ID: 1073374482

View in Genome Browser
Species Human (GRCh38)
Location 10:103021233-103021255
Sequence CCTTCGTCAGGGAGGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073374482_1073374490 -1 Left 1073374482 10:103021233-103021255 CCCCACAGCCTCCCTGACGAAGG 0: 1
1: 0
2: 1
3: 8
4: 225
Right 1073374490 10:103021255-103021277 GAGACAGAGTGGAGAATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073374482 Original CRISPR CCTTCGTCAGGGAGGCTGTG GGG (reversed) Intronic
900187953 1:1341791-1341813 CATTGGTCCGGGCGGCTGTGGGG + Exonic
900300164 1:1973169-1973191 CCTCCCCAAGGGAGGCTGTGCGG - Intronic
900556589 1:3283830-3283852 TGTTGGTCGGGGAGGCTGTGTGG - Intronic
900879661 1:5371708-5371730 CCTTCCTCAGTGCTGCTGTGAGG - Intergenic
900941263 1:5800089-5800111 CCTTCTTCCTGGGGGCTGTGTGG - Intergenic
900991619 1:6100753-6100775 CCATCTACAGGGAGGATGTGAGG + Exonic
901152323 1:7112100-7112122 CCTTTGTAGGGGAGGCTGTGTGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903342345 1:22662295-22662317 CCTGCTTCAGGGAGGAGGTGTGG - Intergenic
903472780 1:23598894-23598916 GCGTGGTCAGGGAGGCTTTGGGG - Intronic
904302237 1:29561778-29561800 CCCTCCTTAGGGTGGCTGTGAGG - Intergenic
905460716 1:38121219-38121241 ACTTTGTTAGGGAGGCAGTGGGG + Intergenic
906248509 1:44293761-44293783 CCTTCCTCAAAGAAGCTGTGTGG - Intronic
908169307 1:61488783-61488805 CTGTCCTCAGGAAGGCTGTGGGG + Intergenic
909130151 1:71724898-71724920 CTTTCTTCAGTGAGTCTGTGAGG + Intronic
909165064 1:72211897-72211919 CCTTTGTAAAGGAGGCAGTGAGG - Intronic
910208991 1:84774983-84775005 CCTTCATCTGAGAGGCAGTGTGG + Intergenic
912713891 1:111968531-111968553 GGTTCCTCAGGAAGGCTGTGAGG + Intronic
915283494 1:154838405-154838427 CCTTCATCCCAGAGGCTGTGGGG - Intronic
915524491 1:156467606-156467628 TCTTCATCAGGGAGGCTGAGAGG + Exonic
921147831 1:212376529-212376551 CCTTCCTCAGAGCTGCTGTGGGG + Intronic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
923826200 1:237503448-237503470 CTTGCGTCAGGGAAACTGTGGGG - Exonic
1063842996 10:10092658-10092680 CCTTTTTGAGGGAGGGTGTGTGG + Intergenic
1066650779 10:37652935-37652957 CTTGTGTCTGGGAGGCTGTGGGG + Intergenic
1069552726 10:69375763-69375785 CCCTCGTCAGCCAGGATGTGGGG + Intronic
1072991422 10:100198595-100198617 ACTTTGTCAGAGAGTCTGTGAGG - Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1076633841 10:131870018-131870040 CCTTCGGCAGGGAGGTGGGGAGG + Intergenic
1076869420 10:133186107-133186129 CCTTGGTTGGGGAGGCTCTGGGG - Exonic
1076906196 10:133362683-133362705 CCTTCGTCACCCAGCCTGTGAGG - Exonic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1078170324 11:8924695-8924717 TCTGGGGCAGGGAGGCTGTGAGG - Intronic
1079656489 11:22992290-22992312 CCCTTCTCAGGGAGTCTGTGAGG + Intergenic
1080605866 11:33864554-33864576 CCCTCGGAAGGGAGGCTGGGTGG - Intronic
