ID: 1073375644

View in Genome Browser
Species Human (GRCh38)
Location 10:103032016-103032038
Sequence ACTAGTCACTGCGGCAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073375639_1073375644 21 Left 1073375639 10:103031972-103031994 CCTGCACTGATGCACGAGCATGA 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1073375644 10:103032016-103032038 ACTAGTCACTGCGGCAGTGGAGG No data
1073375640_1073375644 -4 Left 1073375640 10:103031997-103032019 CCACTGCAAGCCTGCGTGAACTA 0: 1
1: 0
2: 0
3: 1
4: 114
Right 1073375644 10:103032016-103032038 ACTAGTCACTGCGGCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073375644 Original CRISPR ACTAGTCACTGCGGCAGTGG AGG Intronic
No off target data available for this crispr