ID: 1073372964

View in Genome Browser
Species Human (GRCh38)
Location 10:103007213-103007235
Sequence CAAAGATCACATGCTTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1699
Summary {0: 262, 1: 248, 2: 523, 3: 336, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073372962_1073372964 1 Left 1073372962 10:103007189-103007211 CCTGTACGAACAGGGAGTAGGTC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1073372964 10:103007213-103007235 CAAAGATCACATGCTTCAAAGGG 0: 262
1: 248
2: 523
3: 336
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073372964 Original CRISPR CAAAGATCACATGCTTCAAA GGG Intronic
900016593 1:154841-154863 CAGAGATCACATGCTTCACAAGG - Intergenic
900046854 1:513433-513455 CAGAGATCACATGCTTCACAAGG - Intergenic
900069059 1:755151-755173 CAGAGATCACATGCTTCACAAGG - Intergenic
900748906 1:4381345-4381367 CAAAGATCACATGCTTCAAATGG + Intergenic
901709861 1:11105417-11105439 CAGAGATCACGTGCTTCACAAGG - Intergenic
902059778 1:13632345-13632367 CAGAGATCACATGCTTCACAAGG + Intergenic
902189495 1:14752064-14752086 CAAAGATCACATGGTGAGAAAGG + Intronic
902678420 1:18025574-18025596 CAAAGAACAGATGTTTCAGAGGG - Intergenic
902905062 1:19550355-19550377 CAAGGATCACATGCTTCAAAGGG + Intergenic
902964593 1:19990463-19990485 CAGAGATCACATGCTTCACAAGG - Intergenic
902996891 1:20232595-20232617 CAAGGATCACATGCTTCAAAGGG + Intergenic
903421871 1:23223619-23223641 CAAAGATCACATGCTTCAAAGGG + Intergenic
903519711 1:23937488-23937510 CAAAGATCACATGCTTCAAAGGG + Intergenic
903519716 1:23937541-23937563 CAAAGATCACGTGCTTCTGAGGG + Intergenic
903752601 1:25636080-25636102 CAAAGATCACATGCTTCAAAGGG + Intronic
904686602 1:32265444-32265466 CAAAGCTCACATGCTTATAGAGG + Intronic
904714768 1:32459223-32459245 CAAAGATCCCATGCTTCAAAGGG - Intergenic
904893512 1:33797162-33797184 ACAAGATCACATGCTTCAAAGGG - Intronic
905501682 1:38444681-38444703 CTGAGATCACAAGCTTCTAAAGG + Intergenic
905842451 1:41194322-41194344 CAAAAATCAGATCCTTGAAAAGG - Intronic
906410777 1:45577225-45577247 CAGAGATCACGTGCTTCACAAGG - Intergenic
906577170 1:46901505-46901527 CAAAGATCACATGCTTCAAAGGG - Intergenic
906577946 1:46907817-46907839 CAAAGATCACATGCTTCAAAGGG - Intergenic
907506697 1:54924274-54924296 CAGAGATCACATGCTTCACAAGG + Intergenic
907600379 1:55762744-55762766 CAAAGATCAAAAGAGTCAAAGGG + Intergenic
907622534 1:55996029-55996051 CAGAGATCACAAGCTTCACAAGG + Intergenic
908019756 1:59887505-59887527 CAGAGATCACGTGCTTCACAAGG - Intergenic
908045266 1:60161759-60161781 CAGAGATCACATACTTCACAAGG + Intergenic
908109181 1:60877834-60877856 CAAAGATCAAATGAATCAACAGG + Intronic
908567069 1:65368361-65368383 CAAAAATCATATGCTCCAATAGG + Intronic
908761266 1:67514089-67514111 CAAAGATCACATGCTTCTGAGGG - Intergenic
908761270 1:67514142-67514164 CAAAGATCACATGCTTCAAAAGG - Intergenic
908919509 1:69172350-69172372 CAAATGTCACAGGCTTCAGAAGG - Intergenic
909136368 1:71805283-71805305 CAGAGATCACATGCTTCACAAGG - Intronic
909352496 1:74671321-74671343 CAAAGATCAAATGCTTCTGAGGG - Intronic
909352498 1:74671356-74671378 CAAAGATCATATGCTTCAAAGGG - Intronic
909464830 1:75961453-75961475 CAGAGATCACATGCTTCACAAGG - Intergenic
909556531 1:76960359-76960381 CAGAGATCACATGCTTCACAAGG + Intronic
909812869 1:79953425-79953447 CAGAGATCACATGCTTCACAAGG + Intergenic
909824546 1:80110858-80110880 ATAATATCACATGCTTCAAAGGG + Intergenic
910073769 1:83251586-83251608 CAAAGATTACATGCTTTAAAGGG + Intergenic
910287978 1:85576116-85576138 CCAAGATGACCTGCTTCAATGGG + Intronic
910301824 1:85714463-85714485 CAGAGATCACATGCTTCAAAAGG + Intergenic
910638805 1:89438730-89438752 CAAAGATCACGTGCTTCAAAGGG - Intergenic
910833505 1:91484038-91484060 CAGAGATCACATACTTCACAAGG + Intergenic
910957616 1:92724117-92724139 CAAGGATCACATGCTTTAAAGGG - Intronic
911030198 1:93479251-93479273 CAAAGATCACATGCTTCAAAGGG + Intronic
911249348 1:95557507-95557529 CAAAGATCACATGCTTCTGAGGG - Intergenic
911249350 1:95557542-95557564 CAAAGATCACATGCTTCAAAGGG - Intergenic
911279958 1:95912139-95912161 CAGAGATCACATGCTTCAAAAGG - Intergenic
911372687 1:97013140-97013162 CAAATTTCAGATTCTTCAAAGGG - Intergenic
911487939 1:98525917-98525939 CAAAGATCACATGCTTCAAAGGG + Intergenic
911591991 1:99759107-99759129 CAAAGATCACATGCTTCTGAGGG - Intronic
911591995 1:99759160-99759182 CAAAGATCACACGCTTCAAAGGG - Intronic
911638654 1:100264549-100264571 CAAAGATCACATGCTTCTGAGGG - Intergenic
911638659 1:100264603-100264625 CAAAGATCACATGCTTCAAAAGG - Intergenic
911688423 1:100803584-100803606 TAAAGATCACATGTGTCAAAGGG - Intergenic
911826879 1:102498207-102498229 CAAAGATCACATGCTTGAAAGGG - Intergenic
911831344 1:102554363-102554385 CAAAGATCACATGCTTTAAAGGG - Intergenic
911893704 1:103403389-103403411 CAGAGATCACGTGCTTCACAAGG - Intergenic
911896073 1:103436622-103436644 AAGAGATCACATGCTTCACAAGG + Intergenic
912038409 1:105351925-105351947 CAAAGATCACATGGTTCTGAGGG - Intergenic
912038414 1:105351978-105352000 CAAAGATCACATGCTTCAAAGGG - Intergenic
912112333 1:106358440-106358462 CAAAGATCACGTGCTTTAAAGGG + Intergenic
912297696 1:108486386-108486408 CAGGGATCACATGCTTCAGAGGG - Intergenic
912439086 1:109684939-109684961 CGAAGATCACATGCTTTAAAGGG - Intronic
912441609 1:109703392-109703414 CGAAGATCACATGCTTTAAAGGG - Intronic
912442395 1:109709395-109709417 CAAAGATCACATGCTTTAAGGGG - Intronic
913024613 1:114824553-114824575 CAGAGATCACATGCTTCACAAGG - Intergenic
913653177 1:120937820-120937842 AAAAGATCTCATGCTTTTAAAGG + Intergenic
913996706 1:143656639-143656661 CAAAGATCACATGCTTCTGAGGG + Intergenic
914167926 1:145191220-145191242 AAAAGATCTCATGCTTTTAAAGG - Intergenic
914214918 1:145616902-145616924 CAGAGATCACATGCTGCAAAGGG + Intronic
914466862 1:147937296-147937318 CAGAGATCACATGCTGGAAAGGG + Intronic
914505548 1:148286162-148286184 CAAAGATCACATGCTTCTGAGGG - Intergenic
914507014 1:148297989-148298011 CAAAGATCACATGCTTCTGAGGG + Intergenic
914643359 1:149631974-149631996 AAAAGATCTCATGCTTTTAAAGG + Intergenic
915055340 1:153123687-153123709 CAGAGATCACATGCTTCACAAGG + Intergenic
915097324 1:153472537-153472559 ACAAGATCACATACTTCAAAGGG - Intergenic
915403602 1:155642414-155642436 CAAAGATCACATGCTTCAAAGGG + Intergenic
915448433 1:155988415-155988437 CAAAGATCACGTACTTCACAAGG - Intronic
915651928 1:157319514-157319536 CAGAGATCACATGCTTCACAAGG + Intergenic
915817197 1:158980784-158980806 CAAAGATCACATACTTCTGAGGG - Intergenic
915817201 1:158980837-158980859 CAAAGATAACATGCTTTAAAGGG - Intergenic
915886131 1:159723116-159723138 CAGAGATCACATGCTTCACAAGG + Intergenic
915999448 1:160600766-160600788 CAGAGATCACACGCTTCACAAGG - Intergenic
916122075 1:161537519-161537541 CAAAGATCACATGCTTCAAAGGG - Intergenic
916131964 1:161618944-161618966 CAAAGATCACATGCTTCAAAGGG - Intronic
916626889 1:166567733-166567755 CAGAGATCACATGCTTCACAAGG + Intergenic
917078871 1:171236335-171236357 CAAAGATCACATGATTCAAAGGG + Intergenic
917078875 1:171236388-171236410 CAAAGATCACATGCTTCTGAGGG + Intergenic
917129185 1:171723158-171723180 TAGAGATCACATGCTTCACAAGG + Intronic
917164602 1:172097960-172097982 CAGAGGTCACGTGCTTCACAAGG + Intronic
917209868 1:172620544-172620566 CAGAGATCACATGCTTCAAAGGG + Intergenic
917312976 1:173696030-173696052 CAGAGATCACATGCTTCACAAGG - Intergenic
917373452 1:174321344-174321366 CAGAGATCACATGCTTCAAGGGG - Intronic
917381155 1:174410027-174410049 CAAAGATCACATGCTTCAAAGGG - Intronic
917588405 1:176452128-176452150 CAAAGATCACATGCTTCAACAGG - Intergenic
917738570 1:177942174-177942196 CATAGATAAAATGCTCCAAATGG - Intronic
917765218 1:178208675-178208697 CAAAGATCACATGCTTCTGAGGG - Intronic
917821141 1:178765457-178765479 CAGAGATCACATGCTTCACAAGG + Intronic
918086108 1:181246776-181246798 CAAAGATCACATGCTTCTGAGGG - Intergenic
918086112 1:181246829-181246851 CAAAGATCACACACTTCAAAGGG - Intergenic
918087087 1:181254984-181255006 CAAAGATCACATGCTTCAAAGGG - Intergenic
918175968 1:182045470-182045492 CAAAGATCACATACTTCAAAGGG + Intergenic
918175970 1:182045505-182045527 CAAAGATCACATGCTTTTGAGGG + Intergenic
918453203 1:184680774-184680796 CAAAGATCACATGTTTCTGAGGG + Intergenic
918453207 1:184680827-184680849 CAAAGATCACATGCTTCTGAGGG + Intergenic
918461779 1:184784169-184784191 CAGAGATCACATGCTTCAAAGGG - Intergenic
918536302 1:185578733-185578755 ACAAGATCACATGCTTCAAAGGG - Intergenic
918744469 1:188182492-188182514 CAGAGATCACATGCTTCACAAGG - Intergenic
918848013 1:189644127-189644149 CAAAGATCATATGCCTCAAAAGG + Intergenic
918848016 1:189644180-189644202 CAAAGATCAGACGCTTCTAAGGG + Intergenic
918977844 1:191513585-191513607 CAGAGATCACATGCTTCAAAGGG - Intergenic
918999607 1:191813554-191813576 AAAAGATCACATGCTTGAAAGGG + Intergenic
919035834 1:192308177-192308199 CAAAGATCACATGCTTCAAAGGG + Intergenic
919110049 1:193207247-193207269 CAAAGATCACATGCTTCAAAGGG + Intronic
919189963 1:194203736-194203758 CAGAGATCACATGCTTCACAAGG + Intergenic
919296085 1:195702420-195702442 CAGAGATCACAGGCTTCACAAGG + Intergenic
919538109 1:198813754-198813776 CAAAGACCACATGCTTCAAAGGG + Intergenic
920062242 1:203235340-203235362 CAAAGATCACATGCTTCACAAGG - Intronic
920599031 1:207303685-207303707 CAGAGATCACGTGCTTCACAAGG + Intergenic
920879583 1:209867402-209867424 CAAAGATCACATGCTTCAAAGGG - Intergenic
920908982 1:210196330-210196352 CAAAGATCACATGCTTCTGAGGG + Intergenic
920913568 1:210239532-210239554 CCAAGATCACATACTTTAAGAGG + Exonic
921139896 1:212297638-212297660 CAAAGATCCCTTGCTTTAACAGG - Intronic
921900483 1:220444910-220444932 CAAAGATCACATGCTTCTGAGGG - Intergenic
921900487 1:220444963-220444985 CAAAGATCACATGCTTCAAAGGG - Intergenic
922104418 1:222500544-222500566 CAGAGATCACATGCTTCACAAGG - Intergenic
922264736 1:223973057-223973079 CAGAGATCACATGCTTCACAAGG - Intergenic
922361048 1:224821690-224821712 CAGAGATCACATACTTCACAAGG + Intergenic
922376254 1:224970443-224970465 CAGAGATCACATGCTTCACAAGG - Intronic
922379378 1:225006786-225006808 CAGAGATCACATGCTTCAAAAGG - Intronic
922694638 1:227723090-227723112 CAGAGATCACATGCTTCACAAGG - Intergenic
923242580 1:232099813-232099835 CAAAGATTACATGCTTCAAAGGG + Intergenic
923419570 1:233799080-233799102 CAGAGATCACATGCTTCACAAGG + Intergenic
923824255 1:237482155-237482177 CAAAGAAGAAATGCTTGAAAGGG - Intronic
924120211 1:240789840-240789862 CAGAGATCACATGCTTCACAAGG - Intronic
924268067 1:242302841-242302863 CTGAGATCACCTGCTCCAAAAGG - Intronic
924296944 1:242597278-242597300 CAAAGATCACATGCTTCTGAGGG - Intergenic
924296947 1:242597314-242597336 CAAAGATCACATGCTTCAAGGGG - Intergenic
924330986 1:242940285-242940307 CAAAGATTACATACTTCAAATGG - Intergenic
924346594 1:243078062-243078084 CAGAGATCACATGCTTCACAAGG - Intergenic
924358977 1:243215743-243215765 CAGAGATGACATGCTTCACAAGG - Intronic
924489997 1:244526979-244527001 CAAAGATCACATGCTTCACAAGG + Intronic
924728933 1:246694639-246694661 CAAAGATCACATGCTTCTGAGGG - Intergenic
924728935 1:246694674-246694696 CAAAGATCACATGCTTCAAAGGG - Intergenic
924732984 1:246729103-246729125 CAGAGATCACATGCTTCAAAAGG + Intronic
924869646 1:248027415-248027437 CAGAGATCACATGCTTCACAAGG - Intronic
924879518 1:248145059-248145081 CCAAAATCACATGCTTTATAAGG + Intergenic
1063329081 10:5137900-5137922 CAAAGATCACATGCTTCAAAGGG + Intergenic
1063329085 10:5137953-5137975 GAAAGATCACATGCTTCTGAGGG + Intergenic
1063474460 10:6316363-6316385 CAAAGATCAATGACTTCAAAAGG + Intergenic
1063791542 10:9454290-9454312 CAAAGATCACATGCTCCAAAGGG - Intergenic
1063886622 10:10586537-10586559 CCAAAATGACAAGCTTCAAAGGG - Intergenic
1064097990 10:12438150-12438172 AAAAGAGCACGTGCTTCAAAAGG - Intronic
1064522960 10:16222794-16222816 CAAAGATCACATGCTTCAAAGGG + Intergenic
1064587543 10:16853615-16853637 CAAAGTTGAAATGCTTCCAAAGG + Intronic
1064626148 10:17263520-17263542 ACAAGATCACATGCTTCAAAGGG + Intergenic
1064779026 10:18812773-18812795 CAAAGATCACATGCTTCAAAGGG + Intergenic
1064779028 10:18812808-18812830 CAAAGATTACATGCTTCTGAGGG + Intergenic
1064893628 10:20208969-20208991 CAGAGATCACATGCTTCAGAAGG + Intronic
1065002736 10:21351917-21351939 AGTAGATCACATGCTTCAAAGGG - Intergenic
1065196753 10:23274131-23274153 CAGAGATCACACGCTTCAAAGGG + Intronic
1065244793 10:23746239-23746261 CAAAGATCACATGGTGAAAGAGG - Intronic
1065497917 10:26349210-26349232 CAAAGATCACATGCTTCTGAGGG - Intergenic
1065497919 10:26349245-26349267 CAAAGATCACTTGCTTCAAAGGG - Intergenic
1065499690 10:26367392-26367414 CAAAGATCACATGCTTCAAAGGG - Intergenic
1066113565 10:32219611-32219633 CAAAGATCACATGCCTCAAAGGG - Intergenic
1066257100 10:33690645-33690667 CAAAGATCACATGCTTCAAAGGG - Intergenic
1066542744 10:36466835-36466857 CAAAGAGCAAATGCTTAAAGTGG + Intergenic
1066613250 10:37272300-37272322 CAAAGATCAGATGGTTGTAAAGG + Intronic
1066626548 10:37412848-37412870 CAGAGATCCCACGCTTCACAAGG + Intergenic
1066651126 10:37656062-37656084 CAAAGATCACATGCTTCTGAGGG + Intergenic
1066651131 10:37656115-37656137 CAAAGATCACATGCTTCTGAGGG + Intergenic
1066664004 10:37764471-37764493 CAGAGATCACATGCTTCACAAGG - Intergenic
1066686068 10:37982728-37982750 CAAAGATCACATGCTTCTAAGGG + Intergenic
1066716839 10:38295900-38295922 CTGAGATCACCTGCTCCAAAAGG + Intergenic
1066729754 10:38426787-38426809 CAGAGATCACTTGCTTCACAAGG + Intergenic
1066789024 10:39043050-39043072 CAAAGATCACAAGCTTCAAACGG - Intergenic
1067013958 10:42741427-42741449 CAAAGATCACATGCTTCAAAGGG + Intergenic
1067013962 10:42741479-42741501 CAAAGATCACATGCTTTTGAGGG + Intergenic
1067303033 10:45031838-45031860 CAGAGATCACATGTTTCACAAGG + Intergenic
1067543019 10:47170223-47170245 CAGAGATCATGTGCTTCACAAGG + Intergenic
1067841782 10:49686860-49686882 CAAGGACCACATGCTTCAAAGGG - Intronic
1067920086 10:50446206-50446228 CAGAGATCACATGCTTCACAAGG - Intronic
1068052345 10:51966757-51966779 CAAAGAGCAGAGGCTTCTAAAGG - Intronic
1068097132 10:52505284-52505306 CAAGGATCACATGCTTCAAAGGG + Intergenic
1068152777 10:53155614-53155636 CAAAGATCACATGCTTCAAAGGG + Intergenic
1068290827 10:54999957-54999979 TAGAGATCACGTGCTTCACAAGG + Intronic
1068423334 10:56823460-56823482 CAAAGATCACATGCTTCAAGGGG - Intergenic
1068537521 10:58256575-58256597 CAAAGATCACATGCTTCAAGGGG - Intronic
1068568050 10:58597310-58597332 CAAAGATCACATGCTTCAAAAGG + Intronic
1068568054 10:58597363-58597385 CACAGATCACATGCTTCTGAGGG + Intronic
1068662558 10:59637563-59637585 CAGAGATCACGTGCTTCACAAGG + Intergenic
1069072809 10:64007080-64007102 CAGAGATCACATACTTCAAAAGG + Intergenic
1069094425 10:64241433-64241455 CAAAGATCACATGCTTCAAAGGG - Intergenic
1069104017 10:64360574-64360596 CAAAGATCACATGCTTCAGAGGG - Intergenic
1069132807 10:64727620-64727642 CAGAGATCACGTGCTTCACAAGG - Intergenic
1069162190 10:65106179-65106201 CAGAGATCACATGCTTTACAAGG + Intergenic
1069185247 10:65414334-65414356 CAGAGGTCACATGCTTCACAAGG + Intergenic
1069198451 10:65583299-65583321 CAAAGATCACATGCCTCAAAGGG - Intergenic
1069288150 10:66742474-66742496 CAGAGATCACATGCTTCACAAGG - Intronic
1069570005 10:69488742-69488764 CAAAGATCACATGCTTCAAAGGG + Intronic
1069570008 10:69488777-69488799 CAAAGATCACATGCTTCTAAGGG + Intronic
1069737739 10:70668559-70668581 CAGAGATCACGTGCTCCACAAGG - Intergenic
1070050348 10:72882762-72882784 CAGAGATCACATACATCACAAGG - Intronic
1070314800 10:75299833-75299855 CAGAGATCACATGCTTCACAAGG + Intergenic
1070364783 10:75726079-75726101 TAAAGTTTACATGCTTCAGAGGG + Intronic
1070463303 10:76691409-76691431 CAAAGATCACATGCTTCTGAGGG + Intergenic
1071049531 10:81429732-81429754 CAGAGATCACATGCTTCACAAGG + Intergenic
1071183936 10:83019228-83019250 CAGAGATCACGTGCTTCACAAGG - Intergenic
1071380673 10:85056332-85056354 CAGAGATCACATGCTTCACAAGG - Intergenic
1071412515 10:85410871-85410893 CAAAGATCACATGCTTCTGAGGG - Intergenic
1071588974 10:86853780-86853802 CAGAGATCACGTGCTTCACAAGG + Intronic
1071855534 10:89620677-89620699 CAAAGATCACATGCTTGAAAGGG - Intronic
1071945470 10:90638953-90638975 CAGAGATCACATGCTTCACAAGG - Intergenic
1072387262 10:94943664-94943686 CAGAGATCACATGCTTCACAAGG + Intronic
1072473140 10:95732853-95732875 CAGAGATCACATGCTTCACAAGG + Intronic
1072884031 10:99257711-99257733 CAGAGATCACATACTTCACAAGG - Intergenic
1073353891 10:102838333-102838355 CAAAGATCACATGCTTCAAAGGG + Intergenic
1073353893 10:102838386-102838408 CAAAGATCACATGCTTCTGAGGG + Intergenic
1073354671 10:102844291-102844313 CAAAGATCACATGCTTCAAAGGG + Intergenic
1073354675 10:102844344-102844366 CAAAGATCACATGCTTCTCAGGG + Intergenic
1073372964 10:103007213-103007235 CAAAGATCACATGCTTCAAAGGG + Intronic
1073678613 10:105678002-105678024 CAGAGATCACGTACTTCACAAGG - Intergenic
1074211732 10:111341387-111341409 CAAAGTCCACATGCTTCAAAGGG + Intergenic
1074845446 10:117393349-117393371 CAAAGATCACAATCATCAATGGG + Intergenic
1074983800 10:118640246-118640268 CAGAGATCACGTGCTTCACAAGG + Intergenic
1075459019 10:122603477-122603499 CAGAGATCACATCCTTCACAAGG + Intronic
1075459651 10:122607536-122607558 CAGAGATCACATCCTTCACAAGG + Intronic
1075460283 10:122611595-122611617 CAGAGATCACATCCTTCACAAGG + Intronic
1075460915 10:122615654-122615676 CAGAGATCACATCCTTCACAAGG + Intronic
1075613815 10:123876160-123876182 CAAAGACCACTTCCTTGAAAGGG + Intronic
1075929255 10:126281339-126281361 CACAGATCACATACCTTAAATGG + Intronic
1076022014 10:127081824-127081846 CCAAAATCAGATACTTCAAATGG - Intronic
1076085730 10:127629194-127629216 CAAAGATCACATGCTTCAAAGGG + Intergenic
1076085735 10:127629247-127629269 CAAAGATCACATGCTTCTGAGGG + Intergenic
1076392980 10:130117548-130117570 CAAGGATCACATGCTTCAAAGGG + Intergenic
1076973183 11:149910-149932 CAGAGATCACATGCTTCACAAGG - Intergenic
1077594517 11:3520257-3520279 GAAAGATCACATGCTTCTGAGGG - Intergenic
1077594521 11:3520310-3520332 CAAAGATCACATGCTTCAAAGGG - Intergenic
1078032104 11:7763149-7763171 CAAATATCACCTGCTCCACATGG + Intergenic
1078231995 11:9451967-9451989 CAAAGGTCACATGTTTCAAAGGG + Intergenic
1078385160 11:10884294-10884316 CAAGGATCACATGCTTCAAAGGG + Intergenic
1078529334 11:12124825-12124847 CAAAGAACACAGACTTCAAGTGG - Intronic
1078581884 11:12545218-12545240 CAATGAACACATACTTCAACAGG + Intergenic
1078804524 11:14684407-14684429 ACAAGATCACATGCTTCAAAGGG + Intronic
1078839284 11:15063183-15063205 CAGAGTTCACATGCTTCACAAGG + Intronic
1078840024 11:15069701-15069723 CAGAGATCACATGCTTCACAAGG + Intronic
1079666885 11:23117035-23117057 CAAAGATCACATGCTTCAAAGGG + Intergenic
1079783335 11:24637864-24637886 CAGGGATCACATGCTTCAAAGGG - Intronic
1079829496 11:25244942-25244964 CAGAGATCACATGCTTCACAAGG + Intergenic
1079975819 11:27090429-27090451 CAAAGATCACATGCTTCAAAGGG + Intronic
1079975823 11:27090482-27090504 CAAAGATCACATGCTTCTGAGGG + Intronic
1079979630 11:27136206-27136228 CAGGGATCACATGCTTCAGAGGG - Intergenic
1080089103 11:28323463-28323485 CAAATATCACATAATACAAAAGG - Intronic
1080155466 11:29105824-29105846 CAAAGATCACATGCTTCAAAGGG - Intergenic
1080203683 11:29705167-29705189 CAGAGATCACATGCTTCACAAGG - Intergenic
1080673656 11:34404900-34404922 TAAAGATCACCTTGTTCAAAGGG + Intergenic
1080972921 11:37300938-37300960 CAAAGATCACATGCTTCAAAGGG + Intergenic
1080972926 11:37300991-37301013 CAAAGATCACATGCTTCTGAGGG + Intergenic
1081031523 11:38090148-38090170 CAAAGAACACATGCTCCAAAAGG - Intergenic
1081236114 11:40648999-40649021 CAAAGATCACAGGCTTCAAAGGG + Intronic
1081254105 11:40871268-40871290 CAGAGATCACAGGCTTCACAAGG - Intronic
1081328392 11:41774246-41774268 CAAAGATCACATGCTTCAAAGGG + Intergenic
1082062916 11:47875745-47875767 ACAAGATCACATGCTTCAAAGGG + Intergenic
1082115925 11:48328114-48328136 CAGAGATCACATGCTTCAAAGGG + Intronic
1082143295 11:48634762-48634784 CAAAGATCACATGCCTTAAAGGG + Intergenic
1082257768 11:50051378-50051400 CAGAGATCACATGCTTCAAAGGG - Intergenic
1082282172 11:50281726-50281748 CAAAGATCACATGCTTCAAAGGG - Intergenic
1082292880 11:50400687-50400709 CAAAGATCACATGTTTCAAAGGG - Intergenic
1082295658 11:50438905-50438927 CAGAGATCACATGCTCCACAAGG - Intergenic
1082296620 11:50447739-50447761 CAGAGATAACATGCTTCACTAGG - Intergenic
1082300126 11:50494799-50494821 CAGAGATCGCATGCTTCACAAGG + Intergenic
1082570487 11:54732127-54732149 CAAAGATCACATGCTTTAAAGGG + Intergenic
1082573076 11:54765935-54765957 CAGAGATCACAAGCTACACATGG - Intergenic
1082733384 11:56827330-56827352 CAAAGATCACATGCTTCAAAGGG + Intergenic
1082780267 11:57282005-57282027 CAAAGATCACGTACTTCACAAGG + Intergenic
1083099245 11:60285728-60285750 CAGAGATCACATGCTTCAAATGG + Intronic
1083550091 11:63581636-63581658 CAAGGATCACATGCTTCAAAGGG - Intronic
1084097988 11:66925067-66925089 CAGAGATCATGTGCTTCACAAGG + Intronic
1084223434 11:67699323-67699345 CAAAGATCACATGCTTCAAAGGG - Intergenic
1084250364 11:67893528-67893550 GAAAGATCACATGCTTCTGAGGG - Intergenic
1084250368 11:67893581-67893603 CAAAGATCACATGCTTCAAAGGG - Intergenic
1084822417 11:71701761-71701783 CAAAGATCACATGCTTCAAAGGG + Intergenic
1084822421 11:71701814-71701836 GAAAGATCACATGCTTCTGAGGG + Intergenic
1085405480 11:76259214-76259236 CAGAGATTCCATGCTGCAAATGG + Intergenic
1085480194 11:76815618-76815640 CAAAAATCACATGCTTCAAAGGG + Intergenic
1085947195 11:81285786-81285808 CAAAGATCACATGCTTCAAAGGG - Intergenic
1087086045 11:94219740-94219762 CAGAGATCATATGCTTCAGAGGG + Intergenic
1087123623 11:94600497-94600519 CAAAGATCACGTACTTTACAAGG + Intronic
1087410467 11:97784833-97784855 CAGAAATCACATGCTTCACAAGG - Intergenic
1087438990 11:98158910-98158932 CAGAGATCACATGCTTCAAAGGG + Intergenic
1087622079 11:100554223-100554245 CCAAGGTCAGATACTTCAAAAGG + Intergenic
1087680200 11:101211488-101211510 CAAAGATCACATGCTTCTGAGGG + Intergenic
1087681283 11:101220584-101220606 CAAAGATCACATGCTTCTGAGGG + Intergenic
1088008717 11:104973357-104973379 CAGAGATCACGTGCTTCACAAGG - Intergenic
1088458108 11:110053786-110053808 CAGAGATCACATGCTTCACAAGG + Intergenic
1088494747 11:110421602-110421624 CAGAGCTCACATGCTTCACAAGG + Intergenic
1088967231 11:114736066-114736088 GAGAGATCACATACTTCACAAGG + Intergenic
1089858672 11:121569778-121569800 CAGAGATCATGTGCTTCACAAGG - Intronic
1090676234 11:128999490-128999512 CAGAGATCACATGCTTCACAAGG - Intronic
1091410494 12:236160-236182 CAAAGATCACATGCTTCTGAGGG - Intronic
1091410496 12:236213-236235 CAAAGATCTCATGCTTCAAAGGG - Intronic
1091457605 12:619343-619365 CAAAGAGAACATGCTTTAGAAGG + Intronic
1092329624 12:7571722-7571744 GAAAGTTCACATGATTCAGAAGG + Intergenic
1092397610 12:8142063-8142085 CAGAGATCACATGCTTCAAAGGG - Intronic
1092420692 12:8329098-8329120 CAAAGATCACGTGCTTCAAAGGG - Intergenic
1092530073 12:9336559-9336581 CAAAGATCACGTGCTTCAAAGGG + Intergenic
1092678166 12:10945521-10945543 CAGAGATCACATGCTTCACTAGG + Intronic
1092852229 12:12639894-12639916 CAAAGATCACATGCTTCAAAGGG + Intronic
1092852234 12:12639947-12639969 CAAAGATCACGTGCTTTTGAGGG + Intronic
1092900314 12:13053598-13053620 CAAAGATCACGTGCTTCAAAGGG + Intronic
1093074705 12:14745876-14745898 CAGAGATCATGTGCTTCACAAGG + Intergenic
1093347925 12:18062813-18062835 CAGAGATCACATGCTTCACATGG + Intergenic
1093729826 12:22554692-22554714 CAAAGATCACATGCTTCAAAGGG + Intergenic
1093729830 12:22554745-22554767 CAAAGATCACATGCTTCTGAGGG + Intergenic
1093735139 12:22612731-22612753 CAAAGATCACATGCTTTTGAGGG + Intergenic
1093837970 12:23859612-23859634 CAGGGATCACATGCTTCAGAGGG - Intronic
1093965657 12:25322203-25322225 CAAAGATGAGATGCTTCATTTGG + Intergenic
1094411770 12:30174477-30174499 CAGAGATCACGTACTTCACAAGG - Intergenic
1094605916 12:31949015-31949037 CAAAGATCACATGCTTCTGAGGG - Intergenic
1094740350 12:33281532-33281554 CAGAGATCACATGCTTCAAAAGG + Intergenic
1095087180 12:38069624-38069646 CAGAGATCACTTACTTCACAAGG - Intergenic
1095172755 12:39055106-39055128 CAAAGATTACGTACTTCACAAGG - Intergenic
1095252945 12:39999801-39999823 CAAAGATCACATGCTTCAAAGGG - Intronic
1095363459 12:41373127-41373149 CAGAGATCACATGCTTCACAAGG + Intronic
1096605371 12:52761131-52761153 CAGAGATCACATGCTTCACAAGG + Intergenic
1096792816 12:54055418-54055440 ACAACATCACATGCTTAAAAGGG - Exonic
1096948753 12:55441179-55441201 CAGAGATCACATGCTTCACAAGG + Intergenic
1097082554 12:56443580-56443602 CAGAGATCACATGCTTCAAAGGG - Intronic
1097135803 12:56853891-56853913 CAAAGATCACATGCTTCAAAGGG - Intergenic
1097138852 12:56882332-56882354 CAGAGATCACATGCTTCAAAAGG + Intergenic
1097364418 12:58695697-58695719 CAAGGATCACATGCTTCAAAGGG - Intronic
1097425606 12:59440552-59440574 CAAAGATCACATGCTTCTAAGGG - Intergenic
1097425610 12:59440604-59440626 CGAAGATTGCATGCTTCAAAGGG - Intergenic
1097515725 12:60603429-60603451 CAGAGATCACATGCTTCAAATGG + Intergenic
1097664431 12:62463694-62463716 CAAAGATCACATGCTTCAAAGGG - Intergenic
1097719494 12:63004326-63004348 CAGAGTTCAGATCCTTCAAAAGG - Intergenic
1097993672 12:65863800-65863822 GAAACATCACACCCTTCAAAAGG - Intronic
1098333747 12:69380927-69380949 CAGAGATCACATGCTTCACAAGG + Intronic
1098497214 12:71150394-71150416 ACAAGATCACATACTTCAAAGGG - Intronic
1098709168 12:73733105-73733127 CAAAGATCAAATGCAACAGAAGG + Intergenic
1098741139 12:74175031-74175053 TAAAGATCACATGCTTCTGAGGG + Intergenic
1098747207 12:74253793-74253815 CAAGGATCACATGCTTCAAAGGG + Intergenic
1098781135 12:74687831-74687853 CAGAGATCATATGCTTCACAAGG + Intergenic
1099117782 12:78649052-78649074 CAGAGATCATGTGCTTCACAAGG - Intergenic
1099166426 12:79312411-79312433 CAAATATCACATTTTTCAAATGG - Intronic
1099318837 12:81119209-81119231 ATAAGATCACATGCTTCAAAGGG + Intronic
1099580968 12:84446439-84446461 CAAGGATCATATGCTTCAAAGGG + Intergenic
1099721294 12:86364821-86364843 CAGAGATCATGTGCTTCACAAGG + Intronic
1099724562 12:86410036-86410058 CAAAGATCACATGCTTTAAAGGG + Intronic
1100087505 12:90929603-90929625 CAAAGATCACATGCTTCTGAGGG + Intronic
1100418054 12:94399127-94399149 AAAAGATCACATGCTTCAAAGGG - Intronic
1100439869 12:94606785-94606807 CAAAGATCACATGCTTCAAAGGG + Intronic
1100499134 12:95156623-95156645 CAGAGATCACATGCTTCACAAGG - Intronic
1100970596 12:100065846-100065868 CAAAGATGACATGCTTCAAAGGG - Intronic
1101024604 12:100588420-100588442 CAAAGATCACATGCTTCAAAGGG + Intronic
1101024608 12:100588473-100588495 CAAAGATCACATGCTTCTGAGGG + Intronic
1101480829 12:105095310-105095332 CAAGGATCACATGCTTCAAAGGG + Intergenic
1101500536 12:105300046-105300068 CAGAGATCTCATGCTTCACAAGG - Intronic
1101502145 12:105314188-105314210 CAGAGATCTCATGCTTCACAAGG - Intronic
1101644707 12:106620475-106620497 CAAAGATCACATGCTTCAAAGGG + Intronic
1101644709 12:106620510-106620532 CAAAGATCACATGCTTCTGAGGG + Intronic
1102727013 12:115074704-115074726 CAATGTTCACATCCGTCAAATGG + Intergenic
1103218062 12:119218830-119218852 CAGAGATCACATGCTTCACAAGG + Intronic
1104051799 12:125199714-125199736 CAAAAATCACAACCTTGAAATGG - Intronic
1104127973 12:125865256-125865278 CAAAGATCACATGCTTCAGTGGG + Intergenic
1104277892 12:127346703-127346725 CAAAGATCACATGCGTCAAAGGG + Intergenic
1104693231 12:130842266-130842288 CAGAGATCACATGCTTCACAAGG - Intergenic
1104877689 12:132047585-132047607 CAGAGATCACATGCTTCACAAGG + Intronic
1105227633 13:18451233-18451255 CAAAGATCAAGTACTTCACAAGG + Intergenic
1105244429 13:18636028-18636050 CAAAGATCACATGCTTTAAAGGG - Intergenic
1105521536 13:21135537-21135559 CAGAGATCACATGCTTCCCAAGG + Intergenic
1105804106 13:23939684-23939706 CAGAGATCACATGCTTCAAAGGG + Intergenic
1105897741 13:24731453-24731475 CAAAGATCACATGCTTCAAAAGG + Intergenic
1105897745 13:24731506-24731528 CAAAGATCACATGCTTCTGAGGG + Intergenic
1106341114 13:28827825-28827847 CAGAGATCACATGCTTCACAAGG + Intronic
1106390950 13:29335473-29335495 CAGAGATCACATGCTTCACAAGG - Intronic
1106610896 13:31279561-31279583 CAGAGATCACTTGCTTCACAAGG + Intronic
1106961027 13:34998236-34998258 CAGAGATCACCTGCTTCACAAGG + Intronic
1107239201 13:38211754-38211776 CAAAGATCACATGCTTCAAAGGG + Intergenic
1107520471 13:41175541-41175563 CAGAGATCACATGCTTCACAAGG + Intergenic
1108156145 13:47586663-47586685 GTAAGATCACATTCTTCAAAGGG + Intergenic
1108218300 13:48207188-48207210 CAAGGATCACATGCTTCAAAGGG + Intergenic
1108294667 13:49001892-49001914 CAGAGATCACACGCTTCACAAGG - Intronic
1108562538 13:51659970-51659992 CAAAGGTCAGATGCTTGGAAAGG + Intronic
1108799001 13:54069914-54069936 CAGAGATTACATGCTTCAAAAGG + Intergenic
1108902157 13:55424955-55424977 CAGAGATCACATGCTTCAAATGG + Intergenic
1108916799 13:55623911-55623933 CAAGGATCACATGCTTCAAAGGG + Intergenic
1109081122 13:57902896-57902918 CAGAGATCACGTGCTTCACAAGG + Intergenic
1109424394 13:62152024-62152046 CAGAGATCACATGCTTCACAAGG - Intergenic
1109502108 13:63251341-63251363 CTAAAATCACATGTCTCAAATGG - Intergenic
1109573663 13:64225599-64225621 CAAAGATCACCTTCTACAGAAGG + Intergenic
1109590652 13:64476383-64476405 CAAAGATCACATGCTTCTGAAGG - Intergenic
1109647206 13:65274283-65274305 CAAAGATCACATGCTTCAAAGGG - Intergenic
1109682576 13:65772157-65772179 ACAAGATCACATGCTTCAAAGGG - Intergenic
1109721968 13:66286748-66286770 CAGAGATCACATGCTTCACAAGG + Intergenic
1109811731 13:67521144-67521166 CAGAGATCACATGGTGAAAAAGG - Intergenic
1109889096 13:68583575-68583597 CAAATATTCCATGTTTCAAAAGG + Intergenic
1109918082 13:69018144-69018166 CAAATATCACATGCTTCAAAGGG + Intergenic
1109918086 13:69018197-69018219 CAAAGATCACATGCTTCTGAGGG + Intergenic
1109963388 13:69660628-69660650 CAAGGATCACATGCTTCAAAGGG - Intergenic
1110002988 13:70229372-70229394 CAGAGATCACATGTTGAAAAAGG - Intergenic
1110080097 13:71298745-71298767 CAAAGATCACATGCTTCAAAGGG + Intergenic
1110278865 13:73669541-73669563 CAAACTTGACATGCTTAAAATGG + Intergenic
1110287521 13:73766901-73766923 CATAGATCAAATACTGCAAATGG + Intronic
1110388438 13:74942668-74942690 CAAAGCTTAAAGGCTTCAAAAGG + Intergenic
1110456932 13:75699647-75699669 CAGAGATCGCATGCTTCAGAAGG + Intronic
1110579998 13:77110547-77110569 CAAAGATCACATGCCTTAAAGGG - Intronic
1110660699 13:78056796-78056818 CAAAGATCACATGCTTCAAAGGG + Intergenic
1110660703 13:78056831-78056853 CAAAGATCACATGCTTCGGAGGG + Intergenic
1110953696 13:81525389-81525411 CAAAGATCACATGCTTCAACGGG - Intergenic
1111011208 13:82317407-82317429 AGTAGATCACATGCTTCAAAGGG + Intergenic
1111031723 13:82608645-82608667 CAAAGATCACATGCTTTTGAGGG - Intergenic
1111031726 13:82608680-82608702 CAAAGATCACATGCTTCAAAGGG - Intergenic
1111060283 13:83009677-83009699 GAAAGATCACATACCTCCAAAGG - Intergenic
1111429480 13:88133237-88133259 CAGAGGTCACATACTTCACAAGG + Intergenic
1111452320 13:88435348-88435370 AGTAGATCACATGCTTCAAAGGG - Intergenic
1111468267 13:88645055-88645077 CAGAGATCACATGCTTCACAAGG + Intergenic
1111509604 13:89243370-89243392 CAGAGATCACATACTTCACAAGG - Intergenic
1111684856 13:91489191-91489213 CAGAGATCACATGCTTCACAAGG - Intronic
1111946169 13:94668123-94668145 CAGTGATCAAAAGCTTCAAAAGG - Intergenic
1112053605 13:95669886-95669908 AGTAGATCACATGCTTCAAAGGG + Intergenic
1112449305 13:99494500-99494522 CAGAGATCACATGCTTCACAAGG + Intergenic
1112960546 13:105120248-105120270 CAGAGATCACATGCTTCACTAGG + Intergenic
1113214080 13:108017756-108017778 CAAAGATCACATGCTTCAAAGGG - Intergenic
1113216158 13:108043007-108043029 CAAAGATCACATGCTTCTGAGGG - Intergenic
1113216160 13:108043041-108043063 CAAAGATCACAGGCTTCAAAGGG - Intergenic
1113290573 13:108901232-108901254 CAGAAATCACATGTTTCACAAGG - Intronic
1113536579 13:111071392-111071414 CAAAGATCACATGCTTCAAAGGG + Intergenic
1113536581 13:111071427-111071449 CAAAGATCACATGCTTCTGAGGG + Intergenic
1113542513 13:111120121-111120143 ATAAAGTCACATGCTTCAAAAGG - Intronic
1114012072 14:18379695-18379717 TAAAGATCACATACTTCACAAGG + Intergenic
1114144290 14:19955456-19955478 CAGAGATCACGTACTTCACAAGG - Intergenic
1114157261 14:20118741-20118763 CAGAGATCACATGCATCACAAGG + Intergenic
1114638482 14:24202779-24202801 CAAAGATCACGTACTTCACAAGG - Intronic
1114750509 14:25199601-25199623 CAAAGATCACATGCTTCAAGGGG + Intergenic
1114750513 14:25199654-25199676 CAAAGATCATGTGCTTCTGAGGG + Intergenic
1114753043 14:25227419-25227441 CAGAGATCACATGCTTCACAAGG + Intergenic
1114892401 14:26942090-26942112 CAGAGATCACGTACTTCACAAGG + Intergenic
1115002118 14:28435448-28435470 CAGAGATCACATGCTTCACAAGG - Intergenic
1115007670 14:28506440-28506462 CAAAGATCAGATGGTTGTAAAGG + Intergenic
1115085152 14:29506656-29506678 CAAAGATCACACACTTCAAAGGG + Intergenic
1115280190 14:31653064-31653086 CAAAGATTACATACTTCAAAGGG + Intronic
1115386530 14:32804485-32804507 CAAAGATCACATGCTTCAAAGGG + Intronic
1115386532 14:32804520-32804542 CAAAGATCACATGCTTCTGAGGG + Intronic
1115525982 14:34281173-34281195 CAAAGATCACATGCTTCAAAGGG + Intronic
1115781266 14:36771420-36771442 CAAAGATCACTTACTTTGAATGG + Intronic
1115810949 14:37106638-37106660 CAAAGATCACATGCTTCTGAGGG - Intronic
1115810953 14:37106691-37106713 CAAAGATCACATGCTTCAAAGGG - Intronic
1115884726 14:37958625-37958647 CAGAGATCACGTGCTTCACAAGG - Intronic
1115958766 14:38810952-38810974 CAGAGATCACATGCTTCACAAGG + Intergenic
1116200731 14:41792211-41792233 CAAAGATCACATGCTTCAAAGGG + Intronic
1116200733 14:41792246-41792268 CAAAGATCACATGCTTCTGAGGG + Intronic
1116237443 14:42297225-42297247 CAGAGATCACATGCTTCACAAGG + Intergenic
1116269280 14:42740666-42740688 CAAAGATCATAATCTTCATATGG - Intergenic
1116301762 14:43192242-43192264 CAGAGATCATGTGCTTCACAAGG + Intergenic
1116554694 14:46288196-46288218 CAAAGATCACATGCTTCAAAGGG + Intergenic
1116582449 14:46659616-46659638 CAAGGATCACATGCTTCAAAGGG + Intergenic
1116725942 14:48561773-48561795 TAGAGATCACATGGTTCAAAGGG - Intergenic
1116789091 14:49320309-49320331 CAAAGAACTCAGGCTTCCAAGGG + Intergenic
1116840505 14:49816428-49816450 CAAAGATCACATGCTTCAAAGGG - Intronic
1117083797 14:52178914-52178936 AACAGATCACATGCTCCAGATGG - Intergenic
1117098578 14:52322321-52322343 CAAAGATCACATGCTTCAAAGGG + Intronic
1117276439 14:54198746-54198768 CAGAGATCACATGCTTCACAAGG - Intergenic
1118216322 14:63811845-63811867 CAAAGATCACATGCTTCAAAGGG + Intergenic
1118372167 14:65146573-65146595 CAGAGATCACATGCTTCACAAGG + Intergenic
1119101911 14:71887836-71887858 CAAAGATCACATGCTTCTGAGGG - Intergenic
1119101915 14:71887889-71887911 CAAAGATCACATGTTTCAAAGGG - Intergenic
1119128907 14:72153739-72153761 CAAAGATCACATGCTTCAAAGGG + Intronic
1119154290 14:72394325-72394347 CAGAGATCACATGCTTCACAAGG + Intronic
1119299841 14:73562966-73562988 CAAAGATCACATGCTTCTGAGGG - Intergenic
1119299845 14:73563018-73563040 CAAAGATCGTATGCTTCAAAAGG - Intergenic
1119573281 14:75695462-75695484 CAGAGATCACATGCTTCCCAAGG - Intronic
1119869291 14:78001669-78001691 CAAAGATCACATGCTTCAAAGGG - Intergenic
1119959815 14:78842444-78842466 CAGAGATCACATGCTTCACAAGG + Intronic
1120109728 14:80540101-80540123 CAAAGATCACATGCTTCTGAGGG - Intronic
1120109732 14:80540154-80540176 CAAAGATCACATGCTTCAAAGGG - Intronic
1120120932 14:80679739-80679761 CAAAGATCACCTGCTTCAAAGGG - Intronic
1120130395 14:80800012-80800034 CAAAGATCACATGCTTCAAAAGG - Intronic
1120201003 14:81538151-81538173 CAAGGATCACATGCTTCAAAGGG + Intergenic
1120203390 14:81562579-81562601 CAAAAATCAAATTCTTCAGAAGG - Intergenic
1120444259 14:84574118-84574140 CAAAGATCGCATCATTCAAATGG - Intergenic
1120628146 14:86855150-86855172 CAACTATCACATGATACAAAGGG - Intergenic
1120637153 14:86966644-86966666 CAAAGATCACATGCTTCAAAGGG - Intergenic
1120807316 14:88766666-88766688 CAGAGATCACATACTTCACAAGG - Intronic
1120856666 14:89218289-89218311 TAAAAATCACATGATTAAAAAGG - Intronic
1121051783 14:90823962-90823984 CAAAGATCATATGCTTTAAAAGG - Intergenic
1121064937 14:90953967-90953989 CAAAGATCACATGCTTCAAAGGG - Intronic
1121099418 14:91239976-91239998 CAGAGATCACATGCTTTACAAGG + Intronic
1122645807 14:103192934-103192956 CAAAGATCACATGCTTCTGAGGG + Intergenic
1122844228 14:104481965-104481987 CAAAGATCACATGCATCAAAGGG + Intronic
1123098614 14:105778501-105778523 CAAAGATCACATGCTTCTGAGGG + Intergenic
1123137503 14:106043038-106043060 CAAAGATCACATGCTTTAAGGGG - Intergenic
1202889767 14_KI270722v1_random:144988-145010 CAAGGGTCACATGCTTCAAAGGG + Intergenic
1123664299 15:22595997-22596019 CAGAGATCACATGCTTCACAAGG - Intergenic
1123845537 15:24297385-24297407 CAGAGATCATATGCTTCACAAGG + Intergenic
1123849034 15:24334908-24334930 CAGAGATCACGTGCTTCACAAGG + Intergenic
1123868085 15:24542422-24542444 CAGAGATCACGTGCTTCACAAGG + Intergenic
1123931559 15:25174108-25174130 CAGAAATCACATGCTTCACAAGG + Intergenic
1124107969 15:26758718-26758740 CAAAGTTCAGATGCTTACAAGGG - Intronic
1124225805 15:27893893-27893915 CAAAGATCACATGCTTCTGAGGG - Intronic
1124248175 15:28088734-28088756 CAGAGATCACATGCTTCACAAGG + Intronic
1124318132 15:28690433-28690455 CAGAGATCACATGCTTCACAAGG - Intergenic
1124565304 15:30807052-30807074 CAGAGATCACATGCTTCACAAGG + Intergenic
1125005023 15:34807299-34807321 CAAAGATCACATGCTTCAAAGGG + Intergenic
1125005025 15:34807334-34807356 CAAAGATCACATGCTTCCGAGGG + Intergenic
1125567296 15:40686298-40686320 CAGAGATCCCATGCTTCACAAGG + Intergenic
1125874091 15:43128890-43128912 CAAAGATCACATGCTTCAAAGGG - Intronic
1126059969 15:44771176-44771198 CAAAGATCACATGCTTCAAGGGG - Intergenic
1126724023 15:51612617-51612639 CAGAGATCATATGCTTCACAAGG + Intronic
1126931779 15:53661347-53661369 CAGAGATCACATGGTGAAAAGGG + Intronic
1127018883 15:54722794-54722816 CAAAGATCACATGCTTCAAAAGG - Intergenic
1127076462 15:55331307-55331329 CAAGGGTCACATGGTACAAAAGG + Intronic
1127092390 15:55480040-55480062 CAAAGATCACATACTTCTGAGGG - Intronic
1127092394 15:55480093-55480115 CAAAGATCATATGCTTCAAAGGG - Intronic
1127146043 15:56025071-56025093 GAGAGATCACATACTTCACAAGG - Intergenic
1127382515 15:58442295-58442317 AAAAGGTCACATGCTTAAAATGG - Intronic
1127462020 15:59207714-59207736 CAGAGTTCAGATCCTTCAAAGGG - Exonic
1127676335 15:61242796-61242818 CAGAGATCACATGCTTCACATGG + Intergenic
1127755080 15:62084293-62084315 CAGAGATCACATGCTTCACAAGG + Intergenic
1128598773 15:68977353-68977375 CAGAGCTCACATGCTTCACAAGG + Intronic
1128675464 15:69605228-69605250 CAAATATCACCTTCTTCAAGAGG - Intergenic
1129043269 15:72709090-72709112 CAAAGATCACATGCCTCAAAGGG - Intronic
1129218736 15:74118291-74118313 CAGAGATCACATGCTTCACAAGG + Intronic
1130306752 15:82717023-82717045 CAGAGATCACATGCTTCACAAGG - Intergenic
1130583979 15:85165148-85165170 CAAGGATCACATGATTCAAAGGG - Intergenic
1130757268 15:86778189-86778211 CAGAGATCACGAGCTTCACAAGG + Intronic
1131589717 15:93735424-93735446 CAGAGGTCACATGCTTCACAAGG - Intergenic
1132213743 15:100047339-100047361 CAGAGATCACGTACTTCACAAGG - Intronic
1132497365 16:270288-270310 CCCAGATCACATGCTTAATAAGG - Intronic
1133065805 16:3206411-3206433 CAGAGATCACAGGTGTCAAAGGG - Intergenic
1133359398 16:5162094-5162116 CAAAGATCACATGCTTCTGAGGG - Intergenic
1133359405 16:5162147-5162169 CAAAGATCACATGCTTCCAAGGG - Intergenic
1133603602 16:7364272-7364294 AACAGATCTCATACTTCAAAGGG - Intronic
1133918327 16:10129338-10129360 CAAAGGACACATGCTTTAATGGG + Intronic
1134416054 16:14044361-14044383 CAAAGGTCACATGCTAGACATGG - Intergenic
1135093706 16:19543989-19544011 CAAAGATCACATGCTTCAAAGGG - Intronic
1135202852 16:20454035-20454057 CAAGGATCACATGCTTCAAAGGG - Intronic
1135216245 16:20573831-20573853 CAAGGATCACATGCTTCAAAGGG + Intronic
1135593517 16:23723069-23723091 CAAAGATCACATGCTTCAAAGGG - Intergenic
1136595397 16:31245589-31245611 CAGAGATCACATGCTTCACAAGG + Intergenic
1136635292 16:31517564-31517586 CAGAGATCACATGCTTCACAAGG - Intergenic
1136642577 16:31579177-31579199 CAGTGATCACATGCTTCACAAGG + Intergenic
1136925371 16:34367456-34367478 CAAGGATCACATGCTTCAAAAGG - Intergenic
1136979203 16:35044350-35044372 CAAGGATCACATGCTTCAAAAGG + Intergenic
1137279006 16:46959061-46959083 TAAAGATCACCTTTTTCAAAGGG + Exonic
1137335072 16:47540431-47540453 ACAAGATCACATGCTTCAAAGGG - Intronic
1137498071 16:48986248-48986270 ACAAAGTCACATGCTTCAAAGGG + Intergenic
1138011485 16:53384986-53385008 CACAGATCACATGCTTCAAGAGG - Intergenic
1138500533 16:57440368-57440390 CAGAGATCACATGCTTCACAAGG - Intronic
1138767496 16:59622161-59622183 CAGAGATCACGTGCTTCACAAGG + Intergenic
1138875333 16:60941997-60942019 CAGAGATCACGTGCTTCACAAGG - Intergenic
1139014161 16:62669594-62669616 CAAAGATCATATGCTTCAAAGGG - Intergenic
1139016076 16:62690425-62690447 CAGAGATCACATGCTTCCTAGGG - Intergenic
1139497965 16:67334958-67334980 CATAGATCACATGCTTCACAAGG + Intronic
1140060135 16:71561874-71561896 CAAGGATCACATGCTTCAAAGGG + Intronic
1140573645 16:76138087-76138109 CAAAGATCGCACGCTTCAAAGGG + Intergenic
1140589726 16:76337498-76337520 CAGGGATCACATGCTTCAGAGGG + Intronic
1140834478 16:78780620-78780642 CAAACATCACCTCCTTAAAATGG - Intronic
1141117481 16:81322646-81322668 TAAAAATCACAAGCATCAAATGG - Intronic
1142447067 16:90147616-90147638 CAGAGATCACATGCTTCACAAGG + Intergenic
1142460425 17:87715-87737 CAGAGATCACATGCTTCACAAGG - Intergenic
1143208635 17:5166120-5166142 GAAAAAACACGTGCTTCAAAAGG - Intronic
1143941029 17:10541601-10541623 CAGAGATCACATGCTTCACAAGG - Intronic
1144617962 17:16794231-16794253 GAAAAAACACGTGCTTCAAAAGG - Intronic
1144894743 17:18521452-18521474 GAAAAAACACGTGCTTCAAAAGG + Intergenic
1145137479 17:20422779-20422801 GAAAAAACACGTGCTTCAAAAGG - Intergenic
1145292453 17:21559339-21559361 CAGAGATCACATGCTTCACAAGG - Intronic
1145387509 17:22426564-22426586 CAGAGATCACATGCTTCACAAGG + Intergenic
1145801205 17:27686317-27686339 CAGAGATCACATGCTTCATAGGG + Intergenic
1145802243 17:27695193-27695215 CAGAGATCACATGCTTCATAGGG + Intergenic
1145819634 17:27822050-27822072 CAGAGATCACATGCTTCACAAGG + Intronic
1145869572 17:28262546-28262568 CAGAAATCACATGCTTCACAAGG - Intergenic
1145953962 17:28842097-28842119 GGAAGATGTCATGCTTCAAACGG - Intronic
1146544460 17:33726114-33726136 CAAAGAGCACAAAATTCAAATGG - Intronic
1146731869 17:35200039-35200061 CAGAGATCACATACTTCACAAGG - Intergenic
1147058976 17:37858814-37858836 CAGACATCACATGCTTCACAAGG - Intergenic
1147591416 17:41686157-41686179 CAGAGATCATGTGCTTCACAAGG - Intergenic
1147840169 17:43365830-43365852 CAGAGATCATGTGCTTCACAAGG + Intergenic
1149028214 17:52054517-52054539 CAGAGATCACATGTTTTACAAGG - Intronic
1149175013 17:53859153-53859175 CAAGGATCACATGCATCAAAGGG - Intergenic
1149196436 17:54127287-54127309 CAAAGATCACATGTTTTAAAAGG - Intergenic
1149207467 17:54264862-54264884 CAAAGATCACATGCTTTAAAAGG + Intergenic
1149857191 17:60093018-60093040 CAAAGATCACATGCTTTAAAGGG + Intergenic
1149915777 17:60607750-60607772 GAAAGATGACATTCTGCAAAGGG + Intronic
1150447388 17:65237585-65237607 CAGAGATCACGTGCTTCACAAGG - Intergenic
1150807669 17:68331883-68331905 CAGAGATCACATGCTTCACGAGG + Intronic
1151810176 17:76435351-76435373 CAAATATCACAACATTCAAAAGG - Intronic
1151864656 17:76793010-76793032 AAGAGATCACATGCTTCACAAGG + Intergenic
1152415254 17:80155942-80155964 CAAAGATCACATGCTTCAAAGGG - Intergenic
1152746382 17:82041744-82041766 CAGAGATCACATGCTTCAAAGGG + Intergenic
1152995775 18:405298-405320 CAAAGATCACATGCTTCTGAGGG - Intronic
1152995777 18:405348-405370 CAAAGATCACACGCTTCAAAGGG - Intronic
1153074194 18:1143983-1144005 CAAAGATCACATGCTTCAAAGGG + Intergenic
1153074197 18:1144017-1144039 ATAAGATCACATGCTTCTAAGGG + Intergenic
1153237661 18:3004231-3004253 CAAGGATCCCATGCTTCAAAGGG - Intronic
1153364254 18:4236125-4236147 CAAGGATCAGAGGCTTTAAATGG - Intronic
1153485470 18:5593468-5593490 CAGAGATCACGTGCTTCACAAGG + Intronic
1153889910 18:9503309-9503331 CAAAGATCACATACTTCAAAGGG - Intronic
1154089278 18:11342458-11342480 CAAAGATCACATGCTTCTGAGGG + Intergenic
1154444505 18:14423874-14423896 CAAAGATCACATGCTTTAAAGGG + Intergenic
1154525749 18:15288243-15288265 CAAAGATCACGTACTTCACAAGG - Intergenic
1155323442 18:24642392-24642414 AGTAGATCACATGCTTCAAAGGG + Intergenic
1155854540 18:30816308-30816330 CAGAGATCACGTGCTTCACAAGG - Intergenic
1155883519 18:31179640-31179662 CAAAGGTCACATGAATCAACTGG + Intergenic
1156282179 18:35650311-35650333 CAGAGTTCACATGCTTCACAAGG + Intronic
1156603614 18:38639642-38639664 CAAAGATCACATGCTTCAAAGGG + Intergenic
1156649887 18:39213153-39213175 CAGAGATCACGTACTTCACAAGG + Intergenic
1156761426 18:40596240-40596262 CAAAGATCACGTACTTCAGAAGG + Intergenic
1156993594 18:43439771-43439793 CAGAGATCACATTCTTCAAAAGG - Intergenic
1157461847 18:47904312-47904334 CAAAGATCCCCTGCCTCAAAGGG + Intronic
1157467670 18:47961425-47961447 CAGAGATCACATGCTTCACAAGG - Intergenic
1157643789 18:49245718-49245740 CAAAGATCACATGCTTCAAAGGG - Intronic
1157673856 18:49553491-49553513 CAGAGATCACATGCTTCACAAGG + Intergenic
1157706167 18:49808676-49808698 CAAAGATCATATGCTTCAAAGGG + Intronic
1157756257 18:50220375-50220397 CAAAGATCACATGCTTCAAAGGG + Intergenic
1157756263 18:50220428-50220450 CAAAGATCACATGCTTCTGAGGG + Intergenic
1157758613 18:50241730-50241752 TAAGGATCACATGCTTCAAAGGG + Intronic
1158141832 18:54264362-54264384 CAGAAAACACAGGCTTCAAAAGG - Intergenic
1158888070 18:61847891-61847913 CAAATATCACTTTCTTCAGAAGG + Intronic
1159023924 18:63165913-63165935 CAAAAATCACATGCCCCAAATGG + Intronic
1159043897 18:63350138-63350160 CAAAAATCACATGCTGAAAAAGG - Intronic
1159074594 18:63666114-63666136 CAGAGATCACGTGCTTCACAAGG - Intronic
1159079006 18:63714268-63714290 CAGAGATCACATGCTTCACAAGG + Intronic
1159280168 18:66274708-66274730 CAGAGATCACATGCTTCACAAGG - Intergenic
1159347750 18:67228559-67228581 CAAAGATCACATGCTTCAAAGGG - Intergenic