1081621054 11:44619382-44619404 CCTGCGCCAGGGACGCTGTGGGG - Exonic
1081716261 11:45252543-45252565 TCAGCGTCAGGGTGGCTGTGGGG + Exonic
1083966134 11:66045151-66045173 CCCTGTCCAGGGAGGCTGTGTGG + Intronic
1084172441 11:67407002-67407024 CCTTCCTCAGTGAGGGTGAGTGG + Exonic
1084195987 11:67523818-67523840 CCTCTTTCTGGGAGGCTGTGTGG - Intergenic
1084587209 11:70069177-70069199 CCTTGGTCAGGGAGGATGGTGGG - Intergenic
1088501399 11:110486886-110486908 CCTTTGTCAGGGTTGCAGTGTGG - Intergenic
1089331580 11:117692690-117692712 CCTTGGTCAGGGAAGCAGAGGGG - Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1092522004 12:9284940-9284962 CCCTCTTCAGGTTGGCTGTGTGG - Intergenic
1092545278 12:9446916-9446938 CCCTCTTCAGGTTGGCTGTGTGG + Intergenic
1094405915 12:30116027-30116049 GCTTCGTCCTGGAGGCTGTTGGG - Intergenic
1094507671 12:31075134-31075156 CCCTCTTCAGGTTGGCTGTGTGG - Intronic
1095646936 12:44558589-44558611 CCTCCCTAAGGGAAGCTGTGAGG + Intronic
1097722500 12:63038467-63038489 CCTTAGTCATGGAAGCTGAGTGG + Intergenic
1098164303 12:67677826-67677848 CCTGCCTCAGGGATGTTGTGAGG + Intergenic
1098560607 12:71867461-71867483 ACTTATTCAGGGTGGCTGTGAGG + Intronic
1101906266 12:108828777-108828799 TCTTGGTCAGCGTGGCTGTGTGG - Intronic
1103238892 12:119397770-119397792 CGCCCGTCAGGGAGGCTGGGTGG + Intronic
1103611631 12:122127668-122127690 CCTCAGTCAGAGAGGCAGTGTGG - Intronic
1103855919 12:123972004-123972026 GCTTTGTCTGGGATGCTGTGGGG - Intronic
1103871977 12:124098811-124098833 CCCTGGTCAGGCAGGCTGTCGGG - Intronic
1104269154 12:127266767-127266789 CCCTGGGCAGGGAGGCTGTGGGG + Intergenic
1105882650 13:24617541-24617563 CCTGCGTCTGGGAGGCTGCCTGG + Intergenic
1107826032 13:44330031-44330053 TCTCCGTCCAGGAGGCTGTGGGG + Intergenic
1109083220 13:57934504-57934526 CCCTTGTCAGGGTGGCTATGAGG - Intergenic
1110817321 13:79876396-79876418 GCTTCCTCAGGGAGGCTCAGAGG - Intergenic
1113088090 13:106588623-106588645 ACTTTGCCAGAGAGGCTGTGGGG - Intergenic
1113462400 13:110491357-110491379 CCTGCCTGAGGAAGGCTGTGTGG - Intronic
1113524750 13:110966154-110966176 CCTTGGTCAGGGTGGCTTAGAGG + Intergenic
1113869402 13:113548991-113549013 CCAGGGTCAGGGAAGCTGTGGGG + Intronic
1114212712 14:20628998-20629020 CCTTGATGAGGGAGGCTGTGGGG - Intergenic
1117070494 14:52051564-52051586 GCTTCCTCCGGGAAGCTGTGGGG - Intronic
1117334382 14:54744396-54744418 CCAGCCACAGGGAGGCTGTGCGG - Intronic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1118604445 14:67492460-67492482 ACTTTGCCAGTGAGGCTGTGAGG - Intronic
1118992201 14:70808005-70808027 CCTTTGACAGTGAGGCTGTTTGG - Intronic
1121446589 14:93982712-93982734 CCTTCGCCAGGGATGCGCTGTGG + Intergenic
1122415872 14:101549221-101549243 CCCTCCTCGGGGACGCTGTGGGG - Intergenic
