATGCTTCAAAGG - Intergenic
1191654500 X:63581392-63581414 ACAGAGATCACATGCTTTAAGGG + Intergenic
1191721969 X:64238673-64238695 ACAGAGATCACATGCTTCATAGG + Intergenic
1191803089 X:65102920-65102942 ACAGAGATCACATGCTTCAAGGG + Intergenic
1191814763 X:65231231-65231253 ACAGAGATCACATGCTTCAAAGG + Intergenic
1192675561 X:73192311-73192333 ACAAAGATCACATGCTTCTGAGG + Intergenic
1192753895 X:74025112-74025134 ACAGAGATCACATGCTTCAAAGG + Intergenic
1192842474 X:74871338-74871360 ACAGAGATCAGATGCTTCAAAGG + Intronic
1192921164 X:75707883-75707905 ACAAAGATCACATGCTTCAAAGG - Intergenic
1192930748 X:75803420-75803442 ACAAAGATCACTTGCTAGAAAGG + Intergenic
1193016131 X:76736625-76736647 ACACAGATCACAGGCTGAAAAGG + Intergenic
1193224700 X:78968818-78968840 ACAAAGATCACATGCTTCAAAGG + Intergenic
1193224703 X:78968853-78968875 ACAAAGATCACATGCTTCTGAGG + Intergenic
1193262446 X:79424723-79424745 ATAAGGATCACATGCTTCAAAGG - Intergenic
1193300707 X:79885576-79885598 GAGTAGATCACATGCTTCAAAGG + Intergenic
1193441425 X:81544093-81544115 CACAAGATCACATGCTTCAAAGG - Intergenic
1193540618 X:82767265-82767287 AAAAAGATCACATGCTTCAAAGG + Intergenic
1193561935 X:83029437-83029459 ACAGAGATCACATGCTTCAAAGG + Intergenic
1193623225 X:83783109-83783131 ACAAAGATCACATGCTTCTAAGG - Intergenic
1193708442 X:84851589-84851611 ACAAATATCACATGCTTCTGAGG - Intergenic
1193708444 X:84851624-84851646 CACAAGATCACATGCTTCAAAGG - Intergenic
1193712107 X:84893265-84893287 ACAGAGATCATATGCTTCATAGG - Intergenic
1193872929 X:86823850-86823872 CACAAGATCACATGCTTCAAAGG + Intronic
1193872932 X:86823885-86823907 ACAAAGATCACATGCTTCTGAGG + Intronic
1193980260 X:88174078-88174100 ACAAAGATCACATGCTTCTGAGG + Intergenic
1194042292 X:88956493-88956515 ACAAAGATCACATGCTTCAAAGG - Intergenic
1194071130 X:89327707-89327729 ACAAAGATCACATGCTTCAAAGG - Intergenic
1194378885 X:93169098-93169120 ACAGAGATCACATGCTTCAAGGG - Intergenic
1194440610 X:93929002-93929024 CACAAGATCACATGCTTCAAAGG + Intergenic
1194440613 X:93929037-93929059 ACAAAGATCACATGCTTCTGAGG + Intergenic
1194527468 X:94995003-94995025 CCAAGGATCACATGCTTTAAAGG + Intergenic
1195128796 X:101835151-101835173 ACAAAGATCACATGCTTCAAAGG + Intronic
1195128800 X:101835204-101835226 ACAAAGATCACATTCTTCTGAGG + Intronic
1195258286 X:103109411-103109433 ACAAAGATCACATGCTTTAAAGG + Intergenic
1195556775 X:106235809-106235831 GCAAAGATCACATACTTCTGAGG - Intergenic
1195806252 X:108770446-108770468 GAGTAGATCACATGCTTCAAAGG + Intergenic
1195838348 X:109144480-109144502 ACAGAGATCACATGCTTTAAGGG - Intergenic
1195981459 X:110582709-110582731 ACAAAGATCACATGCTTTAAAGG - Intergenic
1195999396 X:110765095-110765117 ACAAAGATCACATGCTTCTGAGG - Intronic
1195999397 X:110765130-110765152 CACAAGATCACATGCTTCAAAGG - Intronic
1196271741 X:113720243-113720265 ACAAGGATCACATGCTTCAAAGG + Intergenic
1196311119 X:114167202-114167224 ACAGAGATCACATGCTTCAAAGG + Intergenic
1196541825 X:116919277-116919299 ACAAAGATCACATGCTTCTGAGG - Intergenic
1196597797 X:117565231-117565253 ACAAAGATCACATGCTTGAAAGG + Intergenic
1196637088 X:118014543-118014565 AAAAAGATCACATGCTTCAAAGG - Intronic
1196713430 X:118787367-118787389 ACAGAGATCACATGCTTCAAGGG + Intronic
1196944275 X:120808698-120808720 ATAAAGATCACATGCTTCAAAGG - Intergenic
1197004680 X:121481500-121481522 ACAAAGATCATATGCTTCTGAGG + Intergenic
1197041399 X:121940079-121940101 ACAAGGATTGCATGCTTCAAAGG - Intergenic
1197358477 X:125467406-125467428 ACAAGGATCACATGCTTCAAAGG - Intergenic
1197375434 X:125676729-125676751 ACAGAGATCACATGTTTCAGAGG - Intergenic
1197520628 X:127491911-127491933 ACAAAGATCACATGCTTCAAAGG + Intergenic
1197542096 X:127776670-127776692 ACAAATATCACATGCTTCTGAGG - Intergenic
1197549203 X:127867277-127867299 ACAGAGATCACATGCTTCACAGG - Intergenic
1197557013 X:127968225-127968247 ACAAGGATCACATGCTTCAAAGG + Intergenic
1197621635 X:128757085-128757107 ACAAAGAAGAAATGCTTGAAGGG - Intergenic
1197628650 X:128832539-128832561 ACAAAGCTCACATGCTTCTGAGG - Intergenic
1197628653 X:128832574-128832596 ACAAAGATCACTTGCTTCAAAGG - Intergenic
1197661016 X:129172484-129172506 ACAAAGGACAAATGCTTGAAGGG - Intergenic
1197817430 X:130512636-130512658 GGGTAGATCACATGCTTCAAAGG + Intergenic
1198556438 X:137798479-137798501 ACAAAGATTACATGCTTCAAAGG + Intergenic
1198556441 X:137798514-137798536 ACAAAGATCACATGCTTCTGAGG + Intergenic
1198824313 X:140683251-140683273 ACAAAGATCACATGCTTCAAAGG - Intergenic
1198857277 X:141031840-141031862 ACAAAGATCACATGCTTCTGAGG + Intergenic
1198905418 X:141555526-141555548 ACAAAGATCACATGCTTCTGAGG - Intergenic
1198994745 X:142561403-142561425 ACAGAGATCACATGCTTCAAGGG - Intergenic
1198996524 X:142579439-142579461 GAGTAGATCACATGCTTCAAAGG - Intergenic
1199107690 X:143890229-143890251 ACAAAGATCACATGCTTCTGAGG - Intergenic
1199339707 X:146662296-146662318 ACAGAGATCACATGCTTCAAAGG - Intergenic
1199360754 X:146915647-146915669 ACAGAGATCACATGCTTCAAGGG + Intergenic
1199364103 X:146958000-146958022 ACAAAGACCACATGCTTCTGAGG - Intergenic
1199364105 X:146958035-146958057 ACAAAGATCATATGCTTCAAAGG - Intergenic
1199629240 X:149764667-149764689 AAAAAGATCAGTTGCTTCCAGGG - Intergenic
1199989332 X:152976556-152976578 ACAAAGATCACATGCTTCTGAGG + Intergenic
1200021263 X:153211752-153211774 CACAAGATCACATGCTTCAAAGG + Intergenic
1200021266 X:153211787-153211809 ACAAAGATCACATGCTTCTGAGG + Intergenic
1200299209 X:154955727-154955749 ACAAAGATCACATGATTCAAAGG + Intronic
1200321516 X:155195072-155195094 ACAAAGATCACATGCTTCAAAGG + Intergenic
1200372407 X:155740751-155740773 ACAAAGATCACATGTTTCTGAGG - Intergenic
1200372410 X:155740786-155740808 ACAAAGATCACATGATTCAAGGG - Intergenic
1200393100 X:155964177-155964199 ACAAAGATCACATGCTTCTGAGG + Intergenic
1200725359 Y:6663452-6663474 ACAAAGATCACATGCTTCAAAGG - Intergenic
1200838240 Y:7753900-7753922 ACAAAGATCACATGCTTCTGAGG - Intergenic
1200878349 Y:8183888-8183910 ACAGAGACCACATGCTTCAAGGG + Intergenic
1201160919 Y:11166612-11166634 ACAAAGGAAACATGCTTAAAGGG - Intergenic
1201342988 Y:12953991-12954013 ACAGAGATCACATGCTTCAAGGG + Intergenic
1201475955 Y:14380688-14380710 GCAAAGATCACATGCTTCTGAGG + Intergenic
1201577419 Y:15476224-15476246 AGAAGGTTCACATGCTTAAATGG - Intergenic
1201616727 Y:15908730-15908752 ACAAAGATCACATGCTTAAAAGG + Intergenic
1201616728 Y:15908765-15908787 ACAATGATCACATGCTTCTGAGG + Intergenic
1201621691 Y:15966079-15966101 GAATAGGTCACATGCTTCAAGGG + Intergenic
1201621694 Y:15966114-15966136 GCAAAGATCACATGCTTCTGAGG + Intergenic
1201706524 Y:16943536-16943558 ACAGACATCACATGCTTCAAAGG + Intergenic
1201706528 Y:16943589-16943611 ACAAAGATCACATGCTTCTGAGG + Intergenic
1201792651 Y:17859185-17859207 ACAGAGAGCACATGCTTCAGAGG - Intergenic
1201808903 Y:18046801-18046823 ACAGAGAGCACATGCTTCAGAGG + Intergenic
1201860466 Y:18592159-18592181 ACAAAGATCACATTCTTCTGAGG - Intergenic
1201872857 Y:18728222-18728244 ACAAAGATCACATTCTTCTGAGG + Intergenic
1202247419 Y:22834077-22834099 ACAGAGATCACATGCTTCAAAGG + Intergenic
1202265952 Y:23019343-23019365 ACAGGGTTCACATGCTTCATAGG - Intergenic
1202354186 Y:24028433-24028455 ACAGAGAGCACATGCTTCAGAGG - Intergenic
1202400407 Y:24467825-24467847 ACAGAGATCACATGCTTCAAAGG + Intergenic
1202418945 Y:24653086-24653108 ACAGGGTTCACATGCTTCATAGG - Intergenic
1202451841 Y:25017000-25017022 ACAGGGTTCACATGCTTCATAGG + Intergenic
1202470373 Y:25202261-25202283 ACAGAGATCACATGCTTCAAAGG - Intergenic
1202516593 Y:25641679-25641701 ACAGAGAGCACATGCTTCAGAGG + Intergenic