1159574253 18:70156538-70156560 CAAAAATCACGTGCTTCACAAGG - Intronic
1159686221 18:71424102-71424124 CAGAGATCACATGCTTCACAAGG - Intergenic
1159815734 18:73072049-73072071 CAAAGATCACATGCTTCAAAGGG - Intergenic
1159850138 18:73517202-73517224 CACAGATCACGTGCTTCACAAGG + Intergenic
1159930483 18:74307898-74307920 CAAAGATCACATGCTGCAAAGGG + Intergenic
1159986918 18:74853669-74853691 CAAAGATAACATGCTGGAAATGG - Intronic
1160288446 18:77568539-77568561 CAAAGATCACATGCTTCAAAGGG - Intergenic
1160620160 18:80164857-80164879 CAAAGATCACATGCTTCAAAAGG + Intronic
1160620163 18:80164910-80164932 CAAAGATCACATGCTTCTGAGGG + Intronic
1160650140 19:220215-220237 CAGAGATCACATGCTTCACAAGG - Intergenic
1160737284 19:669317-669339 CAAAGATCACTTGCTTCTGAGGG - Intergenic
1161904024 19:7141772-7141794 CAAAGATTTCATGCGTCACAGGG + Exonic
1162684108 19:12367345-12367367 CAAAGATCACATGCCTCAAAGGG + Intergenic
1162689521 19:12417690-12417712 CAAAGATCACATGCTCCAAAGGG - Intronic
1163942621 19:20508976-20508998 CAAAGATCACATGTTTCTAAGGG + Intergenic
1163959747 19:20677886-20677908 CAGAGATCACATGCTTCACAAGG - Intronic
1164013459 19:21230374-21230396 CAGGGATCACATGCTTCACAAGG - Intronic
1164025554 19:21348535-21348557 TAAGGATCACATACTTCAAAGGG + Intergenic
1164091875 19:21961332-21961354 CAAAGATCACATGCTTCAAAGGG + Intronic
1164237386 19:23349186-23349208 CAGAGGTCACATGCTTCAAAGGG - Intronic
1164288682 19:23847552-23847574 CAAAGATCACGTGCTTCAAAGGG + Intergenic
1164289801 19:23856849-23856871 CAAAGATCACGTGCTTCAAAGGG + Intergenic
1164326420 19:24196474-24196496 CAAAGATCACATGCTTCAAAGGG + Intergenic
1164329777 19:24243449-24243471 CAGAGATCACTTGCTTCACAAGG - Intergenic
1164330655 19:24251563-24251585 CAGAGATCACGTGCTTCACAAGG - Intergenic
1164332270 19:24271041-24271063 CAGAGATCACATGCTTCACAAGG - Intergenic
1164405811 19:27945028-27945050 CAAAGATCACATGCTTCTGAAGG - Intergenic
1164549587 19:29198062-29198084 CAGAGATCACGTGCTTCACAAGG + Intergenic
1165685429 19:37815985-37816007 CAAAGATCACATGCTTCAAAGGG - Intronic
1166165940 19:40988727-40988749 CAGAGATCACATGCTTCACAAGG - Intergenic
1166236766 19:41462480-41462502 CAGAGATCACATGCTTCAAATGG + Intergenic
1166426849 19:42686581-42686603 ACAAGATCACATGCTTCAAAGGG + Intronic
1166632634 19:44420639-44420661 CAGAGATCACATACTTCACAAGG - Intronic
1168712205 19:58508051-58508073 CAAAGATCACATGCTTCAAAGGG - Intronic
1202665171 1_KI270708v1_random:111810-111832 CAAGGGTCACATGCTTCAAAGGG + Intergenic
925319897 2:2955526-2955548 CAAAGAACAGATGGTACAAATGG + Intergenic
925393473 2:3515598-3515620 CAAAGATCACATGCTTCTGAGGG - Intronic
925393477 2:3515651-3515673 CAAATATCACAGGCTTCAAAGGG - Intronic
925456067 2:4017607-4017629 CAAAGATCACATGCTTCAAAGGG + Intergenic
925660640 2:6198782-6198804 CAAGGATCACATGCTTCAAAGGG - Intergenic
925869858 2:8260605-8260627 CAAACAACACATGTTTCAGACGG - Intergenic
925974699 2:9133664-9133686 CAAAGATCACATGCTTCAAAGGG + Intergenic
926528278 2:14009890-14009912 CAAGGATCACATGCTTCAAAGGG + Intergenic
926556290 2:14362120-14362142 CAGAGATTGCATGCTTCACAAGG + Intergenic
926643105 2:15258826-15258848 CAAAGATCACATGCTTCAAAGGG - Intronic
926859088 2:17290230-17290252 CAGGGATCACATGCTTCACAAGG + Intergenic
927195704 2:20544984-20545006 CAGGGATCACATGCTTCACAAGG + Intergenic
928491063 2:31783889-31783911 CAAAGATCACATGCTTCAAAGGG - Intergenic
928708395 2:33977035-33977057 CAGAGATCACGTGCTTCACAAGG - Intergenic
928901600 2:36324017-36324039 CAGAAATCACATGCTTCACAAGG - Intergenic
929254043 2:39790344-39790366 CAAAGATCACATGCTTTGAAAGG + Intergenic
929976776 2:46642796-46642818 CAGAGATCACATGCTTCAAAAGG + Intergenic
930300690 2:49612023-49612045 CAAAGATCTCATGCTTCTGAGGG - Intergenic
930423208 2:51179224-51179246 CAACGATCACATGTTTCAAAGGG - Intergenic
930489554 2:52051053-52051075 CAGAGATCACGTGCTTCAGAAGG - Intergenic
930595879 2:53387442-53387464 CAGAGATCACATGCCTCACAAGG + Intergenic
930976843 2:57473360-57473382 CAAATATCAGAATCTTCAAAAGG - Intergenic
932071925 2:68629090-68629112 ACAAGATCCCATGCTTCAAAGGG + Intronic
932375608 2:71233013-71233035 CAGAGATCACATGCTTCAAAGGG + Intergenic
932395606 2:71445349-71445371 CAAAGATCACATGCTTCAAAGGG - Intergenic
932484297 2:72073297-72073319 GAAAGATCACATGCTTCAAAAGG + Intergenic
932489582 2:72112161-72112183 CAGAGATCACGTACTTCACAGGG - Intergenic
932941957 2:76177379-76177401 CAGAGATCACATGCTTCACAAGG + Intergenic
933015158 2:77114824-77114846 CAAAGATCACGTGCTCCAAAGGG + Intronic
933082035 2:78002890-78002912 AAATGATCACAGGCCTCAAAAGG + Intergenic
933242057 2:79932925-79932947 CAAAGATCACAGGGATCAACAGG - Intronic
933333121 2:80920212-80920234 CAGAGATCACATGCTTCACAAGG - Intergenic
933401889 2:81809000-81809022 TAGGGTTCACATGCTTCAAAGGG + Intergenic
933459983 2:82570211-82570233 CAGAGATCACATGTTTCACAAGG - Intergenic
933611830 2:84444461-84444483 CAGAGATCATGTGCTTCACAAGG + Intronic
935142085 2:100362222-100362244 CAGAGATCACCTGCTTCACAAGG + Intergenic
935481184 2:103592265-103592287 CAAAGATCACATGCTTCTAAGGG - Intergenic
935481188 2:103592300-103592322 CAAAGATCACATGCTTCAAAGGG - Intergenic
935716147 2:105940590-105940612 CAAAGAACACCTGCATCAAGGGG + Intergenic
935751190 2:106235242-106235264 GCAAGATCACATGCTTCAAAGGG + Intergenic
935762100 2:106330539-106330561 CAAAGATCACATGCTTCAAAGGG + Intergenic
935762103 2:106330592-106330614 CAAGGATCACATGCTTCTGAGGG + Intergenic
935824150 2:106926748-106926770 CAAAGATCACATGCTTCAACGGG + Intergenic
935824155 2:106926801-106926823 CAAAGATCACATGCTCCTGAGGG + Intergenic
935955601 2:108373825-108373847 CAGAGATCACATGCTTCACAAGG - Intergenic
936160806 2:110083009-110083031 CAGAGATCACGTGCTTCACAAGG - Intergenic
936183857 2:110288345-110288367 CAGAGATCACGTGCTTCACAAGG + Intergenic
936874153 2:117168036-117168058 CAGAGATCACGTGCTTCACAAGG + Intergenic
937069850 2:119054711-119054733 ACAAGATCACATGCTTCAAAGGG + Intergenic
937112064 2:119373984-119374006 CAAAGATCACATGCTTCAAAAGG + Intergenic
937112068 2:119374037-119374059 CAAAGATGACATGCTTCTGAGGG + Intergenic
937591511 2:123618592-123618614 CAAGGATCACATGCTTCAAAGGG + Intergenic
937636206 2:124158015-124158037 TGAAGATGACATGCTGCAAATGG + Intronic
938308701 2:130270938-130270960 CAGAGATCACATGCTTCACAAGG + Intergenic
938507473 2:131901476-131901498 CAAAGATCACATGCTTCAAAGGG + Intergenic
938507475 2:131901511-131901533 CAAAGATCACATGCTTCTGAGGG + Intergenic
938524848 2:132119604-132119626 CAAAGATCACGTACTTCACAAGG - Intergenic
938557889 2:132442269-132442291 CAACGACCTCATGCTTCTAAGGG - Intronic
938616495 2:133004560-133004582 CAGAGATCACATGCTTCATAGGG + Intronic
938634353 2:133207090-133207112 CAAGGATCACATGCTTCAAAGGG - Intronic
938842586 2:135177369-135177391 CAAAGATCACATGCTTCCAAGGG + Intronic
938872826 2:135499011-135499033 CAGAGATCCCATGCTTCACAAGG - Intronic
939133191 2:138262491-138262513 CAAAGATCACATGCTTCTGAGGG - Intergenic
939133195 2:138262544-138262566 CAAAGATCACATGCTTCAAAAGG - Intergenic
939306205 2:140415362-140415384 CAAAGATCACATGCTTCAAAGGG - Intronic
939530520 2:143354435-143354457 CAAACAAAACATGGTTCAAATGG + Intronic
939537782 2:143453874-143453896 GATAGAACACATGCTTCAGAAGG + Intronic
939796803 2:146655482-146655504 CAAAGATCATGTACTTCACAAGG + Intergenic
939822054 2:146969649-146969671 CAAAGATCACATGCTTCAAAGGG + Intergenic
939826575 2:147022916-147022938 ACAAGGTCACATGCTTCAAAGGG + Intergenic
940276165 2:151943006-151943028 CAAAGATCACATGCTTCTAAGGG - Intronic
940276167 2:151943041-151943063 CAAAGATCTCATGCTTCAAAGGG - Intronic
940436604 2:153663984-153664006 CAAAGATCACATGCTTCAAAGGG + Intergenic
941073984 2:160986802-160986824 CAAAGATCACATGCTTCAAAGGG + Intergenic
941202246 2:162526206-162526228 CAGAGATCACATGCTTCACAAGG + Intronic
941571123 2:167172268-167172290 CAGAGATCACATGCTTCACAAGG + Intronic
942094699 2:172526017-172526039 CAAAGATCACATGCTTCAAAGGG - Intergenic
942108713 2:172659017-172659039 CAGAGATCACATGCATCATAGGG - Intergenic
942312901 2:174671934-174671956 CAGAGATCACATGCTTCACAAGG - Intronic
942380843 2:175388463-175388485 CGGAGATCACGTGCTTCACAAGG - Intergenic
942478274 2:176352928-176352950 CAGAGATCACATGCTTCACAAGG + Intergenic
942582265 2:177431276-177431298 CAAAGATCACATGCTTCAAAGGG + Intronic
942808395 2:179963978-179964000 CCAAATTCACATCCTTCAAAGGG + Intronic
942997202 2:182277144-182277166 CAAAGATCACATGCTTCAAAGGG - Intronic
943171556 2:184407418-184407440 CAAAGACCACATGCTTCAAAGGG - Intergenic
943213967 2:185006531-185006553 AAGAGATCACATGCTTCAAAGGG + Intergenic
943273326 2:185836156-185836178 AGTAGATCATATGCTTCAAAGGG - Intergenic
943502700 2:188711853-188711875 CAGAGATCACATGCTTCACAAGG - Intergenic
943846838 2:192660562-192660584 CAAAGATCACATGCTTCAAAGGG + Intergenic
943873020 2:193026021-193026043 CAAAGATCACATGCTTGAAAGGG - Intergenic
943942989 2:194022814-194022836 CAAAGGTCACATGCTTCAAAGGG + Intergenic
943942994 2:194022866-194022888 CAAAGATCACATGCTTCTAAGGG + Intergenic
944174730 2:196817052-196817074 CAAAGATTACATGCTTCAAAGGG + Intergenic
944244933 2:197521342-197521364 CAAAGATCACGTACTTCACAAGG + Intronic
944375857 2:199041331-199041353 CCATGAACACATGCTTAAAATGG - Intergenic
944395644 2:199263277-199263299 CAAAGATCACATGCTTCAAGGGG - Intergenic
944397123 2:199280868-199280890 CAGAGAGCACATGCTTCACAAGG - Intronic
944753291 2:202733200-202733222 CAAAGATCACATGCTATAAAGGG + Intronic
944760745 2:202811065-202811087 CAGAGATCACATACTTCACAAGG - Intronic
944780105 2:203008823-203008845 CAGAGATCACATACTTCACAAGG - Intronic
945010442 2:205456056-205456078 AAAAAGCCACATGCTTCAAAAGG - Intronic
945066640 2:205953180-205953202 CAGAGATCACGTGCTTCACAGGG + Intergenic
945386074 2:209202719-209202741 CAGAGATCACATGCTTCACAAGG + Intergenic
945472829 2:210246867-210246889 CAGAGATTACATGCTTCAAAGGG + Intergenic
945488294 2:210424698-210424720 CAGAGATTCCATGCTTCACAAGG + Intergenic
945536521 2:211025047-211025069 CAGAGATCATATGCTTCACAAGG + Intergenic
945611510 2:212010470-212010492 CAAAGATCACATGCTTCAAAGGG + Intronic
945611512 2:212010505-212010527 CAAAGATCACATGCTTCTGAGGG + Intronic
945723687 2:213449344-213449366 CAAAGATCACATGCTTCTGAGGG - Intronic
945897244 2:215497554-215497576 CAGAGATCACGTGCTTCACAAGG - Intergenic
946045433 2:216817275-216817297 CAAAGATCTACTACTTCAAATGG + Intergenic
946125816 2:217561813-217561835 CAAAAATCACATGCTTCAAAGGG - Intronic
946562860 2:220932229-220932251 CAATGATCAGTTGCTTCCAAAGG + Intergenic
946955775 2:224928684-224928706 CAAATGTCACATCCTCCAAATGG - Intronic
947071387 2:226291765-226291787 CAAAGATCACATACTTCAAAGGG - Intergenic
947270403 2:228327913-228327935 CAGAGATCACATGCTTCACAAGG + Intergenic
947361718 2:229352091-229352113 GAAAGATGACATGGTTGAAATGG - Intergenic
948986248 2:241526258-241526280 CAAAGATCACATGCTTCAAAGGG - Intergenic
1168907840 20:1420854-1420876 CAAAGATCAGATGGTTTATAGGG + Intergenic
1169613730 20:7414262-7414284 CAGAGATCACATGCTTCACAAGG + Intergenic
1170506159 20:17027765-17027787 CAGAGATCACATGCTTCACAAGG - Intergenic
1170560006 20:17549119-17549141 CCAAGATCAAGTGCTGCAAAAGG - Intronic
1170684182 20:18554097-18554119 CAAAAATGACAAGCTTCAGAGGG - Intronic
1170788800 20:19491080-19491102 GCAAGTTCACATGCTTCAAATGG - Intronic
1171232213 20:23496456-23496478 CAGAGATCACATGCTTCACAAGG + Intergenic
1171492438 20:25530765-25530787 CAGAGATCACGTGCTTCATAAGG + Intronic
1172865415 20:38092967-38092989 AACATATCACTTGCTTCAAAAGG - Intronic
1173566567 20:44043055-44043077 AAAACTTCACATGCTGCAAATGG - Intronic
1176210224 20:63916476-63916498 ACAAGATCACATGCTTCAAAGGG + Intronic
1176269623 20:64229068-64229090 CCAACATCACATCCTTCAGACGG + Intronic
1176451477 21:6865987-6866009 CGAAGATCACATGCTTTAAAGGG - Intergenic
1176458176 21:6930873-6930895 CAGGGATCACATGCTTCAAAGGG + Intergenic
1176771678 21:13080244-13080266 CAAAGATCACGTACTTCACAAGG + Intergenic
1176786155 21:13258815-13258837 CAAAGATCACATGCTTCTGAGGG - Intergenic
1176786157 21:13258850-13258872 CAAAGATCACATGCTTCAAAGGG - Intergenic
1176829645 21:13731038-13731060 CGAAGATCACATGCTTTAAAGGG - Intergenic
1176836350 21:13795968-13795990 CAGGGATCACATGCTTCAAAGGG + Intergenic
1176879973 21:14180296-14180318 CAAAGATCACATGCTTCAAAGGG - Intronic
1176885464 21:14250049-14250071 CAAAGATCACATGCTTCAAAGGG - Intergenic
1177194591 21:17890084-17890106 GAAAGATGACATGCTTTAACTGG - Intergenic
1177213300 21:18096781-18096803 CAGAGATCACATGCTTCAAAAGG - Intronic
1177588821 21:23135253-23135275 CAGAGATCACATGCTTCACAAGG + Intergenic
1177768588 21:25488695-25488717 CATAGATGACATGGTTCAAGAGG - Intergenic
1177984762 21:27960843-27960865 CAAAGATCACATGCTTCTGAGGG - Intergenic
1177984764 21:27960878-27960900 CAAAGATCACATGCTTCAAAGGG - Intergenic
1178014542 21:28328931-28328953 CAGAGATCACGTGCTTCACAAGG + Intergenic
1178309871 21:31520911-31520933 GAAAGAACACCTGCTTCATAAGG + Intronic
1178528473 21:33354039-33354061 CAAGAATCACAGGCTTTAAACGG - Intronic
1178858242 21:36267894-36267916 CAGAGATCACATGCTTCAAAGGG + Intronic
1178858246 21:36267947-36267969 CAAAGATCACATACTTTTGAGGG + Intronic
1179003108 21:37482485-37482507 CAGAGATCACATACTTCACAAGG + Intronic
1179425273 21:41273128-41273150 CAGAGATCACATACTTCACAAGG + Intronic
1179660965 21:42874885-42874907 CAGAGATCACATGCTTCACAAGG - Intronic
1180234408 21:46448756-46448778 CAAAGATCACATGCTTCAAAGGG + Intergenic
1180331893 22:11488730-11488752 CAAGGGTCACATGCTTCAAAGGG + Intergenic
1180436565 22:15310503-15310525 TAAAGATCACATACTTCACAAGG + Intergenic
1180518805 22:16174691-16174713 TAAAGATCACGTACTTCACAAGG + Intergenic
1180894532 22:19320107-19320129 CAGAGATCACGTGCTTCACAAGG + Intergenic
1180990898 22:19935523-19935545 CAAAGATCACATGCTTCAAAGGG - Intronic
1181377226 22:22469249-22469271 CAGAGGTCACATGCTTCGCAAGG - Intergenic
1181536252 22:23547649-23547671 CAAAGATCACATGCTTCAAAGGG - Intergenic
1181758794 22:25043563-25043585 CAGAGATCAGAAGCTTCAAAGGG - Intronic
1181833659 22:25583808-25583830 CAAAGATTTGATTCTTCAAATGG + Intronic
1182486017 22:30639297-30639319 CAGAGACCACGTGCTTCACAAGG + Intronic
1183171314 22:36190231-36190253 CAAAGATCACCTACTTCACAAGG + Exonic
1183174055 22:36209554-36209576 CAAAGATCACATGCTTCAAAGGG + Intergenic
1183174059 22:36209607-36209629 CAAAGATCACATGCTTCTGAGGG + Intergenic
1184062965 22:42095994-42096016 CAGAGATCACATGCTTCACAAGG - Intergenic
1184868894 22:47220398-47220420 CAAAGATCACTGACTGCAAAAGG - Intergenic
949213638 3:1537251-1537273 CAAAGATCACATGCTTCAAAGGG - Intergenic
949217537 3:1587719-1587741 CAAAGATCATATGCTTCTGAGGG - Intergenic
949217541 3:1587772-1587794 CAAAGATCACATGCTTCAAAGGG - Intergenic
949231303 3:1754161-1754183 CAAAGATCACATGCTTCAAAGGG + Intergenic
949366952 3:3292168-3292190 CAAAGATCACATGCTTCAAAGGG - Intergenic
949783078 3:7711760-7711782 CAAAGATCAGCTCCTTCCAAAGG + Intronic
949787913 3:7761975-7761997 CAGAGATCACATGCTTCACAAGG - Intergenic
950073250 3:10169158-10169180 CAGAGATCACATTCTTCAAAGGG + Intronic
950807544 3:15619945-15619967 CAAAGATCACATGCTTCAAAGGG + Intronic
950807549 3:15619998-15620020 CAAAGATCACATGCTTCTGAGGG + Intronic
950819006 3:15738372-15738394 CAGAGATCACATGCTTCACAAGG + Intronic
951080988 3:18449554-18449576 CAAAGATCACCTGCTTCAAAGGG + Intergenic
951212255 3:19988581-19988603 CAGAGATCACATGCTTCACAAGG - Intronic
951240722 3:20283256-20283278 CAAAGATCACATGCTTCTGAGGG - Intergenic
951240726 3:20283309-20283331 CAAAGATCACATGCTTCAAAGGG - Intergenic
951399542 3:22214880-22214902 CAGACATCACGTGCTTCACAAGG - Intronic
951399642 3:22215714-22215736 CAGAGATCACATGCTTCACAAGG - Intronic
951842774 3:27051950-27051972 CAAGGATCACATGCTTCAAAGGG - Intergenic
951859550 3:27236703-27236725 CAAAGATCACATGCCTTAAAGGG + Intronic
951978476 3:28540669-28540691 CAAAGTTCACATTCTTTAAAGGG + Intergenic
952051851 3:29393864-29393886 CAAAGATCACATGCTTGAAAGGG + Intronic
952293758 3:32042776-32042798 ACAAGATCACATGCTTCAAAGGG + Intronic
952399812 3:32953067-32953089 CAAAGAACACCTGCTTGAAAGGG + Intronic
952699933 3:36316826-36316848 CAAAAATCAGAGGCTTAAAAAGG - Intergenic
952725342 3:36578352-36578374 CAGAGATCACATGCTTCACAAGG + Intergenic
953119477 3:40025806-40025828 CAAAGATCACATGCTTCAAAGGG + Intronic
953488379 3:43325063-43325085 TAAAAATCACCTGCTGCAAATGG - Intronic
953519629 3:43628980-43629002 CAGAGATCACGTACTTCACAAGG - Intronic
953664584 3:44916774-44916796 CAGACACCACAGGCTTCAAATGG + Intronic
953846583 3:46432305-46432327 CAAAGATCACATGCTTCAAAGGG - Intergenic
953987911 3:47459646-47459668 ACAAGATCACATGCTTCAAAGGG + Intronic
954219240 3:49142657-49142679 CAGAGATCACATGCTTCACAAGG + Intergenic
954738687 3:52729110-52729132 CAAAGATCACATGCTTCAAAGGG - Intronic
955197326 3:56817196-56817218 CAAATAGCACCTACTTCAAAGGG + Intronic
955573556 3:60333348-60333370 CATAGATCCCTTGCTTCTAATGG + Intronic
956131308 3:66056274-66056296 CAGAGATAACGTGCTTCACAAGG + Intergenic
956220593 3:66898619-66898641 CAAAGATCACATGCATCAAAGGG - Intergenic
956235066 3:67060513-67060535 CAGAGATCACATGCTTCACAAGG - Intergenic
956715448 3:72075797-72075819 CAGAGATCACATGCTTCCTAGGG + Intergenic
957064651 3:75511604-75511626 CAAAGATCACATGCTTCTGAGGG - Intergenic
957064655 3:75511657-75511679 CAAAGATCACATGCTTCAAAGGG - Intergenic
957373488 3:79326260-79326282 CAGAGATCACCTGCTTCACAAGG - Intronic
957444701 3:80300689-80300711 CAAAGAACACTTGGTTCATAAGG - Intergenic
957457185 3:80466885-80466907 CAGAGATCACGTGCTTCACAAGG + Intergenic
957469163 3:80636263-80636285 CAGAGATCACGTGCTTCACAAGG + Intergenic
957623053 3:82620679-82620701 CAGAGATCACATGTTTCATAGGG + Intergenic
957874793 3:86131247-86131269 CAAAGATCACATACTTCATAAGG + Intergenic
957926573 3:86821886-86821908 CAGAGATCACATGCCTCACAAGG + Intergenic
958424415 3:93964668-93964690 CAAAGATCACATGCTTCAAAGGG - Intronic
958497208 3:94860692-94860714 CAAAGATCACATACTTCAAAGGG - Intergenic
958561755 3:95757055-95757077 CAAAGATCAGATGGTTGAAATGG + Intergenic
958603406 3:96327961-96327983 CAGAGATCACTTGCTTCACAAGG - Intergenic
958621878 3:96572969-96572991 CAAAGATCACATACTTCAAAGGG + Intergenic
958684231 3:97372083-97372105 CAGAGATCACATGCTTCACAAGG - Intronic
958756418 3:98254666-98254688 AGTAGATGACATGCTTCAAAGGG + Intergenic
958761219 3:98310848-98310870 CAGAGATCACATGCTTCACAAGG + Intergenic
959126397 3:102294767-102294789 CAGAGATCACATGCTTCACAAGG - Intronic
959220030 3:103506588-103506610 CAAAGACCACATGCTTCAAAGGG + Intergenic
959224681 3:103564548-103564570 CAGAGATCACATGCTTCAAAAGG - Intergenic
959261695 3:104090332-104090354 CAAAGATCACATGCCTCTGAGGG - Intergenic
959470572 3:106744770-106744792 CAGAGATCACGTACTTCACAAGG - Intergenic
959729443 3:109584146-109584168 CAAGGATCACATGCTTCAAAGGG - Intergenic
959888012 3:111524905-111524927 CAAAGATCACATGCTTCAAAGGG - Intronic
959888673 3:111530210-111530232 CAAAGATCACATGCTTCAAAGGG - Intronic
960011943 3:112842998-112843020 CAAAGATCACATGCTTCTGAGGG - Intronic
960112817 3:113862029-113862051 CAGAGATCACATGCTTCACAAGG + Intronic
960325018 3:116285184-116285206 AAAAGATCACCTGGTGCAAATGG - Intronic
960541304 3:118865369-118865391 CAGAGATCACATGCTTCACAAGG - Intergenic
960646386 3:119889102-119889124 CCAAGATCACATGTTTCATAGGG - Intronic
960666778 3:120117091-120117113 CAAAGGTTACATGCTTCAAAGGG - Intergenic
960889872 3:122436352-122436374 CAGAGATCACATACTTCACAAGG - Intronic
960890611 3:122443765-122443787 CAGAGATCACATGCTTCAAAAGG + Intronic
961264692 3:125632388-125632410 CATAGAGCACAGGCTTCAAGGGG - Intergenic
961288697 3:125827737-125827759 CAAAGATCACATGCGTCAAAGGG + Intergenic
961288701 3:125827790-125827812 AAAAGATCACATGCTTCTGAGGG + Intergenic
961372070 3:126437388-126437410 GAATGAACACATACTTCAAAAGG + Intergenic
961898368 3:130188246-130188268 GAAAGATCACATGCTTCTGAGGG - Intergenic
961898372 3:130188299-130188321 CAAAGATCATATGCTTCAAAGGG - Intergenic
961923639 3:130452562-130452584 CAGAGATCACGTACTTCACAAGG + Intronic
962290372 3:134131292-134131314 CAGAGATCACATGCTTCACAAGG + Intronic
962497553 3:135957189-135957211 CAGAGATCACATGCTTCAAAGGG + Intergenic
962651585 3:137499155-137499177 CAGAGATCCCATGCTTCACAAGG - Intergenic
962758491 3:138486325-138486347 CAAAGATCACATGCTTCAGAGGG + Intergenic
962764158 3:138546022-138546044 CGAAGATCACATGCTTTAAAGGG - Intronic
962765299 3:138556787-138556809 CAGAGATCACGTACTTCACAAGG + Intronic
963176545 3:142303851-142303873 CAAAGGTCACGTACTTCACAAGG + Intergenic
963343997 3:144071810-144071832 CAAAGATCACATGCTTTAGAGGG + Intergenic
963349692 3:144137440-144137462 CAGAGATCATGTGCTTCACAAGG + Intergenic
963414932 3:144983336-144983358 CAGAGATCACATGCTTCACAAGG + Intergenic
963473251 3:145771150-145771172 CAAAGATCACATGCTTCAAAGGG + Intergenic
963874410 3:150458071-150458093 TTAAAATCACATGCTTAAAATGG - Intronic
964180215 3:153874472-153874494 CAAAGATCACATGCTTCAAAAGG + Intergenic
964180220 3:153874525-153874547 CAAAGATCACATGCTTCTGAGGG + Intergenic
964196255 3:154068178-154068200 CAGAGATCATGTGCTTCACAAGG - Intergenic
964612975 3:158633401-158633423 CAAGGATCACATGCTTCAAAGGG + Intergenic
964908173 3:161744140-161744162 CAGAGATCACATGCTTCACAAGG - Intergenic
964945907 3:162223162-162223184 CAGAGATCACATGCTTCACAAGG - Intergenic
965068080 3:163878369-163878391 CAGAGATCACATGCTTCAAAAGG + Intergenic
965400703 3:168209326-168209348 CAGAGATCACATGCTTCGCAAGG + Intergenic
965928899 3:174017759-174017781 CAGAGATCACATGCTTCACAAGG + Intronic
967265326 3:187686374-187686396 CGAGGATCACATGCTTCAAAGGG - Intergenic
967300851 3:188010594-188010616 CAAAGATCACATGCTTCAAAGGG + Intergenic
967335557 3:188340183-188340205 CAAAGATCACATGGTTAACATGG - Intronic
967412750 3:189183297-189183319 CAGAGATCACATACTTCACAAGG + Intronic
967651704 3:191993909-191993931 CAGAGATCACATGCTTCACAAGG + Intergenic
967701967 3:192603700-192603722 CAAAGATCACATGCCTCAAAGGG + Intronic
968041065 3:195589704-195589726 CAAAGATCACATGCTTCAAAAGG + Intergenic
968041069 3:195589757-195589779 CAAAGATCACATGCCTCTGAGGG + Intergenic
968128752 3:196179693-196179715 CAAAGACCACATGCTTCAGCTGG - Intergenic
968367707 3:198199914-198199936 CAGAGATCACATGCTTCACAAGG + Intergenic
969008551 4:4041710-4041732 CAAAGATCACATGCTTCTGAGGG - Intergenic
969008555 4:4041763-4041785 CAAAGGTCACATGCTTCAAAGGG - Intergenic
969126126 4:4949582-4949604 CCAAGATCTCATGCATCCAACGG + Intergenic
969745128 4:9064613-9064635 CAAAGGTCACATGCTTCAAAGGG + Intergenic
969745132 4:9064666-9064688 CAAAGATCACATGCTTCTGAGGG + Intergenic
969804419 4:9595627-9595649 CAAAGATCACATGCTTCAAAGGG + Intergenic
969804423 4:9595680-9595702 CAAAGATCACATGCTTCTGAGGG + Intergenic
969885723 4:10213591-10213613 CAAAGATCACATGCTTCTGAGGG + Intergenic
970448644 4:16145423-16145445 AGTAGATCACATGCTTCAAAGGG - Intergenic
970719567 4:18970673-18970695 CAAGGATCACATGCTTCAAAGGG + Intergenic
970722309 4:19002189-19002211 CAAAGATCACATGCTACAAAGGG + Intergenic
970742618 4:19255549-19255571 CAGAGATCACATGCTTCACAAGG + Intergenic
970956514 4:21817952-21817974 CAAAGATCACATGCTTCTGAGGG - Intronic
970980121 4:22086344-22086366 CAAAGATCACATGCTTCAACGGG + Intergenic
971324424 4:25632476-25632498 CAAAAATTACTTACTTCAAAGGG + Intergenic
971332244 4:25691480-25691502 CAGAGATCACATGCTTCAGTGGG + Intergenic
971332246 4:25691507-25691529 AAAAGATCACATGCTTCAGTGGG + Intergenic
971365853 4:25976634-25976656 CAGAGATCATGTGCTTCACAAGG - Intergenic
971405142 4:26315449-26315471 CAAAGATCACATACTTCAAACGG + Intronic
971586303 4:28409028-28409050 CAGAGATCATGTGCTTCACAAGG + Intergenic
971603829 4:28631410-28631432 CAGAGATCACATGCTTCAAAGGG + Intergenic
971718690 4:30215916-30215938 CGGAGATCACATGCTTCACAAGG + Intergenic
971753823 4:30682748-30682770 CAAAGATCACACGCTTCAAAGGG + Intergenic
971846748 4:31928493-31928515 AGTAGATCACATGCTTCAAAGGG - Intergenic
971899883 4:32646106-32646128 CAGAGATCACATGCTTCACAAGG - Intergenic
972000345 4:34023940-34023962 CAAAGATAGCATTCTTTAAAGGG + Intergenic
972038198 4:34553954-34553976 CAGAGATCACATGCTTCACAAGG + Intergenic
972362367 4:38338894-38338916 CAAGGATCACATGCTTCAAAGGG + Intergenic
972527339 4:39928323-39928345 AAAAGATCACAAGCATGAAACGG + Intronic
972940724 4:44191891-44191913 CAAAGATCACATGCTTCAAATGG - Intronic
973223295 4:47753232-47753254 CAAAGATCACATGCTTTAAAGGG + Intronic
973244013 4:47990579-47990601 CAAGGATTACATGCTTCAACGGG - Intronic
973307471 4:48668911-48668933 CAAAAATCAAATGCTATAAAGGG - Intronic
973585910 4:52390884-52390906 CAGAGATCACATGCTTCACAAGG - Intergenic
973659081 4:53083887-53083909 CAAAGATCACATGCTTCTCAGGG + Intronic
973799926 4:54467382-54467404 TAAAGATCACATGCTTCTGAGGG - Intergenic
973943725 4:55936330-55936352 CAGAGATCTCATGCTTCACAAGG - Intergenic
974050215 4:56934652-56934674 CAAACATCACATTTTTCAAATGG - Exonic
974164622 4:58185431-58185453 CAAATATCACATGCTTTAAAGGG + Intergenic
974185491 4:58440350-58440372 CAAAGATCACATGCTTAAAAGGG + Intergenic
974185493 4:58440385-58440407 CAAAGATCACATGCTTTTGAGGG + Intergenic
974199469 4:58620389-58620411 CAGAGATCACATGCTTCACAAGG - Intergenic
974208826 4:58743188-58743210 CAAAGATCAGGTACTTCACAAGG + Intergenic
974214715 4:58829748-58829770 CAGAGATCACATGTTTCACAAGG + Intergenic
974230864 4:59111948-59111970 CAAAGATCATATGCTTCAAAGGG - Intergenic
974245288 4:59307257-59307279 CAATGATCACATGCTTCTCATGG + Intergenic
974605735 4:64147269-64147291 CAAAGATCACATGCTTCAAAGGG + Intergenic
974645631 4:64687538-64687560 AGTAGATCACATGCTTCAAAGGG - Intergenic
974741430 4:66013180-66013202 CAAAGATCACATGTTTCTGAGGG - Intergenic
974741436 4:66013233-66013255 CAAAGATCCCATATTTCAAAGGG - Intergenic
974961236 4:68703601-68703623 CAAGGATCACATGCTTCAAAGGG - Intergenic
974983347 4:68989469-68989491 CAGAGATCACGTGCTTCACAAGG - Intergenic
974998368 4:69192062-69192084 CAAAGATCACATGCTTCTGAGGG - Intronic
974998370 4:69192097-69192119 CAAAGATCACATGCTTCAAAGGG - Intronic
974999191 4:69198943-69198965 CAAAGATCACATGCTTCTGAGGG - Intronic
974999194 4:69198978-69199000 CAAAGATCACATGCTTCAAAGGG - Intronic
975006595 4:69296305-69296327 CAAAGATCACATGCTTCTGAGGG + Intronic
975016263 4:69424619-69424641 CAAAGATCACATGCTTCATAGGG + Intergenic
975016266 4:69424654-69424676 CAAAGATCACATGCTTCTCAGGG + Intergenic
975024929 4:69535873-69535895 CAAAGATCACGTACTTCACAAGG - Intergenic
975228685 4:71905776-71905798 AAAAGATCACATGCTTCTGAGGG - Intergenic
975228689 4:71905828-71905850 CAAAGATCACATGCTTCAAAGGG - Intergenic
975402454 4:73953381-73953403 CAGAGATCACATGCTTCACAAGG + Intergenic
975587530 4:75965441-75965463 CAGAGATCACATGCTTCACAAGG - Intronic
975722750 4:77264096-77264118 CAAAGATCACACACTTCAAAGGG + Intronic
975722755 4:77264148-77264170 CAAAGATCACATACTTCTCAGGG + Intronic
975729098 4:77320198-77320220 CAAAGATCACATGTTTCAAAGGG + Intronic
975790601 4:77945796-77945818 CAAAGATCACATGCTTCAAAGGG + Intronic
975819223 4:78252833-78252855 CAAAGACCACATGCTTCAAAGGG + Intronic
975897930 4:79117473-79117495 TAAAAATCACATGCTTCAAAGGG - Intergenic
976023668 4:80662156-80662178 CAGAGATCACATGCTTCACAAGG - Intronic
976437460 4:85034357-85034379 CAGAGATCACATGCTTCACAAGG - Intergenic
976636741 4:87293800-87293822 CAAAGAACACATGATTCAAAAGG + Intergenic
976645643 4:87384823-87384845 CAAAGATCACATGCTTCAAAGGG - Intronic
976649355 4:87418605-87418627 CAAAGATCACATGCTTCAAAGGG - Intergenic
976693026 4:87889123-87889145 CAGAGATCACATGCTTCAGAAGG + Intergenic
976741794 4:88364209-88364231 CAAAGATTACATGCTTCAGAGGG + Intergenic
976803120 4:89015290-89015312 CAGAGATCACGTGCTTCACCAGG - Intronic
976971155 4:91104281-91104303 CAAATATCACATGCTTCAAAGGG - Intronic
977354367 4:95926704-95926726 CAAAGTTCACATGCTTCAAAGGG - Intergenic
977473534 4:97473642-97473664 CAGAGATCACGTGGTTCACAAGG - Intronic
977548371 4:98412872-98412894 CAAAGATCACGTGCTTTACAGGG + Intronic
977556512 4:98492251-98492273 GAAATATGACATGCTTCACAAGG - Intronic
977674611 4:99733416-99733438 CAGAGATCACATGCTTCAAAAGG + Intergenic
977720193 4:100230784-100230806 AGTAGATCACATGCTTCAAAGGG + Intergenic
977720196 4:100230819-100230841 CAAAGATCACATGCTTCAAAGGG + Intergenic
977927623 4:102718919-102718941 CAAAGATCACATGCTTCAAAGGG + Intronic
978023870 4:103848277-103848299 CAAAGATCATGTACTTCACACGG + Intergenic
978023998 4:103849352-103849374 CAAAGATCACATGCTTCTGAGGG - Intergenic
978024002 4:103849405-103849427 CAAAGATCACATGCTTCAAAGGG - Intergenic
978036547 4:104002255-104002277 CAGAGATCACATGCTTCAAATGG + Intergenic
978193759 4:105946671-105946693 GCAAGATCACATGCTTCAAAGGG + Intronic
978467301 4:109022055-109022077 CAAAGATCACATGCTTCAAGGGG - Intronic
978734795 4:112073586-112073608 CAAGGATCACATACTTCAAAGGG - Intergenic
979027241 4:115593005-115593027 ACAAGATCACATGCTTCAAAGGG - Intergenic
979075123 4:116261218-116261240 CAAAGATCACATGCTTCTGAGGG - Intergenic
979075126 4:116261271-116261293 CAAAGATCACATGCTTCAAAGGG - Intergenic
979256125 4:118609625-118609647 CAGAGATCACGTGCTTCACAAGG + Intergenic
979332222 4:119430912-119430934 CAGAGATCACATGCTTCACAAGG - Intergenic
979400584 4:120244925-120244947 CAAAGATCACATGCTTCAAAGGG + Intergenic
979400587 4:120244960-120244982 CAAAGGTCACATGCTTCTGAGGG + Intergenic
979503581 4:121467849-121467871 CAAAGATCACATGCTTTAAAGGG + Intergenic
979765617 4:124462046-124462068 CAAAGATCGCATGCTTCAAAGGG - Intergenic
979793166 4:124812074-124812096 CAAAGATCACATGCTTCAAAGGG + Intergenic
979793169 4:124812127-124812149 CAAAGATCACATGCTTCTGACGG + Intergenic
979810849 4:125033964-125033986 CAAAGATCACATGCTTCTGAGGG - Intergenic
979810851 4:125033999-125034021 CAAAGATCACATGTTTCAAAGGG - Intergenic
980046634 4:127996476-127996498 CAAGGATCACATGCTTCAAAGGG + Intronic
980158166 4:129131737-129131759 CAAAGATCACATGCTTCAAAGGG - Intergenic
980180916 4:129399500-129399522 CAAAGATCACATGCTTCAAAGGG + Intergenic
980232010 4:130057385-130057407 CAGACATCACATACTTCATAAGG - Intergenic
980245973 4:130243416-130243438 CAAAGATCATGTACTTCACAAGG + Intergenic
980278274 4:130684052-130684074 CAGAGATCACGTGCTTCACAAGG + Intergenic
980298582 4:130957526-130957548 ACAAGATCACATGCTTCAAAGGG + Intergenic
980337601 4:131496226-131496248 CAAAGGTCACATGCATCAAAGGG + Intergenic
980509340 4:133764348-133764370 CTAAGATGAAATGTTTCAAATGG - Intergenic
980539279 4:134172365-134172387 CAAAGATCACATGTTTGTAGGGG - Intergenic
980600488 4:135018593-135018615 CAAAGATCACATGCTTCAAAGGG + Intergenic
980600494 4:135018646-135018668 CAAAGATCACATGCTTCTGAGGG + Intergenic
980760704 4:137230128-137230150 CAGAGATCACATGATGTAAATGG + Intergenic
980954536 4:139415044-139415066 CAAAGATCACATGCTTCAAAGGG - Intronic
980978367 4:139632965-139632987 ACAAGATCACATGCTTCAAAGGG - Intergenic
980979089 4:139638792-139638814 ACAAGATTACATGCTTCAAAGGG - Intergenic
981190400 4:141855848-141855870 CAAGGATCACATGCTTCAAAGGG - Intergenic
981401183 4:144315213-144315235 AATAGATCACATGCTTCAAAGGG + Intergenic
981412043 4:144443108-144443130 CAAAGATAACATATTTAAAAGGG - Intergenic
981421114 4:144551323-144551345 CAGAGATCACGTGCTGCACAAGG + Intergenic
981424521 4:144587824-144587846 CAAGGATCACATGCTTCAAAGGG + Intergenic
981448388 4:144867116-144867138 CAGAGATCACATGCTTCACAAGG - Intergenic
981754194 4:148123414-148123436 CAAAGATCACATGCTTCTGAGGG - Intronic
981754199 4:148123467-148123489 CAAAGATCACATGCTTCAAAGGG - Intronic
982190598 4:152851085-152851107 GTAACATCTCATGCTTCAAAAGG - Intronic
982209755 4:153024865-153024887 CAAAGATCATATGCTTCTTGAGG - Intergenic
982479408 4:155891047-155891069 CAAAGATCACATGCTTCAAAGGG + Intronic
982480106 4:155898326-155898348 CAAAGATCACATGCTTCAAAGGG + Intronic
982480111 4:155898379-155898401 CAAAGATCACATGCTTCTGAGGG + Intronic
982513638 4:156317158-156317180 CAAAGATCACATGTTTCAAAGGG + Intergenic
982727480 4:158920810-158920832 CAAAGATCACATGCTTCTGAGGG - Intronic
982727482 4:158920845-158920867 CAAAGATCACATGCTTCAAAGGG - Intronic
982807899 4:159789312-159789334 CAGAGATCACATGCTTCACAAGG - Intergenic
982887336 4:160798097-160798119 CAAAGATCACATGCTTCAAAGGG + Intergenic
982903795 4:161042713-161042735 CAGAGATCACATGCTTCACAAGG + Intergenic
983032268 4:162817777-162817799 ACAAGATCACATGCTTCAAAGGG - Intergenic
983189625 4:164741154-164741176 CAAATATCACATGCTTCAAAGGG - Intergenic
983190954 4:164752962-164752984 CAAAGATCACATGCTTATGAGGG - Intergenic
983190956 4:164752997-164753019 AAAAGATCACATGCTTCAAAGGG - Intergenic
983303396 4:165956053-165956075 CAAAGATCACATGCTTCAAAGGG + Intronic
983303398 4:165956088-165956110 CAAAGATCACATGCTTCTGAGGG + Intronic
983745793 4:171198633-171198655 TAAATATCACATGATTCAACAGG - Intergenic
983759498 4:171387470-171387492 AAAAGATCACATGCTTGTGAGGG + Intergenic
983884929 4:172970090-172970112 CAAAGATCACATGCTTCAAAGGG + Intronic
984064234 4:175028333-175028355 CAGAGATCACGTGTTTCACAAGG + Intergenic
984157809 4:176212633-176212655 AGTAGATCACATGTTTCAAAGGG - Intergenic
985037718 4:185857985-185858007 CAGAGATCACATACTTCAAAGGG - Intronic
985115058 4:186582487-186582509 CAAAGATCACATGCTCCTGAGGG - Intergenic
985115062 4:186582540-186582562 CAAAGATCACATGCTTCAAAGGG - Intergenic
985362371 4:189189278-189189300 CAAAGATCACATGCTTCAAAGGG + Intergenic
985362375 4:189189331-189189353 CAAAGATCACATGCTCCTGAGGG + Intergenic
986718137 5:10538691-10538713 CAAGGATCAAAGGCTGCAAAGGG - Intergenic
986950128 5:13072853-13072875 CAAAGATCACATGCTTTAAAGGG + Intergenic
987571907 5:19675158-19675180 CAGAGATCACATGCTTCACAAGG + Intronic
987836962 5:23174298-23174320 CAAAGATCAGATGGTTGTAAAGG + Intergenic
987902569 5:24031653-24031675 CAAAGATCACATGCTTCTGAGGG - Intronic
987978240 5:25044106-25044128 CAAAGATCACATGCTTCAAAGGG + Intergenic
988092038 5:26555653-26555675 CAAAGATCAAGTGCTCCAATGGG - Intergenic
988155233 5:27441302-27441324 CAAATAGGACATGGTTCAAAGGG + Intergenic
988240311 5:28599761-28599783 CAGAGATCACATGCTTCACAAGG - Intergenic
988245486 5:28675198-28675220 CAGAGACCACATGCGTCACAAGG + Intergenic
988396647 5:30704431-30704453 CAAAGATCACATGCTTTAAGGGG + Intergenic
988637281 5:32998378-32998400 CAGAGATCACATGCTGAAAGAGG - Intergenic
988717765 5:33844703-33844725 CAGAGATCACGTGCTTCACAAGG - Intronic
988734874 5:34010296-34010318 CAAAGATCACATGCTTCAAAGGG + Intronic
989317906 5:40103731-40103753 CAGAGATCACGTGCTTCACAAGG - Intergenic
989318939 5:40112530-40112552 CAGAGATCACATGCTTCACAAGG - Intergenic
989387123 5:40865184-40865206 GAAAGATCACATGCTTCAAAGGG - Intergenic
989420295 5:41230655-41230677 CAAGGATCATATGCTTCAAAGGG - Intronic
989455085 5:41634807-41634829 CAAAGATCATATACTTCACAAGG - Intergenic
989572254 5:42955500-42955522 CAAAGATCACATACTTCACAAGG + Intergenic
989624381 5:43415437-43415459 CAGAGATCACGTGCTTCATAAGG - Intergenic
989669575 5:43899780-43899802 CAAAAAACAAATGCCTCAAAAGG - Intergenic
989771558 5:45152323-45152345 CAGAGATCACATGCTTCACAAGG - Intergenic
990234490 5:53752215-53752237 CAGAGATCACATGCTTCACAAGG + Intergenic
990300504 5:54445078-54445100 CAGAGATCACACGCTTCACAAGG - Intergenic
990339599 5:54809227-54809249 CAGAGATCACACGCTTCACAAGG + Intergenic
990704573 5:58514116-58514138 CAAAGATCACATGCTTTAAAGGG - Intergenic
991055135 5:62311948-62311970 CCAAGATCACATGGTTAATAAGG + Intronic
991101349 5:62796980-62797002 CAAAGATCACATGCTTCAAAAGG + Intergenic
991264129 5:64696916-64696938 CAAAGATCACAAGCGTCAAAGGG - Intronic
991542590 5:67746164-67746186 CAAAGATCACATGCTTCAAAAGG + Intergenic
991542594 5:67746217-67746239 CAAAGATCACATGCTTCTGAGGG + Intergenic
991712585 5:69422674-69422696 CAGAGATCACATGCTTTACAAGG - Intronic
991991590 5:72344858-72344880 CAGAGATCACGTGCTTCACAAGG + Intronic
992205520 5:74427001-74427023 AAAGGATCACATGGATCAAAGGG - Intergenic
992758876 5:79934120-79934142 TCCAGATCACATCCTTCAAAGGG - Intergenic
992820772 5:80493858-80493880 CAAGGATCACATGCTTCAAAGGG - Intronic
992955209 5:81901349-81901371 CAAAGATCACGTACTTTACAAGG - Intergenic
993172452 5:84436182-84436204 CAAGGATCACATGCTTCAAAGGG - Intergenic
993427882 5:87792518-87792540 TCAAAATCAAATGCTTCAAAGGG - Intergenic
993533360 5:89050511-89050533 CAAAGATCACATGCATCAAAAGG - Intergenic
993750353 5:91658216-91658238 CAAAGACCACATGCTTTAAAGGG - Intergenic
993834103 5:92795573-92795595 CAAAGATCACATGCTTCAAAGGG + Intergenic
993977986 5:94505517-94505539 TAAAGATTAGATGATTCAAATGG + Intronic
994386898 5:99143384-99143406 CAAAGATCACATGCTTCAAAGGG + Intergenic
994386902 5:99143437-99143459 CAAAGATCACATGCTTCTGAGGG + Intergenic
994615418 5:102098741-102098763 ACAAGATCACATGCTTCAAAGGG + Intergenic
994734368 5:103533976-103533998 CAGAGATCACATGCTTCACAAGG - Intergenic
994744668 5:103663799-103663821 CAGAGATCACATGCTTCACAAGG + Intergenic
994875793 5:105419257-105419279 CAAAGATCACATGCTTCAAAGGG + Intergenic
994877020 5:105436832-105436854 CAAAGATCTCATGCTTCAAAGGG + Intergenic
995120031 5:108526327-108526349 CAGAAATCACATGCTTCACAAGG - Intergenic
995187391 5:109286549-109286571 CAAAGATCACATGCTTCAAAGGG + Intergenic
995593935 5:113728959-113728981 CACAGGTCACATGCTTCACAAGG + Intergenic
996044188 5:118851483-118851505 CAAAGATTACATGCTTCAAAGGG + Intronic
996097485 5:119414295-119414317 AGTAGATCACATGCTTCAAAGGG - Intergenic
996101626 5:119450715-119450737 CAAACATCACATGCTTCAAAGGG + Intergenic
996101628 5:119450750-119450772 CAAAGATCATATGCTTCTGAGGG + Intergenic
996141565 5:119915646-119915668 CCAGGATCAAATGATTCAAATGG - Intergenic
996146830 5:119987017-119987039 CAGAGATCACATGCTTCATAGGG + Intergenic
996517146 5:124383324-124383346 AGTAGATCACATGCTTCAAAGGG - Intergenic
996667220 5:126073650-126073672 CAAAGATCACATGCTTCAAAGGG - Intergenic
996753338 5:126911236-126911258 CAGAGATCACATGCTTCACAAGG - Intronic
996893199 5:128447659-128447681 CAGAGATCACATGCTTCACAAGG - Intronic
997004180 5:129799291-129799313 CAAAGATCACATGCTTCAAAGGG + Intergenic
997089784 5:130843366-130843388 CAGAGATCATATACTTCACAAGG - Intergenic
997115743 5:131124086-131124108 ACAAGATCACATGCTTCAAAGGG - Intergenic
997244800 5:132338306-132338328 CAGAGATCACGTGCTTCACAAGG + Intronic
997489617 5:134262603-134262625 CAGAGATCACATGCTTCAAAAGG + Intergenic
997491878 5:134284388-134284410 CAAAGATCACATGCTTGAAAGGG + Intergenic
997901369 5:137768368-137768390 CAGAGATCACATGCTTCACAAGG - Intergenic
997920802 5:137977367-137977389 CAGAGATCACATGCTTCACAAGG - Intronic
998585150 5:143419657-143419679 CAGAGATCACGCGCTTCACAAGG + Intronic
998647693 5:144081770-144081792 CAAGGATCACATGCTTCAAAGGG - Intergenic
998777201 5:145616649-145616671 CAGAGATCATGTGCTTCACAAGG + Intronic
998970013 5:147580828-147580850 CAAAGATTACATGCTTCAAAGGG - Intergenic
999412817 5:151367022-151367044 CAAAGTTCACATGCTTCTGAGGG + Intergenic
999457489 5:151729610-151729632 CAAGGATCACATGCTTCAAAGGG + Intergenic
1000004473 5:157170364-157170386 TAGAGATCACATGCTTCACAAGG - Intronic
1000237921 5:159379995-159380017 CAAAGATCACATGCTTCAAAGGG + Intergenic
1000400996 5:160827046-160827068 CAAAGATCACATGCTTCAAATGG - Intronic
1000615289 5:163419335-163419357 CAGAGATCACATGCTTCACAAGG - Intergenic
1000691512 5:164327111-164327133 CAAAGATCACATGCTTGAAAGGG + Intergenic
1000880608 5:166692794-166692816 CAAAGATCAGATGCTTCAGAGGG + Intergenic
1001189791 5:169619076-169619098 CAGAGATCATGTGCTTCACAAGG - Intergenic
1001521541 5:172397415-172397437 CAGAGATCATGTGCTTCACAAGG - Intronic
1001522127 5:172402420-172402442 CAGAGATCACATGCTTCACAAGG - Intronic
1002651615 5:180700756-180700778 CAGAGATCACATGCTTCACAAGG - Intergenic
1002666467 5:180829346-180829368 CAAAGATCATATGCTTCAAAGGG - Intergenic
1002726927 5:181305143-181305165 CAGAGATCACATGCTTCACAAGG + Intergenic
1003079412 6:3008884-3008906 CAGAGATCACATGCTTCACAAGG + Intronic
1003709587 6:8574357-8574379 CAGAGATCACATGCTTCAAATGG + Intergenic
1003923326 6:10854194-10854216 CAAAGATCACATGCTTCTGAGGG - Intronic
1003931387 6:10927573-10927595 CAGAGATCACGTACTTCACAAGG + Intronic
1004086419 6:12453744-12453766 CAAAGATCACATGCTTCAAAGGG + Intergenic
1004086420 6:12453779-12453801 CAAAGATCACATGCTTCTGAAGG + Intergenic
1004230526 6:13829091-13829113 CAAAGATCACATGCTTCTGAGGG + Intergenic
1004471280 6:15931638-15931660 CAGAGATCACATGCTTCACAAGG + Intergenic
1004672145 6:17807614-17807636 CAAAGATCACATGCTTCTGAGGG - Intronic
1004778276 6:18873498-18873520 CAGAGATCACACGCTTCACAAGG - Intergenic
1004821119 6:19368829-19368851 CAAACAGCATCTGCTTCAAAGGG + Intergenic
1004954684 6:20716315-20716337 CAAATATCACCTCTTTCAAATGG - Intronic
1005176767 6:23055622-23055644 CAAACATAACATCCTTTAAAAGG - Intergenic
1005374085 6:25164514-25164536 CAAAGATCACATGCTTCTGAGGG - Intergenic
1005501649 6:26434103-26434125 GAGAGATCACATGCTTCACAAGG - Intergenic
1005985284 6:30869633-30869655 CAAGGATCACATGCTTCGAAGGG - Intergenic
1006041948 6:31263464-31263486 CAAAGATCACATGCTTCTGAGGG + Intergenic
1006269633 6:32953858-32953880 CAAAGATCACAGGCATCCAGAGG + Intronic
1006286647 6:33101115-33101137 CAGGGATCACATGCTTCAGAGGG + Intergenic
1006292688 6:33152077-33152099 CAAAGATCACATGCTTCAAAGGG + Intergenic
1007022055 6:38530313-38530335 CAAAGATCACATGCTTCTGAGGG - Intronic
1007022059 6:38530366-38530388 TAAAGATCACATGCTTCAAAGGG - Intronic
1007038446 6:38699970-38699992 CAAAGATCACATGCTTCAAAGGG - Intronic
1007128218 6:39445618-39445640 CAAAGGTCACGTGGTTCAGAAGG + Intronic
1007354029 6:41297315-41297337 CAAGGATCACATGGTTCAAAGGG + Intergenic
1008044984 6:46842684-46842706 CAAAGATCACATGCTTCAAAGGG - Intergenic
1008167217 6:48153073-48153095 CAAAGATCACATGCTTCAAAGGG - Intergenic
1008170748 6:48202574-48202596 CAGAGATCACATGCTTCACAAGG - Intergenic
1008251218 6:49242357-49242379 CAGAGATCACATGCTTCACAAGG + Intergenic
1008502781 6:52200021-52200043 TAAAGATCGCATGCTTGAAAGGG + Intergenic
1008628243 6:53338501-53338523 CAAAGGGCACCTGTTTCAAAGGG + Intronic
1008909677 6:56719869-56719891 CAAAGATCACGTACTTCACAAGG + Intronic
1009296560 6:61957770-61957792 CAGAGATCACATGTCTCACAAGG - Intronic
1009630879 6:66198487-66198509 CAGAGATCACAAGCTTCAAATGG - Intergenic
1009701310 6:67185456-67185478 CAAATATCACATTCTTGTAAAGG - Intergenic
1009720160 6:67458222-67458244 CAAAGATCGCATGCTTCAAAGGG + Intergenic
1009720162 6:67458257-67458279 CAATGATCACATGATTCTGAGGG + Intergenic
1009766621 6:68085584-68085606 CAGGGATCACATGCTTCAGAGGG + Intergenic
1009789680 6:68385754-68385776 CAAAGATCACATGCTTCAAAGGG - Intergenic
1010102959 6:72131560-72131582 CAAAGATCACGTACTTCACAAGG + Intronic
1010143373 6:72637597-72637619 TAAAGACTACATACTTCAAATGG + Intronic
1010236146 6:73576396-73576418 CAGAGATCACATGCTTCACAAGG - Intergenic
1010465073 6:76158216-76158238 CAAAGATCACATGCTTCAAAGGG - Intergenic
1010520253 6:76823676-76823698 CAAAGATCACATGCTTCAAAGGG + Intergenic
1010776380 6:79890971-79890993 CAAAGATCACATGCTTCAAAAGG + Intergenic
1010796503 6:80122651-80122673 CAAAGATCACATGCTTCAAAGGG + Intronic
1010803867 6:80211941-80211963 CAAAGATCACATGCTTCAAAAGG + Intronic
1010803871 6:80211994-80212016 CAAAGAGCACATGCTTCTGAGGG + Intronic
1010810615 6:80294911-80294933 CAAAGATCACATGCTTCTGAGGG - Intronic
1010810617 6:80294946-80294968 CAAAGATCACAGGCTTTAAAAGG - Intronic
1010816586 6:80365049-80365071 TGAAGATCACATGCTTCAAAGGG + Intergenic
1010816590 6:80365102-80365124 CAAAGATCACATGCTTCTGAGGG + Intergenic
1010927893 6:81765641-81765663 CAGAGATCACATGCTTCACAAGG + Intergenic
1011124839 6:83996002-83996024 CAGAGATCACATGCTTCACAAGG - Intergenic
1011314751 6:86018940-86018962 CAAAGATCACATGCTTCTGAGGG - Intergenic
1011314756 6:86018993-86019015 CAAAGATCACATGCTTCAAATGG - Intergenic
1011586549 6:88932421-88932443 CAGGGATCACATGCTTCATAGGG - Intronic
1011590848 6:88969327-88969349 CAAAGATCACATGCTTCAAAGGG + Intergenic
1011608569 6:89128565-89128587 CAAAGATCACATGCTTCTGAGGG - Intergenic
1011608571 6:89128600-89128622 CAAAGATCACATGCTTCAAAGGG - Intergenic
1011681039 6:89783604-89783626 CAAAGATCACATGCTTCAAAGGG - Intronic
1011959827 6:93073733-93073755 CAGAGATCACATGCTTCACAAGG - Intergenic
1012122634 6:95386656-95386678 CAGAGATCACATGCTTCACAAGG + Intergenic
1012138127 6:95584656-95584678 ACAAGATCACATACTTCAAAGGG - Intronic
1012365405 6:98433084-98433106 CAAGGACAACATGCTTTAAATGG + Intergenic
1012607094 6:101170884-101170906 CAAAGATCACATGCTTCAAAGGG + Intergenic
1012682289 6:102197134-102197156 CAAAAATCACATGCTTCATAGGG + Intergenic
1012704420 6:102503250-102503272 ACAAGATCACATGCTTCAAAGGG + Intergenic
1012746212 6:103092773-103092795 CAAAGATCACATGCTTCTGAGGG - Intergenic
1012746216 6:103092826-103092848 CAAAGATCACATGCTTCAAAGGG - Intergenic
1013500294 6:110742893-110742915 CAAAGATCACATGCTTCAAAGGG - Intronic
1013581331 6:111537360-111537382 CTAAGATCACATGGCTCAGAAGG + Intergenic
1013833218 6:114299424-114299446 CAGAGATCACATACTTCACAAGG - Intronic
1013855268 6:114564758-114564780 CAAAGATCACATGCTTGAAAGGG - Intergenic
1013865200 6:114688537-114688559 CAGAGATCACATGCTTCACAAGG + Intergenic
1013920930 6:115402641-115402663 CAAAGATCACATGCTTCTGAGGG + Intergenic
1013987258 6:116209847-116209869 CAGAAATCAAATGCTTTAAATGG - Intronic
1014251437 6:119119279-119119301 CAGAGATCACGTGCTTCACAAGG - Intronic
1014319347 6:119907387-119907409 CAGAGATCACGTGCTTCACAAGG - Intergenic
1014320702 6:119924851-119924873 ACAAGATCACATGCTTCAAAGGG + Intergenic
1014956523 6:127624752-127624774 CAAGGATAACATGCTTGAAAAGG - Intergenic
1015046883 6:128786923-128786945 CAAAGATCACATGGTTGTAGAGG + Intergenic
1015180808 6:130360525-130360547 CAAAGATCATGTACTTCACAAGG + Intronic
1015206418 6:130644716-130644738 CAGAGATCACATGCTTCACAAGG + Intergenic
1015329752 6:131963181-131963203 CAAAGAACACATGGTTCCATAGG - Intergenic
1015329768 6:131963267-131963289 CAAAGAGCACATGGTTCCATAGG - Intergenic
1015545362 6:134356163-134356185 CAGAGATCACGTGCTTTACAAGG - Intergenic
1015857930 6:137645571-137645593 AAAAGAAGACATGCTTCAAATGG - Intergenic
1016192957 6:141293680-141293702 CAAAGATCACGTACTTCACAAGG + Intergenic
1016534812 6:145098085-145098107 CAAAAATCACATGATTCTGAGGG + Intergenic
1016586781 6:145697324-145697346 CAGAGATCACATGCTTCACATGG + Intronic
1016631984 6:146243588-146243610 CAGAGATCACATGCTTCATAAGG + Intronic
1017177547 6:151518870-151518892 CAAAGATCACATGCTTCAGAGGG + Intronic
1017849940 6:158296501-158296523 CAAAGATCACATGCTTCAAAGGG + Intronic
1017849944 6:158296554-158296576 CAAAGATCACATGCTTCTGAGGG + Intronic
1017849988 6:158296836-158296858 AAAAGATTACATGCTTTAAGGGG + Intronic
1017850756 6:158303447-158303469 CAAAGATCACATGCTTCAAAGGG + Intronic
1017850760 6:158303500-158303522 TAAAGATCACATGCTTCTCAGGG + Intronic
1017855305 6:158345617-158345639 CAAAGATCACATACTTCAAAGGG + Intronic
1018102132 6:160449915-160449937 CAAAGATCACATGCTTCAAAGGG + Intronic
1018139928 6:160821149-160821171 ACAAGATCACATGCTTCAAAGGG - Intergenic
1018855433 6:167670995-167671017 TAAAAATCACAGGCTACAAAAGG + Intergenic
1018994184 6:168698630-168698652 CCAAGATCTCATTCTTCAAATGG + Intergenic
1019072060 6:169354879-169354901 CAAAGATCACATGCTTCAAAGGG + Intergenic
1019072064 6:169354932-169354954 CGAAGATCACATGCTTCTGAGGG + Intergenic
1019853041 7:3578319-3578341 CAAAGATCACATGCTTCAAAGGG + Intronic
1020048447 7:5062454-5062476 CAGAGATCACATACTTCACAAGG + Intronic
1020147182 7:5653647-5653669 CAATGATCACAGGCATTAAATGG + Intronic
1020329016 7:6999503-6999525 CAAAGATCACGTGCTTCTGAGGG - Intergenic
1020329020 7:6999556-6999578 CAAAGGTCACATGCTTCAAATGG - Intergenic
1020615720 7:10458319-10458341 CAGAGATCACATGCTTTTCAAGG + Intergenic
1020633221 7:10665762-10665784 CAAAGACCATAAGCTTCACAAGG - Intergenic
1020738455 7:11983335-11983357 CAGAGATCACATGTTTCACAAGG + Intergenic
1020788973 7:12602281-12602303 CAAAGATCACATGCTTCAAAGGG + Intronic
1020834893 7:13136734-13136756 CAGAGATCACATGCTTCACAAGG - Intergenic
1020909311 7:14108761-14108783 CAGAGATCACATGCTTCACAAGG + Intergenic
1021139250 7:17003611-17003633 CAGAGATCACATGCTTCACAAGG + Intergenic
1021176770 7:17458760-17458782 CAAAGATCACATGCTTCAAAGGG + Intergenic
1021218551 7:17947323-17947345 TCAAGATCAAATGCTTCATAAGG + Intergenic
1023565902 7:41523415-41523437 CAGAGATCACAGGCTTCACAAGG + Intergenic
1023603845 7:41909165-41909187 CGAAGATCACATGCTTCGAAGGG + Intergenic
1023668882 7:42555361-42555383 CAGAGATCACATGCTTCACAGGG - Intergenic
1024010612 7:45263150-45263172 CAGAGATCACATGCTTCATAAGG - Intergenic
1024071828 7:45792755-45792777 CAGAGATCACATGCTTCACAAGG + Intergenic
1024213108 7:47223859-47223881 CAGAGATCACATGCTTCACAAGG - Intergenic
1024402997 7:48946525-48946547 GAGAGATCACATGCTTCACAAGG + Intergenic
1024552050 7:50570676-50570698 CAAAAATCACATGCTTCATAGGG - Intergenic
1024553523 7:50583702-50583724 CAGAGATCACATGCTTCATAGGG - Intergenic
1024586449 7:50845944-50845966 CAAAGATCACGTACTTCACAAGG - Intergenic
1024637003 7:51299438-51299460 CAAAAGTCACAAGTTTCAAAGGG + Intronic
1024668067 7:51565403-51565425 CAAAATTCACATCCTTCTAAGGG + Intergenic
1024694888 7:51845839-51845861 CAAAGATCACATGCTTCTGAGGG - Intergenic
1024694893 7:51845892-51845914 CAAAGATCACATGCTTCAAAGGG - Intergenic
1024773460 7:52754161-52754183 CAAAGATCACATGCTTCATAGGG + Intergenic
1024801533 7:53085790-53085812 CAAAGATCACATGCTTCAAAGGG + Intergenic
1025108899 7:56196236-56196258 CAAGGATCACATGCTTCAACGGG + Intergenic
1025155223 7:56599166-56599188 CAGAGATCACATGCTTCACAAGG + Intergenic
1025722946 7:64032926-64032948 CAAAGATCACATTCTTCAAGGGG + Intronic
1025734786 7:64137381-64137403 CAGAGATCACATGCTTCACAAGG - Intronic
1025749467 7:64280820-64280842 CAGAGATCACATGCTTCACAAGG + Intergenic
1025755282 7:64332424-64332446 CAAAGATCACATGCTTCAAAGGG + Intronic
1025755284 7:64332459-64332481 CGAAGATCACATGCTTCTGAGGG + Intronic
1026514144 7:71053001-71053023 CAGAGATCACATGCTTCACAAGG + Intergenic
1026730586 7:72908390-72908412 CAGAAATCACATGCTTCACAAGG + Intronic
1027291462 7:76716466-76716488 CAAAGATCACATGCTTTAAAGGG + Intergenic
1027566623 7:79802459-79802481 CAAAGATCACATGCTTCAAAGGG - Intergenic
1027628822 7:80576901-80576923 CAGAGATCACATGCTTCACAAGG - Intronic
1027859117 7:83552956-83552978 CAAAGATCACATGCTTCTGAGGG - Intronic
1027859119 7:83553009-83553031 CAAAGATCACATGCTTCAAAGGG - Intronic
1027976153 7:85158624-85158646 CAGAGATCACATGTGTCACAAGG - Intronic
1028191511 7:87858331-87858353 ACAAGATCACATGCTTCAAAGGG - Intronic
1028330411 7:89583998-89584020 CAGGGATCACATGCTTCAGAGGG + Intergenic
1028331557 7:89601001-89601023 ACAAGATCACATGCTTCAAAAGG + Intergenic
1028400889 7:90424243-90424265 CAGAGATCACGTGCTTCACAAGG - Intronic
1028435104 7:90794185-90794207 CAGAGATCACATGCTTCACAAGG + Intronic
1028439152 7:90838902-90838924 CAGAGATCACATGTTTCAAAGGG - Intronic
1028450222 7:90973780-90973802 CAGAGATCACATGCTTCAAAGGG + Intronic
1028539357 7:91925228-91925250 CAGAGATCACGTGCTTTACAAGG + Intergenic
1028584868 7:92442804-92442826 CAAAGATCACATGCTTCAAAGGG + Intergenic
1028999824 7:97141312-97141334 CAGAGATCACATGCTTCACAAGG - Intronic
1029008570 7:97234625-97234647 CAAAGATCACATGCTTCTGAGGG - Intergenic
1029008574 7:97234678-97234700 CAAAGATCACATGCTTCAAAGGG - Intergenic
1029370090 7:100144413-100144435 CAGAGATCACATGCTTCACAAGG + Intergenic
1030056056 7:105584550-105584572 CAGAGATCACATGCTTTACAAGG - Intronic
1030126004 7:106153158-106153180 CAAGGAGTACATGTTTCAAAAGG - Intergenic
1030411201 7:109182446-109182468 CAGAGATCACATGCTTCCTAGGG + Intergenic
1030444526 7:109632747-109632769 ACAAGATCACATGCTTCAAAGGG + Intergenic
1030497758 7:110320789-110320811 CAAAGATCCCATGCTTCTGAGGG - Intergenic
1030497763 7:110320842-110320864 CAAAGATCACATGCTTCAAAGGG - Intergenic
1030601447 7:111597466-111597488 CAGAGATCACATGCTTCACAAGG - Intergenic
1031304587 7:120110508-120110530 CAAAGATCACATGCTTCCAAGGG - Intergenic
1031416031 7:121497500-121497522 CAAAGATCACATGCTTCAAAGGG + Intergenic
1031427011 7:121617321-121617343 CACAGATCACGTGCTTCACAAGG - Intergenic
1031459899 7:122036030-122036052 CAAAGAGAAACTGCTTCAAAAGG - Intronic
1031511858 7:122660476-122660498 CAAAGAACAAATGCATCAAGTGG + Intronic
1031636174 7:124103701-124103723 CAGAGATCACATGCTTCACAAGG - Intergenic
1031763014 7:125737749-125737771 CAAGGATCACATGCTTCAAAGGG + Intergenic
1031838266 7:126704923-126704945 CAGAGATCACGTACTTCACAAGG - Intronic
1031930448 7:127680185-127680207 CAGAGATCACGTACTTCACAAGG + Intronic
1031978645 7:128109729-128109751 AGTAGATCACATGCTTCAAAGGG + Intergenic
1031996985 7:128239493-128239515 AGTAGATCACATGCTTCAAAGGG - Intergenic
1032005380 7:128298242-128298264 CAAAGATCACATGCTTCAAAGGG - Exonic
1032048443 7:128630361-128630383 CAGAGATCACATGCTTCACAAGG + Intergenic
1032937077 7:136745382-136745404 CAGAGAACACATGCTTCTCAAGG + Intergenic
1033447553 7:141436207-141436229 CAGAGACCACATACCTCAAAAGG - Intronic
1033627304 7:143122935-143122957 CAAAGATCACATGCTTTAAAGGG + Intergenic
1033716739 7:144010207-144010229 CAAAGATCACATGCTTCAAAGGG + Intergenic
1033859477 7:145607129-145607151 CAGAGATCACCTACTTCACAAGG - Intergenic
1033904937 7:146191346-146191368 CAGAGATCACATGCTTCACAAGG + Intronic
1034102560 7:148462993-148463015 CAAAGATCACATGCTTCAAAGGG - Intergenic
1034251789 7:149698138-149698160 CAAAGATCACATGCTTCAAAGGG - Intergenic
1034367045 7:150560186-150560208 CAAAGATCACATGCTTCTGAGGG - Intergenic
1034367049 7:150560239-150560261 CAAAGATCACATGCTTCAAAGGG - Intergenic
1034609434 7:152352413-152352435 CAGAGATCACGTGCTTCACAAGG - Intronic
1034929664 7:155151758-155151780 CAGAGATCACATGCTTCACAAGG - Intergenic
1035135259 7:156697208-156697230 CAAAGATCACATGCTTCAAAGGG + Intronic
1035135262 7:156697261-156697283 CAAAGATCACATGCTTCTGAGGG + Intronic
1035342595 7:158173468-158173490 CAGGGATCACATGCTTCAGAGGG + Intronic
1036249834 8:7152367-7152389 CAAAGATCACGTGCTTCTGAGGG - Intergenic
1036249838 8:7152420-7152442 CAAAGGTCACATGCTTCAAAGGG - Intergenic
1036728509 8:11241524-11241546 CAAAGATCACATGCTTCTGAGGG - Intergenic
1036728511 8:11241559-11241581 CAAAGATCACATGCTTCAAAGGG - Intergenic
1036999266 8:13698300-13698322 CAGAGATCACGTGCTTCACGAGG + Intergenic
1037038433 8:14199491-14199513 CAGAGATCACATGCTTCACAAGG - Intronic
1037063417 8:14544871-14544893 TAAAGATCACATGCTTCTGAGGG - Intronic
1037063422 8:14544924-14544946 CAAAGATCACATGCTTCAAAGGG - Intronic
1037136923 8:15473727-15473749 ACAAGATCACATGCTTCAAAGGG + Intronic
1037312702 8:17573619-17573641 CAAAGATCACGTGCTTCTGAGGG - Intergenic
1037312704 8:17573654-17573676 CAAAGATGACACGCTTCAAAGGG - Intergenic
1037327156 8:17703889-17703911 CAAAGATCACATGCCTCAAAGGG - Intronic
1037555815 8:20021205-20021227 CAAAGATCACATGCTTCAAAGGG + Intergenic
1038475686 8:27865409-27865431 CTAGGATCAGATGCTTTAAAAGG - Intergenic
1038840351 8:31179148-31179170 CACAGATCTCATGCTTAAGAGGG + Intergenic
1038991915 8:32877574-32877596 CAGAGACCACATGCTTCATAAGG - Intergenic
1039171872 8:34756826-34756848 CAAAGATCACATGATGAAAGAGG + Intergenic
1039183096 8:34888269-34888291 CAAAGATCACATGCTTCAAAGGG + Intergenic
1039185432 8:34910517-34910539 CAAAGATCACATGCTTCTGAGGG + Intergenic
1039501661 8:38022398-38022420 ATAAGATCACATGCTTCAAAGGG + Intergenic
1039669343 8:39579148-39579170 CAAAGATCACATGCTTCTGAGGG - Intergenic
1039669345 8:39579183-39579205 CAAAGATCACATGATTCAAAGGG - Intergenic
1039691202 8:39866616-39866638 CAAAGATCACATGCTTCTGAGGG + Intergenic
1040276087 8:46014386-46014408 CAGAGATCACATGCTTCACAAGG + Intergenic
1040426023 8:47287171-47287193 CAAAGATCACATGCTTCAAAGGG + Intronic
1040474754 8:47765942-47765964 CAGAGATCACATGCTTCAAATGG - Intergenic
1040489865 8:47909972-47909994 CAAAGATCACGTGCTTCAGAGGG - Intronic
1040499415 8:47993723-47993745 CAAAGATCACGTGCTTCAGAGGG + Intergenic
1040583806 8:48720665-48720687 CAAAGATCACCTGCTTCTGAGGG - Intronic
1040583810 8:48720718-48720740 ACAAAATCACATGCTTCAAAGGG - Intronic
1040634346 8:49254812-49254834 CAGAGATCATGTGCTTCACAAGG - Intergenic
1040679044 8:49787006-49787028 CAGAGATCACATGCTTCACAAGG + Intergenic
1040773143 8:51003759-51003781 CAAAGAACACAAACTTTAAAAGG + Intergenic
1040795917 8:51289899-51289921 ACAAGATCACATGCTTCAAATGG + Intergenic
1040840114 8:51776269-51776291 CAGAGATCACATGCTTCACAAGG - Intronic
1040842687 8:51801416-51801438 CAAAGATCACAAGCTTTAAAGGG - Intronic
1040926416 8:52688637-52688659 CAAAGATCACATGCTTCTGAGGG - Intronic
1041010592 8:53538830-53538852 CAAAGATCACATGCTTCAGAGGG - Intergenic
1041287511 8:56275585-56275607 CAAGGATCACATGCTTCAAAAGG - Intergenic
1041584129 8:59496112-59496134 CAGAGATCACGTGCTTCACAAGG + Intergenic
1041664891 8:60433724-60433746 CAGAGATCACATGCTTCACAAGG + Intergenic
1041886003 8:62808694-62808716 CAGAGATCACATGCTTCACAAGG + Intronic
1041907760 8:63052462-63052484 CAAAGATCATATGCTTCAAAGGG - Intronic
1042191371 8:66190940-66190962 CAAAGATCACATGCTTCTGAGGG + Intergenic
1042191919 8:66195609-66195631 CAAAGATCACATGCTTCAAAGGG + Intergenic
1042197740 8:66247657-66247679 AGTAGATCACATGCTTCAAAGGG - Intergenic
1042197846 8:66248645-66248667 AGTAGATCACATGCTTCAAAGGG - Intergenic
1042197988 8:66249880-66249902 AGTAGATCACATGCTTCAAAGGG - Intergenic
1042428836 8:68680560-68680582 CAAAGATCACATGCTTCAAAAGG + Intronic
1042428840 8:68680613-68680635 CAAAGATCACATACTTCTGAGGG + Intronic
1042529256 8:69797891-69797913 CAGAGATCACATGCTTCACAAGG - Intronic
1042934130 8:74041886-74041908 ACAAGATCACATGCTTCAAAGGG - Intergenic
1042991780 8:74648487-74648509 CAAAGATCACATGCTTCAAGGGG - Intronic
1043144936 8:76641431-76641453 CAAAGATCACATGCATCAAAGGG + Intergenic
1043281375 8:78471013-78471035 CAAAGATCACATGCTTCAAAGGG - Intergenic
1043369212 8:79571673-79571695 CAAAGAGCAAAGGCTACAAAGGG - Intergenic
1043684759 8:83071469-83071491 CAGAGATCACGTGCTTCACAAGG + Intergenic
1043861598 8:85323768-85323790 CAAAGATCACATGCTTCTGAGGG + Intergenic
1043977528 8:86599884-86599906 CAGAGATCACATGCTTCACAAGG - Intronic
1044039072 8:87342763-87342785 CAAGGATCACATGCTTCAAAGGG + Intronic
1044064005 8:87676548-87676570 CAGAGATCACCTGCTTCACAAGG + Intergenic
1044064805 8:87686212-87686234 AGTAGATCACAAGCTTCAAAGGG - Intergenic
1044070251 8:87751483-87751505 CAAGGATCACATGCTTCAAAGGG + Intergenic
1044182329 8:89211345-89211367 CAAAGATCACATGCTTCTGAGGG - Intergenic
1044182334 8:89211397-89211419 CAAAGATCACACACTTCAAAGGG - Intergenic
1044307775 8:90657445-90657467 CAAAGATCACATGCATCAAAAGG + Intronic
1044318606 8:90777229-90777251 TAAAGATCACATGCTTCGAAGGG + Intronic
1044318608 8:90777264-90777286 CAAAGATGACATGCTTCTGAGGG + Intronic
1044460648 8:92440399-92440421 GAAAGATTAAATGCTCCAAAGGG + Intergenic
1044495381 8:92872364-92872386 CAAAGAAAAGATGCTTGAAATGG + Intergenic
1044590325 8:93908054-93908076 CAGCGATCGCATGCTTCACAAGG + Intronic
1045457089 8:102391299-102391321 CAAAGTTCACATGCTGCATTTGG - Intronic
1045593508 8:103626858-103626880 CAAGGATCACATGCTTCAAAGGG + Intronic
1045729293 8:105216718-105216740 CAAATATCACATGCTTCAAAGGG - Intronic
1045814006 8:106258335-106258357 CAGAGATCACATGCTTCAAATGG - Intergenic
1045954329 8:107889339-107889361 CAGAGATCACATGCTTCACAAGG + Intergenic
1046038421 8:108873152-108873174 GAAAGAACACAGGCTTCAGATGG + Intergenic
1046044057 8:108942769-108942791 CAGAGATCACATGCTTCAAAAGG - Intergenic
1046253542 8:111666084-111666106 CAAAGATCACACGCTTCAAAGGG + Intergenic
1046253545 8:111666119-111666141 CAAAGATCATATGCTTCTAAGGG + Intergenic
1046494589 8:114997105-114997127 CAAAGATCACATGCTTCTGAGGG - Intergenic
1046494592 8:114997155-114997177 CAAAGAACACATGCTTCAAAAGG - Intergenic
1046749802 8:117914901-117914923 TAAAGATCACATGCTTCTGAGGG - Intronic
1046749805 8:117914954-117914976 CAAAGATCACATGCTTCAAAGGG - Intronic
1046911999 8:119638800-119638822 CAAAGAGAACACGCTGCAAAAGG - Exonic
1047447639 8:124933762-124933784 CAAAGATCACGTACTTCACAAGG - Intergenic
1047661967 8:127047110-127047132 CAAAGATCACATGCTTCTGAGGG - Intergenic
1047661970 8:127047163-127047185 CGAAGATCACATGCTTCAAAGGG - Intergenic
1047922244 8:129647207-129647229 CAAAGATCACATGCTTCTGAGGG + Intergenic
1048033766 8:130657473-130657495 AGTAGATCACATGCTTTAAAAGG + Intergenic
1048053593 8:130842975-130842997 CAAAGATTACTGGCATCAAAAGG - Intronic
1048081659 8:131134810-131134832 CAAAGATCACATGCTTCAAAGGG + Intergenic
1048239171 8:132724058-132724080 CAAAGATCACATGCTTCAAAGGG + Intronic
1048602139 8:135929809-135929831 CAAAGATCACATGCTTCAAAGGG + Intergenic
1048820280 8:138374009-138374031 CAAAGATCACATGCTTCACAAGG - Intronic
1049513375 8:143040975-143040997 CAGAGATCACATGCTTCACAAGG + Intronic
1050394513 9:5180836-5180858 CAAAGATGACATGCTTCTGAGGG - Intronic
1050401406 9:5259702-5259724 ACGAGATCACATGCTTCACAAGG - Intergenic
1050606735 9:7309507-7309529 CAGAGATCACATGCTTCACAAGG - Intergenic
1051258746 9:15240865-15240887 CATTGATAACATGCTTCAATAGG + Intronic
1051375132 9:16394773-16394795 CAAAGATCGCATGCTTCTGAGGG - Intergenic
1051375136 9:16394826-16394848 CAAAGATCACATGCTTCAAAGGG - Intergenic
1051691666 9:19719792-19719814 CAAAGAGAGCATGATTCAAAAGG - Intronic
1051742608 9:20266151-20266173 CAGAGATCACATGCTTTACAAGG - Intergenic
1051833820 9:21311658-21311680 CAGAGATCACATGCTTCACAAGG - Intergenic
1052061120 9:23962497-23962519 CAAAGATCACATGCTTGAAAGGG - Intergenic
1052083784 9:24239092-24239114 CAGAGATCACGTGCTTCACAAGG + Intergenic
1052426436 9:28311212-28311234 CAGAGATCACATGCTTCACAAGG + Intronic
1052456087 9:28700041-28700063 CAAAGATCACATGCTTCAAAGGG - Intergenic
1052687166 9:31771403-31771425 ACGAGATCACATGCTTCAAAGGG - Intergenic
1052741061 9:32393564-32393586 CAGACATCACATGCTTCACAAGG - Intronic
1053087569 9:35239424-35239446 CAGAGATCACATGCTTCACAAGG + Intronic
1053206395 9:36190187-36190209 TAAGGATCACTTGCTTCAAAGGG - Intergenic
1053652583 9:40184079-40184101 CAAAGATCACATGCTTCAAAGGG + Intergenic
1053703598 9:40727209-40727231 TAAAGATCACGTACTTCACAAGG - Intergenic
1053902983 9:42813386-42813408 CAAAGATCACATGCTTCAAAGGG + Intergenic
1054413656 9:64850672-64850694 TAAAGATCACGTACTTCACAAGG - Intergenic
1054531999 9:66192142-66192164 CAAAGATCACATGCTTCAAAGGG - Intergenic
1055340159 9:75272981-75273003 CAGAGATCACATGCTTCACAAGG + Intergenic
1055343803 9:75313111-75313133 CACAGAACACATGCTTCACAAGG + Intergenic
1055348643 9:75362322-75362344 CAAAGATCACATGTTTCAAAAGG + Intergenic
1055451494 9:76435140-76435162 CAAAGATCACATGCTTCAAAGGG - Intronic
1055622641 9:78142490-78142512 CAAAGATCGCATGCTTCTGAGGG - Intergenic
1055784872 9:79862029-79862051 CAGAGATCACATACTTCACAAGG - Intergenic
1055908022 9:81316196-81316218 CAGAGATCACAAGCTTCACAGGG + Intergenic
1056082747 9:83113881-83113903 CAAGGATCACATGCTTCAAAGGG - Intergenic
1056082874 9:83114910-83114932 CAGAGATCACATTCTTCACAAGG - Intergenic
1056894919 9:90536208-90536230 CAGAGATCACATGCTTCACAAGG + Intergenic
1057100567 9:92354964-92354986 CAAAGATCACATGCTTCCAAGGG + Intronic
1057538784 9:95944875-95944897 CAGAGATCACATCCTTCACAAGG + Intronic
1057715672 9:97493448-97493470 CAGAGATCACATGCTTCACAAGG + Intronic
1057732410 9:97621867-97621889 CAGAGATCACATGCTTCAAATGG - Intronic
1057940108 9:99274426-99274448 CAAAGATCATCTAGTTCAAATGG + Intergenic
1058137888 9:101327497-101327519 TAAAGATCACATGCTTCAAAGGG + Intergenic
1058137891 9:101327550-101327572 CAAAGATCACATGCTTCTGAGGG + Intergenic
1058143636 9:101385081-101385103 CAAAGATCACATGCTTCAAAGGG + Intergenic
1058184074 9:101833356-101833378 AAAACATCACATGCTTCCCATGG - Intergenic
1058225481 9:102356396-102356418 CAAAGATCACATGCTTTAAAGGG - Intergenic
1058252230 9:102713347-102713369 CAAAAACCATATGCTTCAAAGGG - Intergenic
1058288776 9:103211463-103211485 CAGAGATCACGTGCTTCACAAGG + Intergenic
1058542900 9:106030517-106030539 CAAAGATCACATGCTTCTGAGGG - Intergenic
1058542904 9:106030570-106030592 CAAAGATCACATGCTTCAAAGGG - Intergenic
1059094855 9:111401419-111401441 CAAAGATCACATGCTTCAAAGGG + Intronic
1059105963 9:111511900-111511922 CAAAGATCACATGCTTCAAGGGG - Intergenic
1059112252 9:111568575-111568597 CAAAGATCACATGCTTCAAAGGG - Intronic
1059198366 9:112392179-112392201 CAAAGATCACATGCTTCAAAGGG + Intronic
1059198371 9:112392232-112392254 CAAAGATCACATGCTTCTGAGGG + Intronic
1059199295 9:112399316-112399338 CAAAGATCACATGCTTCAAAGGG + Intronic
1059281865 9:113141364-113141386 CAGAGATAACATGCTTCACAAGG - Intergenic
1059523152 9:114962779-114962801 AGTAGATCACATGCTTCAAAGGG + Intergenic
1059557940 9:115300228-115300250 CAAGGATCTCCTGCTCCAAAGGG - Intronic
1059580857 9:115546858-115546880 CAAAGATCACATGCTTCAAAGGG + Intergenic
1060566007 9:124592268-124592290 TAAAGACCACATTGTTCAAAAGG + Intronic
1061679484 9:132235953-132235975 CCAAGCTCACCTGCTTCAAGAGG + Intronic
1062728294 9:138092032-138092054 CAAAGAGCACATGCTTCAAAGGG + Intronic
1062752048 9:138262619-138262641 CAGAGATCACATGCTTCACAAGG + Intergenic
1203517704 Un_GL000213v1:18530-18552 CGAAGATCACATGCTTTAAAGGG + Intergenic
1203486868 Un_GL000224v1:64218-64240 TAAGGATCACATGCTTCAAAGGG + Intergenic
1203499488 Un_KI270741v1:6118-6140 TAAGGATCACATGCTTCAAAGGG + Intergenic
1185966676 X:4613699-4613721 CAAAGATCACATGCTTCAAAGGG + Intergenic
1185966678 X:4613734-4613756 CAAAGATCACATGCTTCTGAGGG + Intergenic
1186149954 X:6664352-6664374 CAGAGATCACGTGCTTCACAAGG + Intergenic
1186568722 X:10692154-10692176 CAAAGATCACATGCTTCAAAGGG - Intronic
1186803595 X:13117536-13117558 CAGAGATCACATGCTTCATAAGG + Intergenic
1186857127 X:13637131-13637153 TAAAGATCACGTGCTTCAAAGGG + Intergenic
1187122484 X:16422923-16422945 CAGAGATCACGTGCTTCACAAGG - Intergenic
1187182268 X:16954434-16954456 CAAACATCATATGGTTCATAGGG + Intronic
1187433748 X:19248320-19248342 CAGAGATCACGTGCTTCACAAGG - Intergenic
1187644761 X:21335082-21335104 CAGAGATCACATGCTTCACAAGG - Intergenic
1187677681 X:21734100-21734122 GAAAGATAAAATACTTCAAAAGG - Intronic
1187685110 X:21808182-21808204 CAAAGATCACATGCTTCAAAGGG + Intergenic
1188186075 X:27116080-27116102 CAGGGATCACATGCTTCAGAGGG - Intergenic
1188348055 X:29092947-29092969 TAAAGAGCAGAAGCTTCAAATGG - Intronic
1188425019 X:30036459-30036481 CAAGGATCACATGCTTCAAAGGG + Intergenic
1188434990 X:30149227-30149249 CAAAGATCACATGCTTCAAAGGG + Intergenic
1188822857 X:34796821-34796843 CAGAGATTACATGCTTCACAAGG - Intergenic
1188823591 X:34803187-34803209 CAGAGATCACATGCTTCACAAGG - Intergenic
1188849552 X:35114922-35114944 CAGAGATCACATGCTTCACAAGG - Intergenic
1188979392 X:36713509-36713531 CAGAGATCACATGCTTCACAAGG + Intergenic
1189207849 X:39257070-39257092 TAAAGATCACATGTTCCAGAGGG - Intergenic
1189557575 X:42161576-42161598 CAGAGATCACATGGTTCACAAGG + Intergenic
1189978953 X:46489918-46489940 CAGAGATCACATGCTTCACAAGG + Intronic
1190516924 X:51233518-51233540 CAAAGATTACAGGCTACAAGAGG - Intergenic
1190616327 X:52236744-52236766 CAAAGATCAGGTACTTCACAAGG - Intergenic
1191064348 X:56331480-56331502 CAGAGATCACATGCTTCACAAGG - Intergenic
1191126067 X:56955069-56955091 CAGAGATCACATGCTTCACAAGG - Intergenic
1191147560 X:57184227-57184249 CAAAGATCACATGCTTCTGAGGG - Intergenic
1191147564 X:57184280-57184302 TAAAGATCACATGCTTCAAAGGG - Intergenic
1191148425 X:57193472-57193494 CAGAGATCACATGCTTCACAAGG - Intergenic
1191191594 X:57674056-57674078 CAAAGATCGCATGCTTCAAAGGG + Intergenic
1191191599 X:57674109-57674131 CAAAGATCACATGCTTCTGAGGG + Intergenic
1191226278 X:58047927-58047949 CAAAGATCACATGTTTCTGAGGG - Intergenic
1191226283 X:58047980-58048002 CAAAGATCACATGCTTCAAAGGG - Intergenic
1191596127 X:62946001-62946023 CAGAGATCACATGCTTTACAAGG + Intergenic
1191721970 X:64238674-64238696 CAGAGATCACATGCTTCATAGGG + Intergenic
1191814764 X:65231232-65231254 CAGAGATCACATGCTTCAAAGGG + Intergenic
1191972089 X:66827789-66827811 CAGAGATCACATGCTTCACAAGG + Intergenic
1191980885 X:66924187-66924209 CAGAGATCACGTGCTTCACAAGG - Intergenic
1192059699 X:67811608-67811630 CAGAGATCACGTGCTTCACAAGG + Intergenic
1192752195 X:74004982-74005004 CAGAGATCACGTGCTTCACAAGG + Intergenic
1192842475 X:74871339-74871361 CAGAGATCAGATGCTTCAAAGGG + Intronic
1192921163 X:75707882-75707904 CAAAGATCACATGCTTCAAAGGG - Intergenic
1192930749 X:75803421-75803443 CAAAGATCACTTGCTAGAAAGGG + Intergenic
1193016132 X:76736626-76736648 CACAGATCACAGGCTGAAAAGGG + Intergenic
1193038232 X:76976811-76976833 CCAAGATCACATGGTACATAGGG + Intergenic
1193224701 X:78968819-78968841 CAAAGATCACATGCTTCAAAGGG + Intergenic
1193262445 X:79424722-79424744 TAAGGATCACATGCTTCAAAGGG - Intergenic
1193300708 X:79885577-79885599 AGTAGATCACATGCTTCAAAGGG + Intergenic
1193301743 X:79897127-79897149 CAGAGATCACATGCTTCACAAGG - Intergenic
1193441424 X:81544092-81544114 ACAAGATCACATGCTTCAAAGGG - Intergenic
1193540619 X:82767266-82767288 AAAAGATCACATGCTTCAAAGGG + Intergenic
1193540621 X:82767301-82767323 CAAAGGTCTCATGCTTCTGAAGG + Intergenic
1193623227 X:83783143-83783165 ACAAGATTGCATGCTTCAAAGGG - Intergenic
1193676370 X:84457964-84457986 CAAATATCACCTTTTTCAAATGG + Intronic
1193708443 X:84851623-84851645 ACAAGATCACATGCTTCAAAGGG - Intergenic
1193872930 X:86823851-86823873 ACAAGATCACATGCTTCAAAGGG + Intronic
1193980258 X:88174026-88174048 CAAATATCACATGCTTGAAAAGG + Intergenic
1193980261 X:88174079-88174101 CAAAGATCACATGCTTCTGAGGG + Intergenic
1193994215 X:88344834-88344856 CAGAGATCACATGCTTCCCAAGG + Intergenic
1194042291 X:88956492-88956514 CAAAGATCACATGCTTCAAAGGG - Intergenic
1194071129 X:89327706-89327728 CAAAGATCACATGCTTCAAAGGG - Intergenic
1194102005 X:89717445-89717467 CAGAGATCACGTGCTTCACAAGG - Intergenic
1194440611 X:93929003-93929025 ACAAGATCACATGCTTCAAAGGG + Intergenic
1194527469 X:94995004-94995026 CAAGGATCACATGCTTTAAAGGG + Intergenic
1194535948 X:95106070-95106092 CAGAGATCACATGCTTCACAAGG - Intergenic
1194686821 X:96929464-96929486 CAAAAGTTACATGCTTTAAAAGG - Intronic
1194711662 X:97243140-97243162 ACAAGATCCCATGCTGCAAAGGG - Intronic
1194800804 X:98269919-98269941 CAGAGATCACATGCTTCACAAGG - Intergenic
1194821104 X:98508334-98508356 AGTAGGTCACATGCTTCAAAGGG + Intergenic
1194923291 X:99794161-99794183 CAGAGATCATGTGCTTCACAAGG - Intergenic
1195005851 X:100685148-100685170 AAAAGTTCAAATGCTTAAAAAGG + Intronic
1195128797 X:101835152-101835174 CAAAGATCACATGCTTCAAAGGG + Intronic
1195128801 X:101835205-101835227 CAAAGATCACATTCTTCTGAGGG + Intronic
1195258287 X:103109412-103109434 CAAAGATCACATGCTTTAAAGGG + Intergenic
1195785227 X:108512684-108512706 CAGAGATCACGTACTTCACAAGG + Intronic
1195806253 X:108770447-108770469 AGTAGATCACATGCTTCAAAGGG + Intergenic
1195981458 X:110582708-110582730 CAAAGATCACATGCTTTAAAGGG - Intergenic
1196271742 X:113720244-113720266 CAAGGATCACATGCTTCAAAGGG + Intergenic
1196541824 X:116919276-116919298 CAAAGATCACATGCTTCTGAGGG - Intergenic
1196541828 X:116919329-116919351 CAAAGATCACATGCTTCAAATGG - Intergenic
1196597798 X:117565232-117565254 CAAAGATCACATGCTTGAAAGGG + Intergenic
1196637087 X:118014542-118014564 AAAAGATCACATGCTTCAAAGGG - Intronic
1196768664 X:119272287-119272309 GGAATGTCACATGCTTCAAAAGG + Intergenic
1196944274 X:120808697-120808719 TAAAGATCACATGCTTCAAAGGG - Intergenic
1197004681 X:121481501-121481523 CAAAGATCATATGCTTCTGAGGG + Intergenic
1197004721 X:121481830-121481852 CAAAGATCACATGCACCAAAAGG - Intergenic
1197071691 X:122306481-122306503 CAGAGATCACATGCTTCACAAGG - Intergenic
1197086526 X:122483038-122483060 CAGAGATTACATGCTTCACAAGG - Intergenic
1197326185 X:125096906-125096928 CAATGAGTGCATGCTTCAAAAGG + Intergenic
1197358476 X:125467405-125467427 CAAGGATCACATGCTTCAAAGGG - Intergenic
1197364696 X:125549299-125549321 CAGAGATCATGTGCTTCACAAGG + Intergenic
1197375433 X:125676728-125676750 CAGAGATCACATGTTTCAGAGGG - Intergenic
1197473961 X:126896982-126897004 CAGAGATCACATGCTTCACAAGG + Intergenic
1197520629 X:127491912-127491934 CAAAGATCACATGCTTCAAAGGG + Intergenic
1197549202 X:127867276-127867298 CAGAGATCACATGCTTCACAGGG - Intergenic
1197557014 X:127968226-127968248 CAAGGATCACATGCTTCAAAGGG + Intergenic
1197628652 X:128832573-128832595 CAAAGATCACTTGCTTCAAAGGG - Intergenic
1197817431 X:130512637-130512659 GGTAGATCACATGCTTCAAAGGG + Intergenic
1198023189 X:132679471-132679493 CAAAGATCACATACTTCACAAGG + Intronic
1198556439 X:137798480-137798502 CAAAGATTACATGCTTCAAAGGG + Intergenic
1198723345 X:139648465-139648487 CAAAGAACACATGGGACAAATGG + Intronic
1198824312 X:140683250-140683272 CAAAGATCACATGCTTCAAAGGG - Intergenic
1198857274 X:141031788-141031810 CAAAGATCACATGATTCAAAAGG + Intergenic
1198857278 X:141031841-141031863 CAAAGATCACATGCTTCTGAGGG + Intergenic
1198905417 X:141555525-141555547 CAAAGATCACATGCTTCTGAGGG - Intergenic
1198905421 X:141555578-141555600 CAAAGATCACATGATTCAAAAGG - Intergenic
1198996523 X:142579438-142579460 AGTAGATCACATGCTTCAAAGGG - Intergenic
1199107689 X:143890228-143890250 CAAAGATCACATGCTTCTGAGGG - Intergenic
1199312498 X:146337672-146337694 CACAGATGACACACTTCAAAGGG + Intergenic
1199321300 X:146442393-146442415 CAGAGATCACATACTTCACAAGG - Intergenic
1199345761 X:146737332-146737354 AAAAAATCACATTCTTCAACTGG + Intergenic
1199364104 X:146958034-146958056 CAAAGATCATATGCTTCAAAGGG - Intergenic
1199374996 X:147097818-147097840 CAGAGATCACATGCTTCACAAGG - Intergenic
1199476981 X:148256771-148256793 CAGAGATCACATGCTTCACAAGG + Intergenic
1199529495 X:148830676-148830698 CAGAGATCACATGCTTCACAAGG + Intronic
1199536430 X:148907636-148907658 CAGAGATCACATGCTTCACAAGG + Intronic
1199561544 X:149168847-149168869 CAGAGATCACATGCTTCACAAGG + Intergenic
1199604343 X:149564785-149564807 CAGAGATCACATGCTTCACAAGG - Intergenic
1199884222 X:152003134-152003156 CAGAGATCACATGCTTCACAAGG - Intergenic
1200016310 X:153166313-153166335 CAGAGATCACGTGCTTCACAAGG - Intergenic
1200021264 X:153211753-153211775 ACAAGATCACATGCTTCAAAGGG + Intergenic
1200321517 X:155195073-155195095 CAAAGATCACATGCTTCAAAGGG + Intergenic
1200372409 X:155740785-155740807 CAAAGATCACATGATTCAAGGGG - Intergenic
1200393097 X:155964125-155964147 CAAAGATCACATGCTTCAAAAGG + Intergenic
1200393101 X:155964178-155964200 CAAAGATCACATGCTTCTGAGGG + Intergenic
1200725358 Y:6663451-6663473 CAAAGATCACATGCTTCAAAGGG - Intergenic
1200770006 Y:7115827-7115849 CAGAGATCACATGCTTCAAAAGG + Intergenic
1200861581 Y:7997948-7997970 CAGAGATCACATGCTTCACAAGG + Intergenic
1201050627 Y:9930219-9930241 CAAAGATCACATGGTTGTAGAGG - Intergenic
1201228328 Y:11839406-11839428 CAAAGATTACATACTTCAAATGG - Intergenic
1201621692 Y:15966080-15966102 AATAGGTCACATGCTTCAAGGGG + Intergenic
1201706525 Y:16943537-16943559 CAGACATCACATGCTTCAAAGGG + Intergenic
1201706529 Y:16943590-16943612 CAAAGATCACATGCTTCTGAGGG + Intergenic
1201792650 Y:17859184-17859206 CAGAGAGCACATGCTTCAGAGGG - Intergenic
1201808904 Y:18046802-18046824 CAGAGAGCACATGCTTCAGAGGG + Intergenic
1201892643 Y:18959303-18959325 CAGAGATCACATGCTTCAAATGG - Intergenic
1201913064 Y:19153130-19153152 CAGAGGTCACATGCTTCACAAGG + Intergenic
1201974019 Y:19828999-19829021 CAGAGATCACATGCTTCACAAGG + Intergenic
1202132697 Y:21628265-21628287 CAGAGATCACATGCTTCACAAGG + Intergenic
1202265951 Y:23019342-23019364 CAGGGTTCACATGCTTCATAGGG - Intergenic
1202328802 Y:23722786-23722808 CAGAGATGACATGGTTCACAAGG - Intergenic
1202340393 Y:23858485-23858507 CAGAGATCACATGCTTCATAAGG - Intergenic
1202346273 Y:23931402-23931424 CAGAGATCACATGCTTCATAAGG + Intergenic
1202354185 Y:24028432-24028454 CAGAGAGCACATGCTTCAGAGGG - Intergenic
1202418944 Y:24653085-24653107 CAGGGTTCACATGCTTCATAGGG - Intergenic
1202451842 Y:25017001-25017023 CAGGGTTCACATGCTTCATAGGG + Intergenic
1202516594 Y:25641680-25641702 CAGAGAGCACATGCTTCAGAGGG + Intergenic
1202524498 Y:25738688-25738710 CAGAGATCACATGCTTCATAAGG - Intergenic
1202530373 Y:25811597-25811619 CAGAGATCACATGCTTCATAAGG + Intergenic
1202541969 Y:25947268-25947290 CAGAGATGACATGGTTCACAAGG + Intergenic