1124392285 15:29269848-29269870 CTTGCGTCAGGGCGGCTGGGCGG + Intronic
1126054172 15:44713904-44713926 TCCTTGTCTGGGAGGCTGTGGGG - Intronic
1126574356 15:50182727-50182749 CCTGCGCCAGGGAGACTGCGTGG + Exonic
1128520993 15:68374809-68374831 CCTTGCAGAGGGAGGCTGTGAGG - Intronic
1129693259 15:77725604-77725626 CCTTTCTCAGGGAAGTTGTGAGG - Intronic
1132831218 16:1929456-1929478 CCTTCTTCAGGGCAGCTGCGTGG - Intergenic
1135630971 16:24035411-24035433 CATTCATCATGCAGGCTGTGAGG - Exonic
1136147612 16:28324609-28324631 CCATCGTCAGGGAGCGTCTGTGG - Intergenic
1136278048 16:29191177-29191199 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1136299806 16:29326507-29326529 CCTTGGTAAAGGGGGCTGTGGGG + Intergenic
1136691308 16:32032781-32032803 CATCCATCAGTGAGGCTGTGTGG + Intergenic
1136791896 16:32976346-32976368 CATCCATCAGTGAGGCTGTGTGG + Intergenic
1136877921 16:33877562-33877584 CATCCATCAGTGAGGCTGTGTGG - Intergenic
1137481984 16:48859451-48859473 GCTTCATCAAGGAGGCTGGGAGG - Intergenic
1137709427 16:50555957-50555979 CCTTCCTCAGGGAGAGGGTGGGG - Intronic
1137943267 16:52709572-52709594 CCTTCGTTAGGGAGTCCCTGAGG + Intergenic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139657555 16:68398032-68398054 GCTTCGTCAGGGAGGGAGGGAGG + Intronic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1140897370 16:79336452-79336474 GCTTCTTCAGGGATGCTGGGAGG + Intergenic
1142078800 16:88136201-88136223 TCTGCGTGGGGGAGGCTGTGAGG + Intergenic
1142082424 16:88157217-88157239 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1142270348 16:89085729-89085751 GCTTCGTCAGTGAGGAAGTGAGG - Intergenic
1203094107 16_KI270728v1_random:1237810-1237832 CATCCATCAGTGAGGCTGTGTGG + Intergenic
1142851448 17:2706730-2706752 CCTTTCTCAGGGACCCTGTGGGG - Intronic
1143601190 17:7947284-7947306 CATTCTTCAGGGAGTTTGTGAGG + Intronic
1144704035 17:17355689-17355711 CCTGCAGCAGGGAGGCAGTGTGG + Intergenic
1145066710 17:19766392-19766414 CCTTCTTAAGGGAAGCAGTGAGG - Intergenic
1145216150 17:21054138-21054160 TCCTCTGCAGGGAGGCTGTGGGG + Intergenic
1147262020 17:39214306-39214328 CCTTCCGCAGGGTGGCTTTGGGG + Exonic
1147741921 17:42674863-42674885 CCTTGGCCAGGGAGGCAGTGTGG - Intronic
1148104951 17:45114156-45114178 CCACCGTCTGGAAGGCTGTGTGG + Intronic
1148870998 17:50658718-50658740 CCTGCATCTGGCAGGCTGTGGGG + Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1154201614 18:12304569-12304591 CCTTCCCCAGCGAGGCAGTGGGG + Intergenic
1155532738 18:26783607-26783629 CCCTTGTCAGTGATGCTGTGAGG - Intergenic
1157523850 18:48363915-48363937 CCTTCATCTGGGAGGCTGTGGGG - Intronic
1157695173 18:49716679-49716701 CCTTCCCAAGGGAAGCTGTGAGG - Intergenic
1160546102 18:79657074-79657096 GCTAGGCCAGGGAGGCTGTGAGG + Intergenic
1160865849 19:1255639-1255661 CCTGCAGCAGGGAGGCTGAGGGG - Exonic
