ID: 1073390776

View in Genome Browser
Species Human (GRCh38)
Location 10:103174572-103174594
Sequence TTCTTTTTTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 814
Summary {0: 1, 1: 0, 2: 4, 3: 88, 4: 721}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073390776_1073390779 4 Left 1073390776 10:103174572-103174594 CCAGCACTCCCTCAAAAAAAGAA 0: 1
1: 0
2: 4
3: 88
4: 721
Right 1073390779 10:103174599-103174621 AAAAAAATTTTTATTAACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073390776 Original CRISPR TTCTTTTTTTGAGGGAGTGC TGG (reversed) Intronic
900040296 1:456418-456440 TTTTTTTTTGGGGGGGGTGCTGG - Intergenic
901963150 1:12843394-12843416 TTCTTTTTTTGAAGCAGGGATGG - Intergenic
901990338 1:13107715-13107737 TTCTTTTTTTGAAGCAGGGATGG - Intergenic
902101142 1:13990272-13990294 TTCTTTTCTTGATGGACTCCTGG - Intergenic
902304562 1:15526298-15526320 TTTTTTTTTTGAGAGAATCCAGG - Intronic
902492937 1:16798535-16798557 TTTTTTTTTTGATGGAGTTTTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902584693 1:17431487-17431509 TTTTTTTTTTGAGACAGGGCTGG - Intronic
902859164 1:19232326-19232348 TTCTCTCTTTGAGGAAGAGCAGG - Intronic
903318682 1:22528536-22528558 TTCTTTTTTTGGGGGAGACAGGG + Exonic
903898334 1:26623573-26623595 TTTTTTTTTGGAGAGATTGCGGG + Intergenic
904311054 1:29629869-29629891 TTCTTCTTTTGAGGGAGGACAGG + Intergenic
904691654 1:32297613-32297635 TTCTTTTTTTGCGGGGGGGACGG + Intronic
904722044 1:32517477-32517499 TACTTTTTTTGGGGGGGTGGTGG - Intronic
905129306 1:35741315-35741337 TTCTTTTTTTGCGGGGGTCGGGG + Intronic
905279577 1:36840539-36840561 TTTTTTTTTTGGTGGAGAGCAGG - Intronic
905854564 1:41300078-41300100 TTCTTTTTTTGTGGGGGAGGGGG + Intergenic
906167673 1:43699101-43699123 TTTTTTTTTTGAGAGAGACCAGG + Intronic
907449518 1:54534889-54534911 TTTTTTTTTTGAGACAGGGCTGG - Intergenic
907813996 1:57900355-57900377 TTCTTTATTTGAGAGAAAGCAGG + Intronic
908065533 1:60399984-60400006 TTCTTTTTTTGGAGGTGAGCTGG + Intergenic
908101875 1:60799413-60799435 TTTTTTTTTTAAGGCAGTTCAGG + Intergenic
908236609 1:62153019-62153041 TTCTTTTTTTGAGACGGAGCTGG - Intronic
908315860 1:62931990-62932012 TTCTTTTTTTGGGGGGGGACAGG + Intergenic
908705377 1:66948249-66948271 TTCTTTTTATCATGGAGTACAGG - Intronic
908725064 1:67167099-67167121 TCCTCTTTTTTAGGGGGTGCGGG + Intronic
909012188 1:70347240-70347262 TTATTTTCTTGAGGGAGAGCTGG - Intronic
909625472 1:77711048-77711070 TTGTTTTTTTGAGGGACTCCTGG - Intronic
910042341 1:82867835-82867857 TTCTGTTTTTGATGGGATGCAGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910692393 1:89977953-89977975 TTCTTTTTTGGTGGGGGGGCGGG - Intergenic
910875878 1:91877318-91877340 TTCTTTTTTTGTGTGTGTGGTGG + Intronic
911068949 1:93816966-93816988 TTTTTTTTTTGAGGGGGTGGTGG - Intronic
911570939 1:99516156-99516178 TTTTTTTTTTGGGGGGGGGCAGG - Intergenic
911953682 1:104209576-104209598 TTTTTTTTTTGAGAGAGAGAGGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912056209 1:105601484-105601506 TTCTCTTTTTGAGTGTGTCCTGG - Intergenic
912066105 1:105745577-105745599 TTCTTTTTTTGGGTGGGGGCGGG - Intergenic
912940652 1:114041855-114041877 CTCTTTATTTGAAGGAGTGTGGG + Intergenic
913027919 1:114864489-114864511 TTCTTTTTTTGATGGGGGGTGGG + Intronic
913516142 1:119607128-119607150 TTTTTTTTTTGAGATGGTGCTGG - Intergenic
913597302 1:120390804-120390826 TTTTTCTTTTGCGGGGGTGCGGG + Intergenic
913694965 1:121315914-121315936 CTCTTTTTGTGTGGGGGTGCAGG - Intronic
914090026 1:144488505-144488527 TTTTTCTTTTGCGGGGGTGCGGG - Intergenic
914142596 1:144964144-144964166 CTCTTTTTGTGTGGGGGTGCAGG + Intronic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916412845 1:164563458-164563480 TTCTTTTTTTTAAGGAAAGCAGG - Intronic
917173991 1:172210959-172210981 TTTTTGTTTTGAGGGAGGGAAGG - Intronic
917663849 1:177204595-177204617 TTCTTTATTAGAGAGAGAGCCGG - Intronic
918499900 1:185182656-185182678 TTTTTTTTTTGAGAGAGAGAGGG - Intronic
918572507 1:186014662-186014684 TTCTTTTTTTGGGGGGGAGGTGG - Intronic
918848232 1:189646918-189646940 TTTTTTTTTTGAGGCAGAGTCGG + Intergenic
918892750 1:190296067-190296089 TTTTTTTTTTGGGGGGGGGCTGG + Intronic
919167123 1:193909663-193909685 TTCTTTTGGTCAGGGAGTGCTGG - Intergenic
919445884 1:197704544-197704566 TTCTTTTTTTGATACAGTGGAGG - Intronic
919518818 1:198561629-198561651 TTCTTTTCTCTAGGGAGTGGAGG - Intergenic
919919284 1:202158794-202158816 TTTTTTTTTTGAGAGAGAGGAGG + Intronic
920036722 1:203070573-203070595 TTTTTTTTTTGAGGGAGACAGGG - Intronic
920406229 1:205714245-205714267 TTCCTTTTTTGATGGGGTGTGGG - Exonic
920482297 1:206334297-206334319 CTCTTTTTGTGTGGGGGTGCAGG - Intronic
920675509 1:208035788-208035810 TTCTTTTTTGGTGGGAGAGAGGG - Intronic
921373987 1:214454475-214454497 TTCTTTCTCTGAGGGATTTCTGG - Intronic
921533451 1:216313688-216313710 TTCTTTTATTGAGAGTCTGCTGG + Intronic
922225037 1:223638684-223638706 TTGTTTGTTTGAGGGAGAGTAGG - Intronic
922524144 1:226284993-226285015 TTCTTTCTTTGAGGAAGTCCAGG - Intronic
923527510 1:234783993-234784015 TTTTTTTTTTGATGGAGTTTTGG - Intergenic
923762846 1:236862964-236862986 TTCTTTTTTTGGGGCAGTAGTGG + Intronic
923788512 1:237091418-237091440 TTCTTTTTTTTGGGGGGGGCGGG + Intronic
923827039 1:237511822-237511844 TTTTTTTTTTCAGGGAAGGCAGG - Intronic
924020056 1:239771400-239771422 TTCTTTTTTGGCGGGAATCCAGG - Intronic
924026812 1:239842218-239842240 TTTTTTTTTTGAGGGGGTTGGGG + Intronic
1063805902 10:9640225-9640247 AACTATTTTTGAGGGAGTGGTGG - Intergenic
1064222091 10:13450191-13450213 TTTTTTTCTAGAGGCAGTGCAGG + Intronic
1064409533 10:15093049-15093071 TTTTTTTTTTGATTGAGTGCAGG + Intergenic
1064759699 10:18605183-18605205 TTTTTTTTTTAAGGGAGTCTCGG - Intronic
1064966999 10:21024807-21024829 TTCTTTTTTTGCTGGAGAGGTGG - Intronic
1065014227 10:21446945-21446967 TTGTTCTTTTGAGGGAGTAAGGG - Intergenic
1065092660 10:22251254-22251276 TTTTTTTTTTGAGGCTGTGCAGG - Intergenic
1065569405 10:27054564-27054586 TTCTTTTTTTGTGTGTGTGATGG - Intronic
1065576752 10:27128579-27128601 TTCTTTTTTTTGGGGGGTGGGGG - Intronic
1065682651 10:28252906-28252928 TTCTTTTTTTTTGGGAGGGGGGG + Intronic
1066414692 10:35210316-35210338 TTCTTTTTTTCAGGGTGGGAGGG - Intronic
1067367639 10:45649144-45649166 TTTTTTTTTTGAGGGACTACAGG - Intronic
1067550927 10:47235608-47235630 TTAATATTTTGAGGGACTGCTGG - Intergenic
1067590804 10:47508062-47508084 TTTTTTTTTTGGGGGGGTGGTGG + Intronic
1067637923 10:48016162-48016184 TTTTTTTTTTGGGGGGGTGGTGG + Intergenic
1068259233 10:54556659-54556681 TTTTTTTTTTCAGTGAGAGCAGG + Intronic
1069330894 10:67291692-67291714 TTCTTTTTGTGTGTGAGTGGCGG - Intronic
1069429777 10:68324159-68324181 TTTTTTTTTTGAGATAGAGCTGG + Intronic
1069449098 10:68501841-68501863 TACTTTTGTAGAGGGAGTGAGGG - Intronic
1070255709 10:74811729-74811751 TTCTTTTTTTGAGAGAGAGAGGG + Intergenic
1070427372 10:76302521-76302543 TTCTTTTTTTTGGGGGGTGGTGG + Intronic
1070503908 10:77096455-77096477 TGGCTTTTTTGAGGGAGTGTGGG - Intronic
