ID: 1073379158

View in Genome Browser
Species Human (GRCh38)
Location 10:103064997-103065019
Sequence TGAGATTCACTGCTGCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073379158_1073379164 -3 Left 1073379158 10:103064997-103065019 CCACCCCGCAGCAGTGAATCTCA No data
Right 1073379164 10:103065017-103065039 TCAACTAGATGGAGTCCAGAGGG No data
1073379158_1073379167 23 Left 1073379158 10:103064997-103065019 CCACCCCGCAGCAGTGAATCTCA No data
Right 1073379167 10:103065043-103065065 ATGGCAGATCCTCCCCTGCCTGG No data
1073379158_1073379163 -4 Left 1073379158 10:103064997-103065019 CCACCCCGCAGCAGTGAATCTCA No data
Right 1073379163 10:103065016-103065038 CTCAACTAGATGGAGTCCAGAGG No data
1073379158_1073379168 24 Left 1073379158 10:103064997-103065019 CCACCCCGCAGCAGTGAATCTCA No data
Right 1073379168 10:103065044-103065066 TGGCAGATCCTCCCCTGCCTGGG No data
1073379158_1073379165 4 Left 1073379158 10:103064997-103065019 CCACCCCGCAGCAGTGAATCTCA No data
Right 1073379165 10:103065024-103065046 GATGGAGTCCAGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073379158 Original CRISPR TGAGATTCACTGCTGCGGGG TGG (reversed) Intronic