1160889362 19:1369122-1369144 CCTTTGTCAGGGAGGGTCAGAGG + Intronic
1161602571 19:5193483-5193505 TCTTTGTCTGGGGGGCTGTGGGG + Intronic
1162268619 19:9596178-9596200 CCTTGGTCAGGGTGGCTAAGTGG - Intergenic
1162311415 19:9909672-9909694 CCAACGTCGGGGAGGCTGAGGGG - Intronic
1162494728 19:11017365-11017387 CCTACTTCAGTGAGGTTGTGAGG + Intronic
1163856418 19:19705982-19706004 TGTTGGTCTGGGAGGCTGTGGGG - Intergenic
1164916055 19:32053143-32053165 TCTTCCCAAGGGAGGCTGTGGGG + Intergenic
1166740941 19:45114484-45114506 CATTTGACAGGGAGGATGTGGGG - Intronic
1166864759 19:45829116-45829138 CCTTCATCCTGGAGGATGTGCGG - Exonic
1167486011 19:49763333-49763355 CCTTTGTGAGGCAGGCTGAGGGG - Intergenic
926197174 2:10771117-10771139 CCCTCCTCAGGGAGCCTGCGTGG - Intronic
929509343 2:42554734-42554756 CCCTTCTCAGAGAGGCTGTGAGG - Intronic
930421816 2:51163413-51163435 TCTTCTTCAGGGAGGCTTTAAGG - Intergenic
931282666 2:60807851-60807873 CCTTGGTCAGGGATGGTGTTGGG + Intergenic
932225279 2:70034786-70034808 CCTTCTTCAGAGGGTCTGTGGGG - Intergenic
932234821 2:70112525-70112547 CTTTCCCCAGGGAGGCTTTGGGG + Intergenic
935874843 2:107495064-107495086 GCTTTGGCAGGAAGGCTGTGAGG - Intergenic
937298524 2:120824332-120824354 CCTTGGCCAGGGGGACTGTGTGG + Intronic
937312144 2:120909045-120909067 CCTCCAGCAGAGAGGCTGTGAGG + Intronic
944547481 2:200812151-200812173 GCTTCGGCAGGGAGGCCGAGGGG + Intronic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
948487428 2:238289641-238289663 CCTTTCTCACGGAGCCTGTGGGG - Intronic
1168823420 20:792621-792643 CCTTGGTCAGGGTGGCTTAGAGG + Intergenic
1171341283 20:24431377-24431399 AGTTTGTCTGGGAGGCTGTGGGG - Intergenic
1171341432 20:24431953-24431975 GTTTTGTCTGGGAGGCTGTGGGG - Intergenic
1171981798 20:31633736-31633758 CCTTTTTCAGGGTGGCTGGGAGG - Intergenic
1172187750 20:33041857-33041879 CCTGCATCAGGGAGGCGTTGGGG + Intronic
1173624912 20:44465732-44465754 CCTGCTTCAGGGAGGTGGTGTGG + Intergenic
1173791501 20:45830820-45830842 CATTTCTCAGGGAGGCTGTAGGG + Intronic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1174483249 20:50845603-50845625 CCTGCCTCAGGGGGGCAGTGGGG - Intronic
1176092633 20:63325784-63325806 CCTTGGAGATGGAGGCTGTGGGG + Intronic
1176270052 20:64231640-64231662 CCTCAGTCTGGGAGGCTGTGGGG + Intronic
1178412007 21:32372151-32372173 CCTGCGTCAGGACTGCTGTGAGG + Intronic
1181044593 22:20208579-20208601 CCGTGGGCAGGGTGGCTGTGGGG + Intergenic
1181083937 22:20430627-20430649 CCTTTGTTAGGGAGGCAGGGCGG + Intronic
1181538140 22:23557452-23557474 CCTTGGTCAAGGTGGGTGTGGGG - Intergenic
1181571097 22:23768115-23768137 CCTGCGCCTGGCAGGCTGTGCGG + Exonic
1182883685 22:33755357-33755379 CCATTGTCAGGGAGGCAGTCCGG - Intronic
1183465458 22:37978087-37978109 CCTTCATCGAGGAGGCTGAGCGG - Exonic
1183483337 22:38076544-38076566 CCCCCTTCAGGGAGGCAGTGTGG - Intergenic
1184080363 22:42214976-42214998 CCTTCGCTGAGGAGGCTGTGGGG + Exonic
1184650133 22:45915846-45915868 ACTTGGTCATGGAGGCTGAGGGG + Intergenic
1184887325 22:47354377-47354399 GCTCCATCAGGGAGGCTCTGGGG - Intergenic
950088176 3:10276138-10276160 CCTGCCTCAGGGTGGTTGTGAGG + Intronic
950846878 3:16023402-16023424 CCTTGGTCAGGGTGGCTTAGAGG - Intergenic
961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG + Intergenic
963619470 3:147587503-147587525 CTTTGGTCAGGAAGGCTGTATGG + Intergenic
964412527 3:156413663-156413685 TCTTGGCCAGGGAGGCTCTGTGG - Intronic
966315106 3:178635652-178635674 CCTTCTTCATTCAGGCTGTGTGG + Intronic
968971834 4:3799756-3799778 CCTGCGTCAGCGAGGGTCTGGGG - Intergenic
969611035 4:8227966-8227988 GTTTGGGCAGGGAGGCTGTGGGG - Exonic
971853095 4:32009985-32010007 CCCTCCCCAGGGAGGCAGTGAGG + Intergenic
972150220 4:36079964-36079986 CCTAAGCCAAGGAGGCTGTGGGG + Intronic
978323037 4:107519229-107519251 CCTCCCACAGGGAGGCAGTGTGG - Intergenic
978398232 4:108305284-108305306 CCTCCTTCAGGGAGGCAGGGAGG + Intergenic
982296565 4:153835131-153835153 CCTTTGTCCTGGAGGCAGTGCGG + Intergenic
985472205 5:53392-53414 CCCTTCTCAGGCAGGCTGTGGGG + Intergenic
985764273 5:1768611-1768633 TCGTTGTCATGGAGGCTGTGGGG + Intergenic
989283843 5:39675855-39675877 TCTTGGGCAGGCAGGCTGTGAGG + Intergenic
989615817 5:43335790-43335812 CCTTGGTCAGGGTGGCTTAGAGG - Intergenic
990725659 5:58751437-58751459 TCTAAGTCAGGGAGGCTGAGAGG + Intronic
994918102 5:106005142-106005164 CCCTCCTAAGGGAAGCTGTGAGG - Intergenic
995456304 5:112356168-112356190 CCATCGTCAGGGAGCCATTGTGG - Intronic
1000258243 5:159561058-159561080 TCCTCCTCAGGGAGGTTGTGTGG - Intergenic
1000575984 5:162975819-162975841 CCTTGATAAGGAAGGCTGTGTGG - Intergenic
1001121642 5:168985716-168985738 CCTTGAACCGGGAGGCTGTGAGG + Intronic
1001798619 5:174523907-174523929 CATTCCTCCTGGAGGCTGTGGGG + Intergenic
1002366335 5:178715412-178715434 AGTTAGTCAGGGAGGGTGTGTGG - Intronic
1002692239 5:181058673-181058695 CCTTCGTCAGAGAATCTGGGAGG - Intronic
1003138236 6:3449670-3449692 CCTGGGTCAGGGAGGGTGTAGGG + Intronic
1004402735 6:15304051-15304073 CCTTGGTCTGGGTTGCTGTGGGG + Intronic
1004540447 6:16544550-16544572 CCTACATCTGGGATGCTGTGGGG + Intronic
1004635629 6:17465093-17465115 CCATAGTCAGGGACACTGTGTGG + Intronic
1007404163 6:41624062-41624084 TCTTCTCCAGGGAGGCTGAGTGG - Intergenic
1010006164 6:70997908-70997930 CCTACCTAAGGGAAGCTGTGAGG + Intergenic
1014004626 6:116403959-116403981 CCTTGATCAGGGAGGGAGTGGGG + Intronic
1014699941 6:124672663-124672685 CCTTTGACAATGAGGCTGTGTGG + Intronic
1016725092 6:147354930-147354952 CATTGGTCAGGGAGGCAATGGGG + Intronic
1017220067 6:151955872-151955894 CCTACGTGAGGGAGGGTGAGAGG - Intronic
1017776653 6:157686089-157686111 CCTTTCTCAGAGGGGCTGTGTGG - Intergenic
1019937161 7:4264370-4264392 CCTGAGTGAGGGAGGCCGTGTGG + Intronic
1026771688 7:73205470-73205492 TCTGTGTCAGGGATGCTGTGTGG + Intergenic
1027012556 7:74758867-74758889 TCTGTGTCAGGGATGCTGTGTGG + Intronic
1027075484 7:75187186-75187208 TCTGTGTCAGGGATGCTGTGTGG - Intergenic
1028118683 7:87031173-87031195 CCTTCATCAGGAATGCTGTCTGG + Intronic
1029248447 7:99219146-99219168 AGTTGGTCAGGGAGGCTGAGGGG + Intergenic
1031760524 7:125707807-125707829 CATTGGTCAGGGAGCCAGTGTGG - Intergenic
1033098288 7:138449533-138449555 CCTTGGTCAGGGTGGCTTAGAGG - Intergenic
1035115021 7:156517117-156517139 GCTGTGTCGGGGAGGCTGTGAGG + Intergenic
1035115075 7:156517396-156517418 GCTGTGTGAGGGAGGCTGTGTGG + Intergenic
1035115140 7:156517717-156517739 GCTGTGTGAGGGAGGCTGTGTGG + Intergenic
1036416110 8:8550183-8550205 CCCACTTCAGGGAGGATGTGGGG + Intergenic
1036900472 8:12665818-12665840 CCTTCGGCAGGGAGACTATCGGG - Intergenic
1039545076 8:38404185-38404207 CCATAGTGAGGGAGGCTGTAGGG + Intronic
1039696232 8:39915215-39915237 CCTTCTTAAGAGAGGCAGTGTGG - Intronic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1039894547 8:41707220-41707242 GCTTCGTCAGGAAGGCAGTAAGG + Intronic
1049580615 8:143408939-143408961 CCTTGGGCAGGGATGCTGAGGGG + Intergenic
1049587735 8:143439883-143439905 CCTTGGTGAGGGAGGCCCTGGGG + Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1050565392 9:6876923-6876945 CCGACATCAGGGAGGTTGTGGGG + Intronic
1056289699 9:85130259-85130281 CCTTCCTCCAGGAGGCTGTTGGG - Intergenic
1056388232 9:86116905-86116927 CATTCTTCAGGAAGGCAGTGAGG - Intergenic
1057128563 9:92637967-92637989 CCTTCCCCAGGTAGGCGGTGGGG - Intronic
1058650828 9:107174553-107174575 TCTTCCTCAGCCAGGCTGTGGGG - Intergenic
1061243841 9:129391106-129391128 CCTTGGTCAAGGTGGGTGTGGGG + Intergenic
1062096618 9:134707044-134707066 GCCACGTCAGGGAGGCTGGGAGG + Intronic
1062266110 9:135687287-135687309 CCTTCCACTGGGAGGGTGTGGGG - Intergenic
1062277866 9:135739206-135739228 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062280269 9:135748816-135748838 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062294808 9:135818799-135818821 CGGTGGCCAGGGAGGCTGTGTGG - Intronic
1062397487 9:136358332-136358354 CCTGGGTCGGGGAGGCCGTGGGG - Exonic
1062448953 9:136607535-136607557 CATGCACCAGGGAGGCTGTGCGG + Intergenic
1185611573 X:1396485-1396507 CCTTTCCCAAGGAGGCTGTGTGG - Intergenic
1186669393 X:11754915-11754937 CCATCGTCACTGAGGCTCTGAGG - Intergenic
1190731765 X:53231279-53231301 CCTTCATCAGGGATGTTGGGGGG + Intergenic
1192433375 X:71127322-71127344 GCTTCTTCATGCAGGCTGTGTGG + Exonic
1192834309 X:74782825-74782847 CCTGGGTAAGGGAGGCAGTGTGG + Intronic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic