ID: 1073379167

View in Genome Browser
Species Human (GRCh38)
Location 10:103065043-103065065
Sequence ATGGCAGATCCTCCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073379158_1073379167 23 Left 1073379158 10:103064997-103065019 CCACCCCGCAGCAGTGAATCTCA No data
Right 1073379167 10:103065043-103065065 ATGGCAGATCCTCCCCTGCCTGG No data
1073379161_1073379167 18 Left 1073379161 10:103065002-103065024 CCGCAGCAGTGAATCTCAACTAG No data
Right 1073379167 10:103065043-103065065 ATGGCAGATCCTCCCCTGCCTGG No data
1073379159_1073379167 20 Left 1073379159 10:103065000-103065022 CCCCGCAGCAGTGAATCTCAACT No data
Right 1073379167 10:103065043-103065065 ATGGCAGATCCTCCCCTGCCTGG No data
1073379160_1073379167 19 Left 1073379160 10:103065001-103065023 CCCGCAGCAGTGAATCTCAACTA No data
Right 1073379167 10:103065043-103065065 ATGGCAGATCCTCCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073379167 Original CRISPR ATGGCAGATCCTCCCCTGCC TGG Intronic