1070961149 10:80501118-80501140 TTCTTTTTTTTTGGGAGACCTGG + Intronic
1071224220 10:83509214-83509236 TTTTTATTTTGGGGAAGTGCCGG + Intergenic
1071747322 10:88436755-88436777 TTTTTTTTTAAAGGGAATGCAGG + Intronic
1072156823 10:92731179-92731201 TTCTTTTTTTGGGGGAGGCAGGG + Intergenic
1072512182 10:96138950-96138972 TTTTTTTTTTGAGGAAGGGATGG + Intronic
1072592102 10:96835771-96835793 TACTTTTTTGGAGGGTGTGGGGG + Intronic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1074556578 10:114496817-114496839 TTCTGTTTTTGCAGCAGTGCAGG + Intronic
1074706950 10:116141575-116141597 TCTTTTTTTTGAGGGGGTGGTGG + Intronic
1075303733 10:121348901-121348923 ATCTTTTCTTGGGGGAGTGAAGG + Intergenic
1076983490 11:218536-218558 TGCTTTATTTTAGGGAGTGAAGG + Intronic
1077435639 11:2537723-2537745 TTATTTTTTTGAGAGAGAGAGGG + Intronic
1078295673 11:10067367-10067389 TTGTTTTTTTGAGGGGGAGGGGG + Intronic
1078753010 11:14182784-14182806 TTCTATTTTTCAGTGAGCGCTGG - Intronic
1078766803 11:14306054-14306076 TTCTTTTTTTGTTGGGGTGGGGG - Intronic
1078861066 11:15247030-15247052 TTTTTTTTTTTAGAGAGAGCTGG + Exonic
1078886207 11:15502621-15502643 TTTTTTTTTTTGTGGAGTGCAGG - Intergenic
1079255237 11:18822214-18822236 TTTTTTTTTTGATGGAGTCTCGG + Intergenic
1079623128 11:22579738-22579760 TTCTTTTTTTTAAGAAGTGATGG - Intergenic
1079983934 11:27180193-27180215 TTCTTGATTGGAGGCAGTGCAGG + Intergenic
1080568627 11:33535664-33535686 TTCTTTTTTGGAGGGGGGACAGG - Intergenic
1080734877 11:35003800-35003822 TTCCTTTTTTAAGGGACTGGGGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081345849 11:41984829-41984851 TTCTTTTTTGGAGGGTGGGATGG - Intergenic
1081365109 11:42225702-42225724 TTCTTTTTTTGTGGAGGTGGTGG + Intergenic
1081814180 11:45929395-45929417 TTTTTGTTTTGAGGGGGTGGGGG - Intronic
1081891868 11:46549817-46549839 TTCTTTTTTGGGGGGGGTGGGGG + Intronic
1082819213 11:57532652-57532674 TTCTTTTTTGCGGGGAGTGGGGG - Intergenic
1083082579 11:60109197-60109219 TTCTTTTTTTCGGGGGGTGGAGG - Intergenic
1083452443 11:62754826-62754848 CTCTTTTTTTGGGGGGGTGGGGG - Intergenic
1084975548 11:72795608-72795630 GTCTTTTTTGGGGGGAGGGCAGG + Intergenic
1085305644 11:75484195-75484217 TTCTTTTTTTGTGGGAGGGTTGG - Intronic
1085579029 11:77634332-77634354 TTCTTCATCTGAGGGAGTGAGGG - Intronic
1085623051 11:78051498-78051520 CTATTTATTTGAGGGAGTGGTGG - Intronic
1085990163 11:81832171-81832193 TTATCTTTTTGAGGTGGTGCTGG - Intergenic
1087565439 11:99850819-99850841 TTGTTTCTTTGAGGAAGTGTTGG - Intronic
1087747245 11:101963209-101963231 TTCTTTTTTTGAGGCTGGCCAGG - Exonic
1089365898 11:117920810-117920832 TTGTTTGTTTGTGGGAATGCTGG + Intronic
1089905900 11:122038236-122038258 TTCTTTTTTTGACAGAGTGCAGG - Intergenic
1090504431 11:127296603-127296625 TTCTTTTTTTGAGACAGAGTCGG + Intergenic
1090562337 11:127946030-127946052 GTTTTTTTTGGGGGGAGTGCGGG - Intergenic
1090724196 11:129508325-129508347 TTATTTTTTTGAGACAGGGCAGG - Intergenic
1090876532 11:130793620-130793642 TTCTTTTTTTAAGGGAGAGATGG - Intergenic
1091085991 11:132722320-132722342 TTGTTTTTTAGAGGGGATGCAGG + Intronic
1091117109 11:133023644-133023666 ATCTTTATTTGAGGCAGTGATGG - Intronic
1091142936 11:133251568-133251590 TTCTTTTTTTGGGGGGGGGAGGG + Intronic
1091291562 11:134443167-134443189 TTCTGTTTTGTGGGGAGTGCGGG - Intergenic
1091472015 12:736958-736980 TTTTTTTTTTGAGGAGGTGGGGG + Intergenic
1091487006 12:899316-899338 TTGTTTTTTTGAGGCAGAGTCGG + Intronic
1091992442 12:4966574-4966596 TTTTTTGTTGGAGGGAGTGAGGG - Intergenic
1092115428 12:5998453-5998475 TTTTTTTTTTGACGGAGTCTCGG - Intronic
1092376459 12:7959635-7959657 TTCTTTTTTTGGGGGGGTGGGGG - Intergenic
1092386706 12:8041203-8041225 TTTTTTTTTTGTGGGGGTGGGGG + Intronic
1092706296 12:11288896-11288918 TTATTTTGTTGAGGAAGTTCTGG - Intergenic
1093016045 12:14155705-14155727 TTCTTTTTGAGAGGGAGTCTTGG - Intergenic
1093114649 12:15194498-15194520 TTTTTTTTTTTAGGGAGATCGGG - Intronic
1093442887 12:19220121-19220143 TTCTTTTTTTGGGGGTGGGGTGG - Intronic
1093769856 12:23005798-23005820 TACTTTTTTTGAGGGGTTGGGGG - Intergenic
1093770779 12:23015269-23015291 TTATTTTTTTGAGAGAGAGAGGG + Intergenic
1093815685 12:23543375-23543397 TTCCTGTTTTCAGGAAGTGCTGG - Exonic
1093840238 12:23889717-23889739 TTCTTCTTTTGATGGACTTCAGG + Intronic
1094602331 12:31920308-31920330 TTTTTTTTTTGAGAGAGAGAGGG - Intergenic
1094672497 12:32584590-32584612 TTCTTTTTTTTTGGGAGGGGGGG - Intronic
1095702339 12:45203134-45203156 TTCTTTTTTTGAAGGAGGTGGGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095898264 12:47302268-47302290 TTCTTCTTTTGTGTGTGTGCTGG + Intergenic
1096246781 12:49994500-49994522 TTTTTTTTTCCAGGGAATGCTGG - Exonic
1096359136 12:50968381-50968403 TTCTTTTTTTGTGTGTGTGTGGG + Intronic
1096598278 12:52711585-52711607 TTTTTTTTTTGAGACAGGGCAGG + Intergenic
1097059361 12:56271034-56271056 TTCTTTTCCTGGGGGAGTGAAGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097637463 12:62140233-62140255 GTGGTTTTGTGAGGGAGTGCTGG + Intronic
1097693587 12:62756421-62756443 TTTTTTTTTTGGCTGAGTGCAGG - Intronic
1097884669 12:64717093-64717115 TTTTTCTTTTGAGGGAGTAGGGG + Intronic
1098331490 12:69358458-69358480 TTCTTTTTTTGAGGGGGAGGGGG + Intergenic
1099044221 12:77695832-77695854 TTCTTTATTTGAGGCACTGAGGG - Intergenic
1099651752 12:85437418-85437440 TTCTTTTTTTGGGGGGGTAGGGG + Intergenic
1099799190 12:87435728-87435750 TTACTTTGTTGAGTGAGTGCTGG - Intergenic
1100043981 12:90356320-90356342 TTTTTTTTTTGGCGGAGTGGGGG + Intergenic
1100260177 12:92926003-92926025 TTTTTTTTTAGACGGAGTTCCGG + Intronic
1100425608 12:94482804-94482826 ATCTTTATTTGAGAGAATGCTGG + Intergenic
1100515337 12:95322199-95322221 TTTTTTTTTTGAGGGAGCATTGG + Intergenic
1101910215 12:108856043-108856065 TTCTTTGTGGGAGGGAGTGGGGG - Intronic
1101930533 12:109010115-109010137 TTTTTTTTTTGAGAGAGAGAGGG - Intronic
1102361740 12:112293899-112293921 TTCTTTTTTTGTGGGCGGGGAGG + Intronic
1102672410 12:114631352-114631374 TTGTTTTCTTCTGGGAGTGCAGG + Intergenic
1102754738 12:115328678-115328700 TTTTTTTTTTGAGAGAGAGAGGG + Intergenic
1102948246 12:117009390-117009412 TGGTTTTTTTGAGGGGGTGGGGG - Intronic
1103123480 12:118400341-118400363 TTCTTAATTTGAGGGAGAGGAGG + Intronic
1104369700 12:128212930-128212952 TTCTTTTTTGGAAGGAGGTCAGG - Intergenic
1104455913 12:128911974-128911996 TTCTTTTTTTCTGGGGGTGGTGG + Intronic
1105831758 13:24168729-24168751 TTCTTGTTTTGAATGAGGGCTGG - Intronic
1106388154 13:29307965-29307987 TTCTTTTTTTGACTGAGCACAGG - Intronic
1106732921 13:32560602-32560624 TTTTTTTTTTGACAGAGTCCAGG - Intergenic
1107426504 13:40298790-40298812 TTTTTTTTTTCAGGGAGGGGTGG + Intergenic
1107568185 13:41628162-41628184 TTGTTTTTTGGAGGGAATGAAGG - Intronic
1107621508 13:42236085-42236107 TTCTCTATGTGAGGCAGTGCTGG + Intronic
1107833621 13:44396421-44396443 TTTTTTTTTTGAAGGAGGGTGGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1107934322 13:45332217-45332239 TTTTTTTTTTGTGGGGGAGCGGG - Intergenic
1108037437 13:46306244-46306266 TCCTTTTTTTGGGGGGGTGGTGG + Intergenic
1108127222 13:47257432-47257454 TTCTGTTTTTGAGGGATACCAGG - Intergenic
1108137917 13:47385558-47385580 TTCTTTTTTGGGGGGGGTGGGGG + Intergenic
1108566747 13:51707155-51707177 TTCTTTTTTTGGGGGGCAGCAGG + Intronic
1108724022 13:53161355-53161377 TTCTTTTTTTCAGGGAGAAAAGG + Intergenic
1109184887 13:59256318-59256340 TTCGTTTTTTGAGGGGGTAGGGG + Intergenic
1109255879 13:60081557-60081579 GTCTTTTTTTGTGGGAGATCAGG - Intronic
1109487355 13:63044527-63044549 TTGTTTTGTTGAGGGAATGAAGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109563919 13:64085972-64085994 CTCTTTTTTTTGGGGGGTGCGGG - Intergenic
1109746815 13:66634786-66634808 TACTTTTTTGGAGGGGGTGGGGG - Intronic
1110284572 13:73734609-73734631 TTCCTTTTTTGGGGGGGTGGGGG + Intronic
1110350070 13:74496658-74496680 TTCTTTTTTTGAGGGGGATATGG + Intergenic
1110510502 13:76344429-76344451 TTCTTTTTTTGTGGGGGAGAGGG - Intergenic
1112880771 13:104104062-104104084 GTTTTTTTTTGAGGGGGTGGGGG + Intergenic
1112916786 13:104561225-104561247 TTGTTTTTTTGCAGGAGTTCTGG - Intergenic
1113270303 13:108666216-108666238 TTGTTTTTTTGATGGAGAGATGG + Intronic
1113470958 13:110545731-110545753 TTCTTTTTGAGGGGGAGTGCAGG - Intronic
1114065548 14:19056333-19056355 TTCTTTTTTGGGGGGGGTGGGGG + Intergenic
1114096714 14:19343668-19343690 TTCTTTTTTTGGGGGGGTGGGGG - Intergenic
1114286300 14:21247067-21247089 TTTTATTTTTGAGGGGGTGCTGG + Intronic
1114740161 14:25088608-25088630 TTCTTTTTTTGAGGTGGAGGCGG + Intergenic
1114895921 14:26991305-26991327 TTCCTTTCTGGAAGGAGTGCAGG + Intergenic
1114929221 14:27446936-27446958 GTATTTTTTTGGGGGGGTGCTGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1115684918 14:35786606-35786628 TTTTTTTTGAGACGGAGTGCTGG - Intronic
1116048941 14:39780551-39780573 TTTTTTTTTTGAGGGGGTACGGG + Intergenic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116751056 14:48884220-48884242 TGCTTTTTTTGTGGGAAGGCAGG + Intergenic
1116800596 14:49439538-49439560 TTCTTTCATTTAGGGAGTCCAGG - Intergenic
1116897880 14:50334921-50334943 TTTTTTTTTTGAGGGGGTGGGGG + Intronic
1117083270 14:52173774-52173796 TTCTTTTTTTGGGGGATAGGTGG - Intergenic
1117382314 14:55177064-55177086 TTCTGTTTTTAAAGGAGTCCAGG + Exonic
1117704147 14:58445792-58445814 TTTTTTTTTTGAGTGAGTGAGGG + Intronic
1118213193 14:63784944-63784966 TTATTTTTTTGGGGGGGTGAGGG + Intergenic
1118222366 14:63866947-63866969 TTCTTTTTTTGTTGGAGAGAGGG - Intronic
1118418355 14:65570407-65570429 TTTTTTTTTTCTGGGAGTGGTGG + Intronic
1118614100 14:67563424-67563446 TTCTTTTTTTTGGGGGGTGGGGG + Intronic
1118647035 14:67850641-67850663 TTCCTATTTTACGGGAGTGCTGG + Intronic
1118674732 14:68171709-68171731 TTCTTTTTTTGTGTGTGTGACGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120608887 14:86614528-86614550 TTCTTTTTTTGGGGGGGTGGGGG - Intergenic
1120671507 14:87367732-87367754 TTTTTTTTTTGCAGTAGTGCCGG + Intergenic
1120891100 14:89492056-89492078 TTTTGTTTTTTGGGGAGTGCTGG - Intronic
1121206127 14:92169313-92169335 TTCTTTTTTAGGGGGTGTGGGGG - Exonic
1121452853 14:94020415-94020437 TTGTTTATTTGAGGAATTGCTGG - Intergenic
1121935729 14:98016884-98016906 TTCTTTTATTGAGGGGGTGGTGG - Intergenic
1122180383 14:99950218-99950240 TTCTTTTTTTGCGGGGGTTGGGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125148118 15:36496969-36496991 TTCTTATTTTGGGGGAGAGGTGG - Intergenic
1125186824 15:36940422-36940444 TTCTATTTTTAATGGTGTGCAGG - Intronic
1125246295 15:37645103-37645125 ATCTTTTTTTGAGGTAGAGCAGG - Intergenic
1125296915 15:38212990-38213012 TTCTCTTTTTTAGTGAGTGTGGG - Intergenic
1125822598 15:42645570-42645592 TTTTTTTTTTGAGAGAGGGAGGG + Intronic
1126262874 15:46714673-46714695 TTCTTTTTCTGAGGGGTTGTGGG + Intergenic
1126477810 15:49084483-49084505 TTATTTTTCTGGGGGAGGGCTGG - Intergenic
1126822469 15:52518252-52518274 TTTTTTTTTTGTGGGAGGGGTGG - Intronic
1126892101 15:53217678-53217700 TTCTGTTTTTGAGTGAATGTTGG + Intergenic
1127080627 15:55375216-55375238 TTCTTTTTTTGAGATGGTGCTGG + Intronic
1127140335 15:55969566-55969588 TTATTTTATTGTGGGTGTGCTGG - Intronic
1127403991 15:58621322-58621344 TTCTTTTTCTGAAGTAGTGTTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1128979702 15:72177160-72177182 TTTTTTTTTTAAAGGACTGCAGG - Intronic
1129416398 15:75384539-75384561 TTCTTTTTTTGGGGGGGTGGGGG + Intronic
1130139219 15:81209531-81209553 TTCTTTTTTTTAAGGAGCACAGG + Intronic
1130141442 15:81229535-81229557 TTCTTTTTTTTAAGGAGTACAGG + Intronic
1130815894 15:87432403-87432425 TGCTTTGTTTGAGGGAATGGAGG + Intergenic
1131145839 15:90011284-90011306 TTATTTTTTAGAGGCAGTTCTGG + Intronic
1131356921 15:91753338-91753360 TTTTTTTTGAGACGGAGTGCAGG + Intergenic
1131501636 15:92972945-92972967 TTCTTTTTTTGAAGGTGGGTGGG + Intronic
1131827551 15:96332929-96332951 TTTTTTTTTTGAGAGGGTGGGGG - Intronic
1131838362 15:96412233-96412255 TTCTTTTTGCGAGGGTGTGGGGG - Intergenic
1132174117 15:99694985-99695007 TTTTTTTTTTCAGGGGGAGCAGG + Intronic
1133242053 16:4420544-4420566 TTCTTGTTTTCAGGGATAGCAGG - Intronic
1133247678 16:4460040-4460062 TTCTTTTTTTTAGGTAGAGATGG + Intergenic
1134191809 16:12127431-12127453 TTTTTTTTTTGAGATAGTTCTGG + Intronic
1135346530 16:21693477-21693499 TTGTTTTATTGTGGGAGTGTTGG + Intronic
1135930796 16:26734691-26734713 TTTTTTTTTTGAGTGTGAGCTGG - Intergenic
1136131167 16:28222559-28222581 TTTTTTTTTTAAGGGAGTTGGGG + Intergenic
1137038421 16:35587554-35587576 TTTTTTTTTTGAGAGAGGGTAGG + Intergenic
1137041289 16:35615240-35615262 TTTTTTATTTGAAGGAGTACAGG + Intergenic
1137278678 16:46956109-46956131 TTATTTTTTTAAGGGGGTGGTGG + Exonic
1138438698 16:57021297-57021319 TTCTTTTTTGGCGGGGGTGGGGG + Intronic
1138500847 16:57443140-57443162 TTTTTTTTTTGCGGGGGTGGTGG + Intronic
1138854218 16:60668244-60668266 TTTATTTTTTGGGGGAGTGTGGG + Intergenic
1138872013 16:60901942-60901964 TTCTCTTTTCGAGGGGGTGTAGG - Intergenic
1140218678 16:73028125-73028147 TCCTTTTTTTGGGGGAGTGTGGG + Intronic
1140377116 16:74453437-74453459 TTCTTTTGGAGAGGGAGGGCAGG + Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1141967582 16:87456893-87456915 TTCTTTTTGTGAGACAGTGAAGG - Intronic
1143642255 17:8205771-8205793 GGCTTTTTTTGAGAGAGTCCAGG + Intronic
1144171445 17:12663416-12663438 TTCTTTTTTTCAGTGAGTTTGGG - Intergenic
1144244934 17:13353413-13353435 TTCTTCTGTAGAGGCAGTGCTGG - Intergenic
1144333650 17:14248984-14249006 TTATTTTTTGGATGGAGTGTAGG - Intergenic
1144379031 17:14674461-14674483 TTCTTTTTTGTAGGAAGGGCAGG - Intergenic
1144512366 17:15887939-15887961 TTTTTTTTTTGATGGAGTCTTGG - Intergenic
1144767669 17:17741504-17741526 TGCTTTTTGTGTGGCAGTGCGGG + Intronic
1145046364 17:19620328-19620350 TTTTTTTTTTGACTGGGTGCAGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145835814 17:27953398-27953420 TTTTTTTTTTGAGGGGGGACAGG - Intergenic
1147447399 17:40482897-40482919 TTCTTTTTTTGGGGGTGGGGTGG + Intronic
1147654226 17:42079667-42079689 TTCTTTTTTTTGGGGGGTGATGG - Intergenic
1148136057 17:45292675-45292697 TTCTTTTTTGGAGGTAGAGTGGG - Intronic
1148285383 17:46386102-46386124 TTTTTTTTTGGAGGGAGGACAGG + Intergenic
1148307547 17:46603702-46603724 TTTTTTTTTGGAGGGAGGACAGG + Intronic
1148977572 17:51543218-51543240 TTTTTTTTTTGAGACAGTCCTGG + Intergenic
1149356481 17:55845073-55845095 TTTTTTTTTTGATGGAGTTTTGG - Intergenic
1150498052 17:65624254-65624276 TTGTTTTTTGAGGGGAGTGCTGG + Intronic
1150900913 17:69276079-69276101 TTCTTTTTTTGGGGGGGCGGGGG + Intronic
1150970878 17:70026325-70026347 TTCACTTTTTGAGGTACTGCTGG + Intergenic
1151596203 17:75079316-75079338 TTCCTTATTTGGGGGAGTCCTGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1153544475 18:6191994-6192016 TTTTTTTTTTGAGGGGGGGGAGG - Intronic
1154238197 18:12626039-12626061 TCCTTTTTTTGGGGGGGGGCGGG - Intronic
1155134539 18:22975878-22975900 TTCTTCTTTTGAGACAGTGTTGG - Intronic
1155451334 18:25965983-25966005 GTCTTTTTTTGAGGGACAGCTGG - Intergenic
1155553675 18:26994584-26994606 TTCTTTTTTTGCGGGGCTGGGGG + Intronic
1155969090 18:32064410-32064432 TTTTTTTTTTGAGACAGAGCTGG + Intronic
1156140915 18:34110116-34110138 TTTTTTTTTTGTGGGAGGGCGGG - Intronic
1158368667 18:56771564-56771586 TTCTTTTTTTGGGGGGGGGTGGG - Intronic
1158532083 18:58272653-58272675 TTCTTTTTTGGAGGAAGGTCGGG - Intronic
1158708274 18:59814396-59814418 TTCTTTTTTTGGGGGGGGGCGGG + Intergenic
1158818878 18:61135544-61135566 TACTTTTTTTGGGGGGGTGGTGG - Intergenic
1158895917 18:61912715-61912737 GTATTTCTTTGAGGCAGTGCTGG - Intergenic
1159051663 18:63426199-63426221 ATCTGATTTTGACGGAGTGCAGG + Intergenic
1159463924 18:68755183-68755205 TTCTCTCTTTGAAGGAGAGCAGG - Intronic
1160742642 19:694549-694571 TTTTTTTTTTGAGGCAGTCTCGG - Intronic
1161732816 19:5972460-5972482 TTCTTTGTTTTAGGGGGTCCTGG - Intronic
1162483509 19:10943938-10943960 TTTTTTTTTAGAGGGAGTCTTGG - Intergenic
1162829763 19:13277011-13277033 TTTTTTTTTTAAGCAAGTGCAGG - Intronic
1162991246 19:14303814-14303836 TGCTTTTTTTGAGGGATTAGAGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163542825 19:17921521-17921543 TTTTTTTTTTGAGGTAGGGATGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165024611 19:32950558-32950580 TGCTTTTTTTGTGGGGGTGAAGG - Intronic
1165115760 19:33527681-33527703 TTCTTTTTTTGAGTGATGGGGGG + Intergenic
1165209549 19:34223076-34223098 TTCTTTTTTTTGGGGGGTGGAGG + Intronic
1165304121 19:34993158-34993180 TTTTTTTTTGGTGGGGGTGCCGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166220340 19:41360171-41360193 TTCTTTTTTTGGGGGGGTGGGGG + Intronic
1166954905 19:46457014-46457036 TTTTTTTTTTGTTGGAGTGGGGG - Intergenic
1167316472 19:48766230-48766252 TTCTTTTTTTGGGGGGGTGGGGG + Intergenic
1167394801 19:49221301-49221323 TTTTTTTTTTGAGACAGGGCTGG + Intergenic
1167601507 19:50457690-50457712 TTTTTTTTTTGATGGAGTCTTGG + Intronic
1167624199 19:50576427-50576449 TTTTTTTTTTTTGGGAGTGGGGG + Intergenic
1167639668 19:50673821-50673843 TTTTTTTTTTGAGACAGGGCTGG + Intronic
1167891026 19:52539564-52539586 TTTTTTTTTTGACGGAGTTTTGG + Intronic
1168708946 19:58486708-58486730 TTTTTTTTTTGGGGGGGGGCGGG + Intronic
925108267 2:1311305-1311327 TTCTTTATTTCAAGGAGTTCTGG + Intronic
925378362 2:3405168-3405190 GTCTTTTTTTGGGGGGGTGGGGG + Intronic
925948311 2:8887264-8887286 TTAGTTTTTTGAGGGGGTGGTGG - Intronic
926423465 2:12719582-12719604 TTTTTTTTTTGAGGGGGTAAGGG + Intronic
927662890 2:25007762-25007784 TTTTTGTTTTGAGACAGTGCTGG - Intergenic
927731397 2:25475813-25475835 TTCTTCCTTTTATGGAGTGCAGG - Intronic
928087239 2:28353367-28353389 TTTTTTTTTGGAGGGGGTGCGGG + Intergenic
928761671 2:34590716-34590738 CTTTTTTTTTGAGGGGGTGGGGG - Intergenic
929291808 2:40201100-40201122 TTTTTTTTTTGAGGGAGTGGGGG - Intronic
929718689 2:44342588-44342610 TTTTTTTTTTAATGGAGTGTAGG - Intronic
929924485 2:46197214-46197236 TTCTTTTTTTGATGGTGGGCAGG - Intergenic
932168254 2:69528355-69528377 ATCTTTTGGTGAGGGTGTGCTGG + Intronic
932305215 2:70697146-70697168 TTCTTTTTTTGGGAGGGTGTGGG - Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933543109 2:83673344-83673366 TTCTTTCTTTAAGGGAGTGGAGG - Intergenic
933576560 2:84075432-84075454 TTCTTTTTTGGAGACAGTGAAGG - Intergenic
933794310 2:85907399-85907421 TTCTTTTTTTGTTGGGGTGGGGG + Intergenic
933928788 2:87126736-87126758 TTCTTTTTTTGGGGGGGGGGAGG + Intergenic
934000121 2:87702521-87702543 TTCTTTTTTTGGGGGGGGGGAGG + Intergenic
935086079 2:99846477-99846499 TTCTTTTTTTAAGGGATGGCAGG + Intronic
935753156 2:106256633-106256655 TTGTTTTTTTGGGGGAGGGCAGG - Intergenic
935881097 2:107566327-107566349 TTTTTTTTTTGATGGAGTCTTGG - Intergenic
936495194 2:113014476-113014498 TTTTTTTTTTGATGGAGTCTTGG + Intergenic
936593264 2:113823641-113823663 TTCTTTTTTGGGGGAAGTGAGGG - Intergenic
936600261 2:113889079-113889101 TTCTTTTTTGGAGGGATGGGGGG + Intergenic
936871868 2:117142959-117142981 TTTTTTTTTTGAGTCAGTGTTGG + Intergenic
937196628 2:120163260-120163282 TTCTTTTTTTGGGGGGGGGGGGG - Intronic
937482859 2:122280872-122280894 TTCCTTTTTTGAGGACGTGGGGG + Intergenic
938482968 2:131676695-131676717 TTCTTTTTTTTGGGGAGCGGGGG + Intergenic
939329288 2:140737044-140737066 TTATTTTTTTGGGGGAGGGTGGG - Intronic
939367518 2:141252196-141252218 TTTTTTTTTTTAGGGGGTGGGGG - Intronic
939619774 2:144404360-144404382 TTTTTTTTTTGGGGGGGTGGGGG + Intronic
939936014 2:148294512-148294534 TTTTTTTTTTGAGATAGAGCTGG + Intronic
939967312 2:148623157-148623179 TTTTTTTTTTCAGGGAGGGAGGG - Intergenic
939990308 2:148872100-148872122 CTCTTTTTTTGGGGGGGGGCAGG - Intergenic
940012362 2:149068158-149068180 TTCTGTGTTTGAGGTAGGGCAGG + Intronic
940525076 2:154802860-154802882 TTTTTTTTTTGAGGGGATGGAGG + Intronic
941039690 2:160607132-160607154 TTCTTTTTTTTGGGGGGTGGGGG + Intergenic
941085280 2:161110281-161110303 TCCTCTTTTTAAGGGAATGCTGG - Intergenic
941344001 2:164345019-164345041 TCCTTTATTTCAGGGAGTGTAGG + Intergenic
941438209 2:165498367-165498389 ATCTTTTTTTCAGGGAGTCCAGG - Intronic
941842493 2:170101432-170101454 TACTTTTATTTAGGGAGTGCTGG - Intergenic
941925478 2:170889978-170890000 TTACTTTTTTGGGGGAATGCGGG - Intergenic
942692923 2:178606375-178606397 TTTTTTTTTTCAGGGGGTGATGG + Intronic
942891851 2:180999633-180999655 TTCTTTTTTTTTGGGAGGGGTGG - Intronic
944158516 2:196634487-196634509 TTTTTTTTTTTAGTGAGTGTAGG - Intergenic
944495520 2:200304260-200304282 TGATTTTTTTGGGGGGGTGCTGG + Intergenic
945317790 2:208389795-208389817 TTCTTTTTTTGCGGGGGTGGGGG + Intronic
945833668 2:214813363-214813385 TTTTTTTTTTGCGGGGGGGCGGG + Intergenic
946585430 2:221181406-221181428 ATCTTTTTTTGAGGGAGATGCGG + Intergenic
946605074 2:221395067-221395089 TAGTTTTTTTGATGGAGTACAGG - Intergenic
946619012 2:221540943-221540965 TTTTTTTTTTGAGGGTATGGCGG + Intronic
946916624 2:224529597-224529619 TTCTTTTTGAGAGGGAGTCTCGG - Intronic
947165382 2:227256330-227256352 TTCTTTTCTTTAGGGAGTCAAGG + Exonic
947428244 2:230003234-230003256 TTCTTTTTTTTATGAAGTGGTGG + Intronic
947652808 2:231801637-231801659 TTTTTTTTTTTAGGGAGAACTGG + Intronic
947854443 2:233313729-233313751 TTTTTTTTTTGAGAGATGGCAGG + Intronic
948162732 2:235838184-235838206 TTCTTTTTTTGGGGGGGTGGGGG - Intronic
948247923 2:236502062-236502084 TTCTTTTTTTGTTGGTGTGTGGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948751146 2:240134077-240134099 TTCTTTTTTTGTGGGGGTAGTGG - Intronic
948833203 2:240610645-240610667 TTCTTTTTTTGAGACAGTCTTGG + Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169564356 20:6837273-6837295 TTTTTTTTATTAGGGGGTGCAGG + Intergenic
1169581520 20:7028579-7028601 TTTTTTTTTTCTGGGAGTGGGGG + Intergenic
1169660696 20:7975450-7975472 TCTTTTTTTTGAGGGAGGGATGG - Intergenic
1169895167 20:10497138-10497160 TTCTTTTAATGAGGGACTGTGGG + Intronic
1170603052 20:17856289-17856311 GTATTTTTATGAGGGAGAGCTGG - Intergenic
1173483491 20:43422402-43422424 TCCTTTTTTTGGAGGAGTGGGGG - Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174027255 20:47588149-47588171 TTTTTTTTTTGAGGCAGTCTTGG + Intronic
1174235497 20:49087360-49087382 TTTTTTTTTTGAGAGAGAGAGGG + Intronic
1174493413 20:50920542-50920564 TTTTTTTTTTAATGGAGTCCAGG - Intronic
1174632467 20:51969728-51969750 TTTTTTTTTTGCGGGGGGGCGGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175498736 20:59434136-59434158 TTTTTTTTTTGACGGGGAGCGGG - Intergenic
1176375302 21:6084058-6084080 TTCATTTTGGGTGGGAGTGCTGG - Intergenic
1176929609 21:14792391-14792413 TGCTTTTATTGTGGGAGTGTGGG + Intergenic
1177332278 21:19679899-19679921 TTCTTTTTTTCGGGGGGTGGGGG + Intergenic
1177574904 21:22940766-22940788 ATCTTTTTTTTGTGGAGTGCAGG - Intergenic
1177873057 21:26596802-26596824 TTTTTAATTTGAGGGAGTGGTGG - Intergenic
1178002323 21:28176225-28176247 TTTTTTTTTTGACGGAGTCTTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1178698933 21:34817517-34817539 TTCCTTGTTTGAGTGACTGCTGG + Intronic
1179092066 21:38275507-38275529 TTTTTTTTTTGACGGAGTTTCGG - Intronic
1179748172 21:43454186-43454208 TTCATTTTGGGTGGGAGTGCTGG + Intergenic
1180484029 22:15778926-15778948 TTCTTTTTTTGGGGGGGTGGGGG + Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181626010 22:24122693-24122715 TTTTTTTTTAGAGGGAGTTTTGG - Intronic
1181866474 22:25860892-25860914 TTTTTTTTTTGAGACAGGGCAGG + Intronic
1183156804 22:36082083-36082105 TTTTTTTTTTGAGAGAGTCTTGG + Intergenic
1183378442 22:37478681-37478703 TTTTTTTTTTGACGGAGGGACGG + Intronic
1183564746 22:38605879-38605901 TTATTTTTTTGAGGGAGAAATGG - Intronic
1184933272 22:47697724-47697746 TTCTTTTTTTTTGGGGGGGCGGG - Intergenic
949159721 3:866242-866264 TTCTTTTTTGGCGGGAATGGGGG + Intergenic
949271748 3:2225150-2225172 TTCTTTTTTTTTGGGGGTGGTGG - Intronic
949346045 3:3077771-3077793 TTCTTTTTTTGCAGGGGGGCTGG - Intronic
949564621 3:5233313-5233335 TTTTTTTTTTGAGACAGAGCTGG + Intergenic
949874991 3:8620716-8620738 TTAATTTTTAGATGGAGTGCTGG + Intronic
950030085 3:9846443-9846465 GTCTGCTTGTGAGGGAGTGCTGG + Intronic
950532460 3:13560239-13560261 TTCTTTTTTTTAGGGAGGAGAGG + Intronic
950879436 3:16311133-16311155 TTCTTTTTGGGAGGGAGGGAGGG - Intronic
951297252 3:20953985-20954007 TTGTTTTTTAGACGGAGTCCGGG + Intergenic
951792987 3:26507174-26507196 TTCTTTTTTTGGGGGGGCGGTGG + Intergenic
951920387 3:27848149-27848171 TTCTTTTTTTGGGGGGGGGTGGG - Intergenic
952404893 3:32997070-32997092 TTGTTTTTTTGCGGGGGTGGGGG + Exonic
952784242 3:37136948-37136970 TTCTTTTTTGGGGGGGGTGGGGG + Intronic
953168768 3:40488653-40488675 TTTTTTTTTTTAGGGGGTGGGGG + Exonic
953661056 3:44891943-44891965 TTCCTTTTTTGAGACAGAGCTGG - Intronic
953746981 3:45582664-45582686 TTCTTTCTTTGAGTGAGTCATGG - Intronic
954728770 3:52639443-52639465 TTTTTTTTTGGAGGCAGGGCTGG + Intronic
954912909 3:54123151-54123173 TTCTTTTTTTGGGGGGGGGATGG + Intronic
955179245 3:56651367-56651389 CTCTTTTTTTGTGGGGGTGGGGG - Intronic
955179774 3:56656590-56656612 TTCTTTTTTTGGGGGGGGGCGGG - Intronic
955289299 3:57676064-57676086 TTTTTTTTTTGAGAGAGAGAGGG - Intronic
955529464 3:59858254-59858276 TTTTTTTTGAGATGGAGTGCTGG + Intronic
956111640 3:65875988-65876010 TTCGTTTTTTAAGGGACTGATGG + Intronic
956114273 3:65902986-65903008 GTCTTTTTTGGGGGGAGTGGTGG + Intronic
956212902 3:66820254-66820276 TTTTCTTTTTGAGGGGGTGGAGG + Intergenic
956760403 3:72438348-72438370 TTTTTTTTTAGAGGGGGTGTGGG + Intronic
957395469 3:79631176-79631198 TTTGTTTTTTGAGGTAATGCAGG - Intronic
957766276 3:84629169-84629191 TTTTTTTTTTGGGGGGGTGGGGG + Intergenic
957836711 3:85603288-85603310 TTCTTTTTTTGAAGGGGAGAAGG + Intronic
959248565 3:103908001-103908023 TTTTTTTTTTGAGGGGGGGTGGG - Intergenic
959498279 3:107076251-107076273 TTTTTTTTTTGAGGCAGAGGAGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
959963743 3:112331757-112331779 TTCTTTTTTTGGGGGGGGGGCGG - Intergenic
960194584 3:114749538-114749560 TTCTTTCTTTGATGGAGTCACGG - Intronic
961021115 3:123507986-123508008 TTCTTTTTTTAAGAGAGGGGGGG - Intronic
961084628 3:124056249-124056271 TTTTTTTTTTGAGGGAGGAGAGG + Intergenic
961228380 3:125275754-125275776 TTCTTTTTTTAAAAAAGTGCTGG - Intronic
961755637 3:129125656-129125678 TTCTTTTTTTGGGGGGGTAGGGG + Intronic
962573979 3:136738653-136738675 TACTTTTTTTGGGGGAGAGGAGG - Intronic
962656575 3:137550700-137550722 ATCTTCTTTTGAGGTACTGCTGG + Intergenic
962806216 3:138929413-138929435 TGCATTTTTTCAGGGAATGCTGG + Intergenic
963272962 3:143303377-143303399 TTTTTTTTTTGAGGGAAGGAGGG + Intronic
963547277 3:146675968-146675990 TTCTTTTATTGAAGGACTGCTGG + Intergenic
963786513 3:149540003-149540025 TTATTTTTGTTAGGGAGTACAGG - Intronic
964021305 3:152015347-152015369 TTCTTATTTTGAGGTAATACAGG + Intergenic
964315588 3:155440661-155440683 TTTTTTTTTTTTGGGAGTGGGGG - Intronic
964323511 3:155522952-155522974 TTCTTTTTTTGCGGGGGGGGTGG + Intronic
964865338 3:161253095-161253117 TTTTTTTATTGGGGGAGTGGGGG - Intronic
965287525 3:166835969-166835991 TTTTTTTTTTGACGGGGTGGGGG - Intergenic
965949171 3:174283329-174283351 TTCTTTTTTTCATGGATTTCTGG - Exonic
966582871 3:181588206-181588228 TTCTATTTTTGTGGGATTGGTGG + Intergenic
966785702 3:183620881-183620903 TTTTTTTTTTGATGGGTTGCAGG - Intergenic
967332255 3:188302443-188302465 TTCTTTTCTTGAGAGAAGGCAGG + Intronic
967456524 3:189693014-189693036 ATTTTTGTTTGAGGGGGTGCTGG - Intronic
968241947 3:197097510-197097532 TAATTTTTTTGAGGGAGAGGAGG + Intronic
968547932 4:1208073-1208095 TTCTTTGCTGCAGGGAGTGCCGG + Intronic
968582071 4:1399839-1399861 TTCTCTTTGTGAGGGAATTCTGG - Intergenic
968681667 4:1925180-1925202 TTTTTATTTTTCGGGAGTGCTGG + Intronic
968765504 4:2466485-2466507 TTTTTTTTTTGAGAGAGAGAGGG + Intronic
970359519 4:15294605-15294627 TTCCTGATTTGAGGGAGTTCAGG + Intergenic
970538010 4:17049601-17049623 TTCTTTTTTTGGGGGGGGGGGGG + Intergenic
970629302 4:17923651-17923673 ATCTTTTTTTGGGGGAGGGTGGG - Intronic
971201477 4:24513147-24513169 TCCTGTTTTGGTGGGAGTGCTGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
971301714 4:25447501-25447523 TTCTTTTTTTGCGGGGGGGATGG + Intergenic
971412394 4:26388011-26388033 TTGCCTTTCTGAGGGAGTGCTGG - Intronic
971920565 4:32933803-32933825 CTCTTCTTTTGAGAGTGTGCAGG - Intergenic
971953774 4:33388974-33388996 ATCTTTTTTTGTGGAAGAGCTGG - Intergenic
972442567 4:39109643-39109665 TTTTTTTTTGGAGGGGGTGGTGG + Intronic
972884427 4:43468415-43468437 TTCTTTTTTTGATGTAGATCTGG + Intergenic
972931921 4:44082590-44082612 TTCTTTTTTGGGGGGTGTGGGGG + Intergenic
973132716 4:46668144-46668166 TTGTTTTTTTGTGTGTGTGCTGG - Intergenic
973734631 4:53858811-53858833 TTCTCTTATTGAGGGCTTGCTGG + Intronic
974337957 4:60576021-60576043 TTTTTTTTTTCAGAGAGTACAGG - Intergenic
975140269 4:70911451-70911473 TTGTATTTTTGAGGGAATGTGGG + Intronic
975191327 4:71466431-71466453 TTCTTTATTTTAGGGCGTGTTGG + Exonic
975412836 4:74074857-74074879 TTTTTTTTTGGAGAGAGTGCAGG + Intergenic
975849561 4:78557717-78557739 TTCTTTAATTGAGGGAGAGGAGG - Intronic
976250011 4:83040769-83040791 TTTTTTTTTTGAGGGAGGGTTGG + Intronic
976255178 4:83092824-83092846 TTTTTTTTTTGAGACAGGGCTGG + Intronic
976331169 4:83832640-83832662 TTCCTTTTTTGGGGGTGTGAGGG + Intergenic
976525196 4:86078987-86079009 TTCTTTTTTTGGGGGGGTGGGGG - Intronic
976926080 4:90497891-90497913 TTCTTCTCATGAGGGAGTGCAGG + Intronic
976931016 4:90567314-90567336 TTTTTTTTTTGACGGAGCCCAGG + Intronic
977150714 4:93508208-93508230 TTTTTTTTTTGACGGAGTCTTGG + Intronic
977811838 4:101364880-101364902 TTCTGGTTTTCAAGGAGTGCAGG + Intergenic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
978138123 4:105288324-105288346 TTTTTTTTTTGAGGGTGAGTGGG + Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
978701438 4:111651281-111651303 CTCCTTTTTGGAGGGAGTGAGGG + Intergenic
978806573 4:112806950-112806972 TTCTTTGTTTAAGAGTGTGCTGG + Intergenic
979125963 4:116971640-116971662 TTCTGATTTGGAGGGACTGCAGG - Intergenic
979321941 4:119335142-119335164 CCCTTTTTTTGTGGGAGTGGTGG + Intergenic
979858986 4:125669992-125670014 TTCTTGTTTTGATGGAGTTTAGG + Intergenic
980011718 4:127602992-127603014 TTCAATTTTTGAGGCAGTGGTGG - Intergenic
980080310 4:128337328-128337350 TTTTGTGTTTGAGGGAGTGAGGG + Intergenic
980663032 4:135891924-135891946 TCTTATTTTTGTGGGAGTGCTGG + Intergenic
980684176 4:136203644-136203666 GTCTATTTTTGTGGGAGTTCAGG - Intergenic
981616957 4:146652437-146652459 CTCTTTTAATGAGGGAGTGTGGG + Intergenic
981720833 4:147799902-147799924 TCTTTTTTTTGGGGGGGTGCGGG + Intronic
982479719 4:155894564-155894586 TTCTTTTTCTGTGGGATTGGTGG - Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983064956 4:163198043-163198065 TTCTTTTTTTAACTGAGTGATGG - Intergenic
983377147 4:166944537-166944559 TTTTTTTCTTGAGGGAGGGGTGG + Intronic
984304285 4:177966943-177966965 ATTTTTTTATGAGGGAGTGAGGG + Intronic
984655748 4:182316586-182316608 TTCCTTTTTTGTGGGAGTGGGGG - Intronic
985009468 4:185567818-185567840 TTTTTTTTTGGAGGGGGTGGGGG + Intergenic
986795718 5:11210047-11210069 TTATTGTATTGAGGGAGTGGAGG - Intronic
987024180 5:13907429-13907451 TTCTTTTTTTGGGGGGTGGCGGG - Intronic
987110358 5:14680439-14680461 TTCTTTCTTTCTGTGAGTGCAGG + Intronic
987365050 5:17141169-17141191 TTTTTTTTTTGGGGGGGTGATGG - Intronic
987721882 5:21646456-21646478 TTCCTTTTTTGGGGGGGTACGGG - Intergenic
989217766 5:38922771-38922793 TTCTTTTTTGGGGGGTGTGGTGG + Intronic
989302598 5:39911486-39911508 TTCTTTTTTTGGGGGGGTCAGGG - Intergenic
989446308 5:41533853-41533875 TTTTTTTTTTTATGGAGTCCAGG + Intergenic
989577623 5:43003110-43003132 TTTTTTTTTTGAGAGAGAGAGGG - Intergenic
989628274 5:43454220-43454242 TTTTTTTTTTTAGGAAGAGCAGG + Intronic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
990206807 5:53438537-53438559 TGCTTTGTTTGAGTGAGTGGGGG - Intergenic
990253454 5:53941267-53941289 TCCTTTTTTTAAAGGATTGCAGG - Intronic
990557149 5:56948739-56948761 TTCTTTTTTTGAGGAATTCTTGG + Intronic
992829224 5:80578193-80578215 TTCTTTTTTTGGGGGGGTGGGGG + Intergenic
993036699 5:82767015-82767037 TTTTTTTTTTGTGGGAGTGGTGG + Intergenic
993074509 5:83211619-83211641 TTCTTTTGTTGGGGGAGGGGCGG - Intronic
993327142 5:86555092-86555114 TTCTTTTTTTCAGGTATTACTGG + Intergenic
994207967 5:97057218-97057240 TTCTTCTTTTGAGGGAGGAGTGG + Intergenic
994760285 5:103843505-103843527 TTTTTATTTTGAGGTAGAGCTGG + Intergenic
994850186 5:105044908-105044930 TTTTTTTTTTGGGGGGGTGGGGG + Intergenic
994855822 5:105117892-105117914 TTCTTTTTTTGAGATAGTTCTGG + Intergenic
995082380 5:108068449-108068471 TTCTTTTTTTGGGGGGGGGGCGG + Intronic
995094206 5:108216147-108216169 TTCTTTTTTTGAGATAGTTACGG + Intronic
995143365 5:108758971-108758993 TTCTTTTCTTGAGGGACAGGTGG - Intronic
996196671 5:120615410-120615432 TTTTTTTTTTGGGAGAGTGGAGG + Intronic
997318972 5:132962811-132962833 TTTTTTTTTTGCGGGGGTGGGGG + Intronic
997971728 5:138408378-138408400 TTTTTTTTTTTAAGGAGTGTAGG - Intronic
998542646 5:142997405-142997427 TTCTTTTCTTGAGGGGTTGGTGG + Intronic
998973060 5:147613715-147613737 TTCTTTTTTAGGGGGAGGGGTGG - Intronic
999007671 5:148000756-148000778 TTCTACTGTTGAGAGAGTGCTGG - Intergenic
999027250 5:148248277-148248299 TTCTTTTTTTGGGGGGGCGAGGG + Intergenic
999370905 5:151054679-151054701 TTCTTTTTTTTAAGGGGTGTTGG - Intronic
999626425 5:153525547-153525569 TTCTTTTTTTGGCCAAGTGCTGG + Intronic
999708367 5:154294339-154294361 TTCTTTTTTTTAGGGAGATGGGG - Intronic
1000107006 5:158069336-158069358 TTTTTTTTTAGTTGGAGTGCGGG + Intergenic
1000307200 5:160005651-160005673 TTTTTTTTTTGGGGGGGAGCAGG - Intergenic
1000798826 5:165698537-165698559 TTGTTTTTTTGAGGGGGTTGAGG - Intergenic
1000879950 5:166685778-166685800 TTCTCTTTTTGCGTGAGTCCTGG - Intergenic
1001049843 5:168405403-168405425 TTCTTTTTTGGAGGGAGGGCAGG - Intronic
1001263410 5:170253290-170253312 GTATTTTTTTGGGGGAGTGGGGG - Intronic
1001466283 5:171969268-171969290 TTCTTTTTTTTGGGGGGTGATGG - Intronic
1001665158 5:173426778-173426800 TTTTTTTTTTGAGATAGTTCTGG + Intergenic
1002050185 5:176566100-176566122 TTTTTTTTTAAAGGGAGAGCAGG + Intronic
1002733550 5:181362527-181362549 TTTTTTTTTGGGGGGGGTGCTGG + Intergenic
1002960727 6:1912569-1912591 TTCTTTTTTTAAGGGAAGGTGGG - Intronic
1003083090 6:3037912-3037934 TTCTTTTTTTGAGAGTCTGAGGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003703842 6:8501091-8501113 TTATTTTTTTGGGGGAGGGATGG - Intergenic
1003886373 6:10524827-10524849 TTCTTTTTTTTGGGGGGTGGGGG - Intronic
1003991411 6:11490249-11490271 TTATTTATTTGAGGGATTCCAGG + Intergenic
1004121354 6:12825304-12825326 TTTTTTTTTTGAGAGAGAGAGGG - Intronic
1004414407 6:15412303-15412325 TTCTTTTTTTGGGGGGGTTGAGG + Intronic
1004416515 6:15429269-15429291 TTTTTTTTTTGAGGTAGTTGTGG + Intronic
1005421205 6:25652882-25652904 TTCTCATTTTGAGAGAGTGAGGG - Intronic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005597966 6:27397444-27397466 TTCTTTTTTTCAGGGGAGGCTGG + Intronic
1005661790 6:28005567-28005589 TTGATTTTTGGAGGGATTGCAGG - Intergenic
1006193868 6:32225535-32225557 TTTTTTTTTTGAGACAGTCCAGG + Intergenic
1006292068 6:33145894-33145916 TTTTTTTTTTTTGGGAGTGGGGG - Intergenic
1006856329 6:37135939-37135961 TTTTTTTTTTGCGGGGGGGCAGG - Intergenic
1006860021 6:37165378-37165400 TTCTTTTTTTGTGTGTGTGACGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006956663 6:37879340-37879362 TTTTTTTTTTGTGGGGGAGCGGG + Intronic
1007182161 6:39937157-39937179 ATCTTTTTTTGAGGGGGAGTTGG - Intergenic
1007657068 6:43456716-43456738 GTCTTTTTTTGGGGGGGGGCGGG - Intergenic
1008091119 6:47294698-47294720 TTTTTTTTTTGAGGGGGGCCAGG + Intronic
1008391948 6:50962507-50962529 TTCTTTTTATGAGGTGGTGAAGG + Intergenic
1008415501 6:51235164-51235186 TTCTTCTTTGGAGGCAGTGAAGG - Intergenic
1008653785 6:53590257-53590279 TTTTTTTTTTGAGACAGAGCTGG + Intronic
1008887385 6:56445771-56445793 GTCTTATTTTGAGGGAAGGCAGG + Intergenic
1008949379 6:57138799-57138821 TTTTTTTTTTGAGAGAGAGGTGG + Intronic
1009439186 6:63655811-63655833 TTCTTTTTTTGTTGCAGTGTTGG + Intronic
1009511337 6:64552924-64552946 TTCTTTTTTTGGGGGGGAGGGGG - Intronic
1009581944 6:65547807-65547829 TTCTCTGTTTCAGGGAGTACAGG - Intronic
1009767838 6:68104766-68104788 TTTTTTTTTTGAGGGGGAGGTGG + Intergenic
1009835205 6:68991558-68991580 TTTTTTTTTTGTGGGAGCGAGGG - Intronic
1009854328 6:69241667-69241689 TTCTTATTTTGAGGAAGGGCTGG + Intronic
1009975338 6:70666005-70666027 TTCTTTTTTTGGGGGGGGGGTGG + Intergenic
1010303979 6:74295248-74295270 TTCTTCTAATGAGGAAGTGCAGG - Intergenic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1011929913 6:92699170-92699192 TTCTTTTTTTGGGGGGGTTGGGG - Intergenic
1012000765 6:93651903-93651925 TTCTTTTTTTTGGGGGGGGCAGG + Intergenic
1012920335 6:105215957-105215979 GTATTTTTGTGAGGTAGTGCCGG + Intergenic
1013455888 6:110329487-110329509 TTCCTTTTTAGAGGGGGTGGGGG + Intronic
1013906012 6:115220871-115220893 TTCCTTTTTTTAGGGGGTGGGGG - Intergenic
1014000884 6:116365258-116365280 TTCTTTTTTTGTGGGGGGGATGG + Intronic
1014100190 6:117502933-117502955 TTCTTGTTTTGATGAAATGCTGG + Intronic
1014260709 6:119213693-119213715 CTATCTTTTTGAGGGAGCGCTGG - Intronic
1014895419 6:126894385-126894407 TTTTTTTTTTGGGGGATTGCAGG - Intergenic
1015437703 6:133208698-133208720 TTGCTTTTTTGAGGGAATGAAGG - Intergenic
1016484477 6:144521283-144521305 TTATTTTTTTGGGGGGGTGCAGG - Intronic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1017117131 6:150988596-150988618 TTCTTTTTTTGTGGGGGGGGCGG + Intronic
1017319307 6:153070221-153070243 TTCTTTTTTGGTGGGGGTGTGGG + Intronic
1017412948 6:154188576-154188598 TTCTTTTTTTAAGGGTGTTTAGG - Intronic
1017583768 6:155897539-155897561 TTTTTTTTTTCAGGCAGTACAGG - Intergenic
1017798212 6:157866954-157866976 TTGTTTTTTTAAGAGACTGCAGG + Intronic
1017847683 6:158273698-158273720 TAATATTTTTGAGGCAGTGCCGG - Intronic
1019039047 6:169087774-169087796 TACTTTTTCTGAGGTATTGCGGG - Intergenic
1020247464 7:6440962-6440984 TTTTTTTTTTGAGGGGGGGACGG + Intronic
1020415169 7:7937284-7937306 TTTTTTTTTTGAAGGAGGACGGG + Intronic
1020590576 7:10131670-10131692 TTCTTTTTGAGATGGAGTGATGG + Intergenic
1021106129 7:16641781-16641803 TCCTTTTTTTGAGGGGGGGCTGG - Intronic
1021301199 7:18975155-18975177 TTCTTTTTTTGAGGCAGGAAAGG - Intronic
1021687520 7:23201753-23201775 TTTTTTTGTTGGGGGAGGGCAGG - Intergenic
1021708876 7:23395598-23395620 TTCTTTTTTTGGGGGGGTGGGGG - Intronic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1022242838 7:28529571-28529593 TTCTGTGTTTGAGGGAATGAAGG - Intronic
1022363019 7:29681357-29681379 TTCTTATATTGAAGGAGTGTGGG - Intergenic
1022428295 7:30289242-30289264 TTCTTATATTGAAGGAGTGTGGG + Intronic
1022698374 7:32732430-32732452 TTCTTATATTGAAGGAGTGTGGG + Intergenic
1023371199 7:39513772-39513794 TTTTTTTTTTGTGGGGGTGGTGG - Intergenic
1023406195 7:39835294-39835316 TTGGTGATTTGAGGGAGTGCTGG - Intergenic
1023933265 7:44720060-44720082 CTCTTTTTTTGGGGGGGTGCGGG + Intergenic
1023936776 7:44746172-44746194 TTTTTTTTTTGGGGGGGTGATGG + Intergenic
1024149760 7:46559018-46559040 GTCATCTTTTGAGGGATTGCAGG + Intergenic
1025613297 7:63096718-63096740 TTTTTTTTTTGAGGGGTTACAGG + Intergenic
1025735805 7:64145662-64145684 TTTTTTTTTGGCGGGAGTGATGG - Intronic
1026162249 7:67880189-67880211 TTTTTTTTTTGAGACAGAGCTGG + Intergenic
1026241888 7:68582951-68582973 TTCTTTTTTTGTGTGTGTGATGG + Intergenic
1026287852 7:68979129-68979151 TTAATTTTTTGAGGAAGTGATGG - Intergenic
1026457276 7:70583616-70583638 TTCTGTTTTTAGGGGAGTGGTGG + Intronic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1027141121 7:75658395-75658417 TTCATTTTTTGAAGGAATTCTGG + Intronic
1027265083 7:76490323-76490345 TTCTTTTTTTGGGGGGGTGAGGG - Intronic
1027288201 7:76672319-76672341 TTTTTTTTTTGAGGGGGTGAGGG - Intergenic
1027316456 7:76988426-76988448 TTCTTTTTTTGCGGGGGTGAGGG - Intergenic
1027735648 7:81929964-81929986 TTCTTGTCTTGAGGAAGTTCAGG + Intergenic
1028035615 7:85978095-85978117 TTCATTTTTTGAGTGGGTGTTGG + Intergenic
1028235536 7:88356878-88356900 TTCTTTTTTTGAGGTACTGTTGG - Intergenic
1028506820 7:91580129-91580151 TTTTTTTTTTGGGGGGGTGGGGG + Intergenic
1029650934 7:101890988-101891010 TTTTTTTTTTGAGCGGGGGCGGG + Intronic
1030072499 7:105710043-105710065 TTCTTTTGTAGAGGCAGGGCTGG + Intronic
1030694219 7:112567481-112567503 TGATTTTTTTCAGGGAGTTCAGG + Intergenic
1031991021 7:128199150-128199172 TTTTTTTTTGGCGGGGGTGCGGG - Intergenic
1032070124 7:128799641-128799663 ATTTTTTTTTGAGGAAGTGGAGG + Intronic
1032441492 7:131945890-131945912 TTCCTTTTTGGAGTGAGTCCTGG - Intergenic
1032535748 7:132662100-132662122 TTTTTTTTTTGCGGGGGGGCAGG + Intronic
1032578861 7:133084884-133084906 TTTTTTTTTTGAGAGAGAGAGGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033506122 7:142002516-142002538 TTTTTTTTATGAAGGAATGCTGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1033760632 7:144433031-144433053 TTTTTTTTTTGAGGGGGGGATGG - Intergenic
1034096005 7:148408263-148408285 TTCTTTTTTTGTGTGTGTGTGGG - Intronic
1034576807 7:152006772-152006794 TTCTTTTTTTTGGGGGGGGCGGG + Intronic
1036391547 8:8328323-8328345 ATCTTTTTCTGGGGGAGTGGAGG + Exonic
1037309568 8:17540494-17540516 TTCTTTTTTGGAGGGGTTGGGGG - Intronic
1037348511 8:17924005-17924027 TTGTTTTTTTGAGCGAGTTGAGG + Intronic
1037456583 8:19070268-19070290 TTTTTTTGCTGATGGAGTGCAGG - Intronic
1037991391 8:23323696-23323718 TTTTTTTTTTGGGGGGGTGGGGG + Intronic
1038389586 8:27182907-27182929 TTTTTTTTTTAAAGAAGTGCAGG - Intergenic
1039034238 8:33342349-33342371 TTCTTTTTTTGTGGGGGGACAGG - Intergenic
1039360968 8:36876543-36876565 TTCTTTCTTGGAGGTAGGGCAGG + Intronic
1039675490 8:39661163-39661185 TTTTTTTTTTGAGGGAGTCTCGG + Intronic
1041864116 8:62549324-62549346 TTCTTTTTTTGGGGGATCGGAGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043624094 8:82233046-82233068 TTTTTTTTTTGATGGAGTATGGG + Intergenic
1043754104 8:83980572-83980594 TTCTTTTTTGGAGAGAATACAGG - Intergenic
1043854629 8:85250946-85250968 TTCTTTTTTTGTGTGTGTGGTGG + Intronic
1044262629 8:90145144-90145166 TTCTTTTGGTGTGGGATTGCTGG + Intergenic
1044415727 8:91937229-91937251 TTCTTTTTTTGTGGGGGTGGGGG + Intergenic
1044734661 8:95267879-95267901 TTTTTTTTTTGAGGGGTTGTGGG + Intronic
1044749218 8:95400316-95400338 TTTTTTTTTTGACGGAGTCTTGG + Intergenic
1045058023 8:98385737-98385759 TTCTCTTTTTCAGGGTGTGGGGG - Intergenic
1045092492 8:98760711-98760733 TCTTTTTTTTGAGGGGGTGGGGG + Intronic
1046186577 8:110729136-110729158 TTATTTTTTTGAGGGACTGGGGG + Intergenic
1046611143 8:116426827-116426849 TCCTTGTTCTGATGGAGTGCAGG - Intergenic
1046612315 8:116439768-116439790 TTTTTTTTTTGAGAGAGAGATGG + Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1046958379 8:120084578-120084600 TTCTTTTTTGGAGGGGGGACAGG - Intronic
1046995029 8:120509601-120509623 TTCTTTTTTTGGGGGGGCGGTGG - Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047834974 8:128679620-128679642 TTCTGATTTTGAGGGAGAGATGG - Intergenic
1047942750 8:129841354-129841376 TTCTTCTTTTAGGGGAGAGCCGG - Exonic
1048198650 8:132353236-132353258 TACTTTTTTTGGCGGAGGGCTGG - Intronic
1048352602 8:133628078-133628100 TTCTTTTTTTCGGGGGGTGGTGG + Intergenic
1048750497 8:137668127-137668149 TTTTTTTTTTGAGGCAGAGGAGG - Intergenic
1048815941 8:138333688-138333710 TTCATGTCTTGAGGGACTGCTGG - Intronic
1050012245 9:1196681-1196703 TTCTTTTTTGGAGGTAGAGGTGG + Intergenic
1050324265 9:4485002-4485024 TCCTTTTTTTGGGGGGGTGGGGG + Intergenic
1050944462 9:11499880-11499902 TTTTTTTTTTGTGGGAATGAAGG - Intergenic
1051039448 9:12789078-12789100 TTTTTTTTTTGGGGGGGTGCTGG - Intronic
1051168114 9:14287414-14287436 TTTTTTTTTTGACGGAGTCTCGG - Intronic
1051261636 9:15270595-15270617 TTCTTTTTTTGATGGAGGGGTGG - Intronic
1051773436 9:20606297-20606319 CTATTTTATTGAGGGATTGCAGG + Intronic
1052139001 9:24954784-24954806 TTTTTTTTTTGACGGAGTCTCGG + Intergenic
1052197367 9:25733681-25733703 TTCTTTTACTTAGGGAGGGCAGG + Intergenic
1052808463 9:33035047-33035069 TTTTTTTTTTAATGGAGTGGAGG + Intronic
1052918300 9:33940771-33940793 TTTGTTTTTTGGGGGAGTACAGG - Intronic
1053224118 9:36336962-36336984 TTATTTTTTTGAGGGGCTGGGGG + Exonic
1053358476 9:37466282-37466304 TTTTTTTGTGGGGGGAGTGCAGG - Intergenic
1053465952 9:38308726-38308748 CTCTTTTTTGGTGGGGGTGCTGG - Intergenic
1053908768 9:42873625-42873647 TTCCTTTTTTGAGGGGAAGCTGG + Intergenic
1054568900 9:66789021-66789043 TTTTTTTTTTGGGGGGGTGGTGG + Intergenic
1054705397 9:68456296-68456318 TTCTTTTTTTTTGGGGGTGGGGG + Intronic
1054853720 9:69875213-69875235 TTTTTTTTTTAAGGGGGTGAGGG + Intronic
1055438871 9:76319640-76319662 TCCTTTTCTTGAGGGAGTCAGGG + Intronic
1056045425 9:82710785-82710807 GTCTTATTTTGTGGGAGGGCAGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1056686509 9:88767936-88767958 TTCATTTTTGGAAGGAGTCCTGG + Intergenic
1056954188 9:91069330-91069352 TTTGTTTTTGGAGGGGGTGCTGG - Intergenic
1057366535 9:94427280-94427302 TTCCTTTTTTGGGGGAGGGTAGG + Intronic
1057369265 9:94455172-94455194 TTTTTTTTTTGAGAGAGAGAGGG + Intronic
1057656799 9:96960784-96960806 TTCCTTTTTTGGGGGAGGGTGGG - Intronic
1057849117 9:98550936-98550958 TTTTTTTTTTGAGTGAGTGTAGG - Intronic
1058075121 9:100643182-100643204 TTTTTTTTGTGAGGAGGTGCTGG + Intergenic
1058852027 9:109021807-109021829 TGCTTTTTTTGGGGGGGTGGTGG - Intronic
1058882124 9:109294612-109294634 TATTTTTTTTGAGGGGGTACGGG - Intronic
1058981187 9:110172317-110172339 TTCTTTTTTTGGGGGAGGAGGGG + Exonic
1059164306 9:112064037-112064059 TTCTTTTTTTGGGGGGGGGGCGG + Intronic
1059677471 9:116553140-116553162 TTCTTTTTTTAATGGTTTGCTGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060514186 9:124255712-124255734 TGCTTTTTTATAGGGGGTGCTGG - Intergenic
1060624138 9:125095033-125095055 TTCTTTCTTGAAGGGAGAGCTGG - Intronic
1185540199 X:897273-897295 GTTTTTTTTTGAGGGGGGGCAGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186056946 X:5659853-5659875 TTCTTTTTGTGGGGGAGTCATGG - Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186564133 X:10644287-10644309 TTCTTTTTTTTAATGAGAGCAGG - Intronic
1187862982 X:23699449-23699471 TTCTTTTTTTGGGGGGGTGGGGG + Intergenic
1187917079 X:24163877-24163899 TTCTTTTATTGAGTTAATGCTGG + Intronic
1187994811 X:24914516-24914538 TTTTTTTTTTGCGGGGGTGGGGG - Intronic
1188050589 X:25480502-25480524 TTTTTTTTTTGACGGAGTCTCGG + Intergenic
1188571790 X:31595337-31595359 TTCTTTTTGTGTGGGGGAGCTGG + Intronic
1189063868 X:37785197-37785219 TTCTTTTTCTGAGGAAGCGAAGG - Intronic
1189103297 X:38212771-38212793 TGCTCTTTTTGAGGGTGTGACGG - Intronic
1189315815 X:40055811-40055833 TCCTTTTTTTGCGGGGGTGGGGG + Intronic
1189526648 X:41829611-41829633 TTTTTTTTTTGGGGGGGTGGGGG + Intronic
1189649830 X:43177362-43177384 TTCTTTTTTTGAGACTGTACTGG + Intergenic
1189662238 X:43312598-43312620 TTCTTTTGTTGAGGGACAACAGG - Intergenic
1189683145 X:43537190-43537212 TTCTTTTTTTGGGGGTGTTGGGG + Intergenic
1189802155 X:44701513-44701535 TTTTTTTTTTTTGGGAGTGGGGG + Intergenic
1189809731 X:44770379-44770401 TTTTTTTTGAGACGGAGTGCTGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191830826 X:65414262-65414284 TTTTTTTTTTGAGGGGGGGAAGG + Intronic
1191852843 X:65598720-65598742 GTCTGTCTTTGAGGGACTGCGGG + Intronic
1192098699 X:68240385-68240407 CACTTTTTCTGAGGGAGTGAAGG + Intronic
1192574516 X:72232404-72232426 TTTTTTTTTTGAGGCAGGTCTGG - Intronic
1192582356 X:72294953-72294975 TTTTTTTTTTGAGAGAGAGAGGG + Intronic
1192869021 X:75168411-75168433 TTCTTTTTTTGGGTGGGGGCGGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193680085 X:84508041-84508063 TTTTTTTTTTGAGGGAGGAGAGG - Intergenic
1194347330 X:92782471-92782493 TTCTTTTTCTCTGGGATTGCTGG - Intergenic
1194834556 X:98665696-98665718 TTTTTTTTTTGTGGGAGGGGGGG + Intergenic
1194948383 X:100095254-100095276 TTCTTTTTTTGATGTATTTCTGG - Intergenic
1195414948 X:104610100-104610122 TTCTTTTTTTTAGGTATTGATGG + Intronic
1195964371 X:110416963-110416985 TTCGGTTTTTGGGGGAGAGCTGG + Intronic
1196610959 X:117714369-117714391 TTTTTTTTTTGAGGGAGGTGGGG - Intergenic
1196728038 X:118914672-118914694 TTCTTTTTTTGGGGGGGGGGCGG + Intergenic
1196851713 X:119944480-119944502 TTTTTTTTTTGAGGGGGGTCGGG + Intergenic
1196898075 X:120357683-120357705 TTCTGTTTTTTTGGGAGTGGAGG - Intergenic
1197110368 X:122766158-122766180 CTTTTTTTTGGAGGGAGTGTAGG - Intergenic
1197250966 X:124216137-124216159 TTCTTTTTTTGTGGGATCTCAGG + Intronic
1197298073 X:124743857-124743879 CTCATCTTTAGAGGGAGTGCTGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197743521 X:129914581-129914603 TCTTTTTTTTGGGGGAGGGCGGG - Intronic
1198273720 X:135081121-135081143 TTTTATTTTTGGGGGAGTGGGGG - Intergenic
1198319765 X:135508759-135508781 TTTGTTTTCTGAGGGAGTCCTGG - Intergenic
1198477510 X:137009662-137009684 TTGTTTTATTGTGGGAGTGATGG + Intergenic
1198848986 X:140944963-140944985 TCCTTTTTTTGAGGAACTACTGG - Intergenic
1199791049 X:151155583-151155605 TTCTTGTCTAAAGGGAGTGCAGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200437539 Y:3170388-3170410 TTCTTTTTTTGGGGGGGAGGGGG + Intergenic
1200655654 Y:5899103-5899125 TTCTTTTTCTCTGGGATTGCTGG - Intergenic
1201286286 Y:12381455-12381477 TTGTTTTTTAGAGGGAGTCTTGG + Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic