ID: 1073379164

View in Genome Browser
Species Human (GRCh38)
Location 10:103065017-103065039
Sequence TCAACTAGATGGAGTCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073379158_1073379164 -3 Left 1073379158 10:103064997-103065019 CCACCCCGCAGCAGTGAATCTCA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1073379164 10:103065017-103065039 TCAACTAGATGGAGTCCAGAGGG No data
1073379159_1073379164 -6 Left 1073379159 10:103065000-103065022 CCCCGCAGCAGTGAATCTCAACT No data
Right 1073379164 10:103065017-103065039 TCAACTAGATGGAGTCCAGAGGG No data
1073379160_1073379164 -7 Left 1073379160 10:103065001-103065023 CCCGCAGCAGTGAATCTCAACTA 0: 1
1: 0
2: 0
3: 15
4: 123
Right 1073379164 10:103065017-103065039 TCAACTAGATGGAGTCCAGAGGG No data
1073379161_1073379164 -8 Left 1073379161 10:103065002-103065024 CCGCAGCAGTGAATCTCAACTAG 0: 1
1: 0
2: 1
3: 16
4: 212
Right 1073379164 10:103065017-103065039 TCAACTAGATGGAGTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073379164 Original CRISPR TCAACTAGATGGAGTCCAGA GGG Intronic
No off target data available for this crispr