ID: 1073392586

View in Genome Browser
Species Human (GRCh38)
Location 10:103192263-103192285
Sequence GTGTGTGCGCGCCCGTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073392586_1073392595 6 Left 1073392586 10:103192263-103192285 CCCCTGGACGGGCGCGCACACAC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1073392595 10:103192292-103192314 GTAATGGTGACTAGTCATTTCGG No data
1073392586_1073392597 8 Left 1073392586 10:103192263-103192285 CCCCTGGACGGGCGCGCACACAC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1073392597 10:103192294-103192316 AATGGTGACTAGTCATTTCGGGG No data
1073392586_1073392596 7 Left 1073392586 10:103192263-103192285 CCCCTGGACGGGCGCGCACACAC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1073392596 10:103192293-103192315 TAATGGTGACTAGTCATTTCGGG No data
1073392586_1073392589 -10 Left 1073392586 10:103192263-103192285 CCCCTGGACGGGCGCGCACACAC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1073392589 10:103192276-103192298 GCGCACACACCCCCCTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073392586 Original CRISPR GTGTGTGCGCGCCCGTCCAG GGG (reversed) Intronic
901057530 1:6455595-6455617 GGGGGTGCGCCGCCGTCCAGGGG - Intronic
910105164 1:83624309-83624331 GTGTGTGTGCGCGTGCCCAGAGG + Intergenic
919770031 1:201152211-201152233 GTGTGTGCACCTCTGTCCAGTGG + Intronic
920297705 1:204969152-204969174 GTGTGTGCATGCCCGTGCATGGG + Intronic
923279864 1:232433040-232433062 GTGTGTGTGCGCCCTTGGAGTGG - Intronic
1063379287 10:5574373-5574395 GTGTGTGCCGGCCCTTCGAGGGG - Intergenic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1065025135 10:21534219-21534241 TGGCGTGCGCGCCCGTCCTGCGG - Intronic
1067070776 10:43129778-43129800 GTGTGTGCGCACACACCCAGAGG + Exonic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1076680251 10:132168049-132168071 GTCTCTGCACGCCCGTCCCGTGG + Exonic
1077133324 11:985895-985917 GGGTGTGCGCGCATGTCCCGTGG + Intronic
1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG + Exonic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085666220 11:78417619-78417641 GTGCGGGCGCGGCCGCCCAGGGG - Intronic
1085738149 11:79057247-79057269 GTGTGTGCAGGCCAGTGCAGGGG - Intronic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1104774875 12:131385120-131385142 GTGGGTGCGCTCCCTTCCTGGGG + Intergenic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1110596602 13:77326810-77326832 GTGTCTGCCCGCCCGGCCCGCGG - Intronic
1130369204 15:83269439-83269461 GTGTGTGCGCGCGCATCTGGAGG + Intronic
1132877936 16:2148592-2148614 GTGGCTGCGCGCCCGTGGAGCGG + Intronic
1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG + Intergenic
1138116084 16:54361818-54361840 GTGTGTGCGTGCACGCTCAGGGG + Intergenic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1142188484 16:88706150-88706172 ACGTGAGCGCGCCCGCCCAGGGG - Exonic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1145265071 17:21376108-21376130 GTGTGTGCGCGCATGTCCCCGGG + Intergenic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1152038470 17:77888065-77888087 GTGTGCGCGCACCCGTGCATGGG - Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1160242358 18:77132797-77132819 CTGGGTGCGCGCCCGTCCCTCGG - Intronic
1161170146 19:2808445-2808467 GTGGGTGCGGGCCCGGGCAGGGG + Intronic
1161566373 19:5005047-5005069 GTGTGTGCCGGCCTGTCCTGCGG + Intronic
1162485960 19:10960842-10960864 GCGCGTGCGCGCCCGTCCCTGGG - Intergenic
1163314908 19:16535234-16535256 ATGGGTGCACGCACGTCCAGTGG + Intronic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
938639668 2:133266117-133266139 GTGTGTGCGCGCCTGTAGAGCGG + Intronic
943488086 2:188514075-188514097 GTGTGTGTGCGCCCTGCCACTGG + Intronic
944494906 2:200296895-200296917 GTGCGTGCGCGCGCATTCAGGGG - Intergenic
1169832240 20:9838174-9838196 GTGTGTGCGCGCGCGCCTGGTGG - Intronic
1179890864 21:44334498-44334520 GGGTGCGCGTGCCCGCCCAGAGG - Intronic
1179890884 21:44334540-44334562 GGGTGCGCGTGCCCGCCCAGAGG - Intronic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1182295542 22:29309650-29309672 GTGCGTGCTCACCCGGCCAGTGG + Intronic
954368968 3:50160451-50160473 GTGTGCGTGCACCTGTCCAGTGG - Intronic
963264460 3:143227136-143227158 TTGTGTTCCCGCCCTTCCAGGGG - Intergenic
963922699 3:150921388-150921410 GTGTGTGCGTGCACATGCAGGGG - Intronic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
967858504 3:194135024-194135046 GTGTGTGTGCGCGCGCCCCGGGG - Intergenic
967987458 3:195106412-195106434 GTGTGTGCGGGGCCGTGCTGGGG - Intronic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
978384967 4:108169151-108169173 GTGTGTGCGCGCGCGCCTGGAGG + Intergenic
985701995 5:1379047-1379069 GTGTGTGCGTGGCCTACCAGCGG - Intergenic
985895918 5:2750077-2750099 CTGTGTGCGCGCACGTGCAAGGG - Intronic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
994333470 5:98536037-98536059 TTGTGTGCCAGCCCTTCCAGTGG + Intergenic
995250157 5:109983944-109983966 GTGTGTGCGCACGCGCACAGTGG - Intergenic
995536401 5:113140979-113141001 GTGTGTGAGGGCGCTTCCAGAGG + Intronic
997899844 5:137754365-137754387 GAGGGTGCGCGCGCGTTCAGCGG - Exonic
998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002213665 5:177612886-177612908 ATGTGTGTGAGCCCGGCCAGGGG + Intergenic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018956550 6:168414000-168414022 CTCTGTGCGCTCCCGTCCACGGG + Intergenic
1018984735 6:168627887-168627909 GTGTGTGAGGGCCCCTCCTGTGG - Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1029118816 7:98252559-98252581 GGGTGTGGGCGCCCGGCCTGGGG + Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1037836252 8:22216353-22216375 ATGGGTGCGCGCCCGAGCAGAGG + Intergenic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1046094345 8:109539853-109539875 TTGTGTGCGCGCGCGGCCCGCGG + Intronic
1049197453 8:141323572-141323594 GTGTGTGTGTGCCTGTGCAGTGG - Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1053618402 9:39792571-39792593 GTGTGTGTGTGGCCGGCCAGAGG + Intergenic
1053896099 9:42742775-42742797 GTGTGTGTGTGGCCGGCCAGAGG - Intergenic
1054265754 9:62914858-62914880 GTGTGTGTGTGGCCGGCCAGAGG - Intergenic
1060051756 9:120383151-120383173 GTGTGTGCGCGCCCTGGCGGCGG - Intergenic
1060404376 9:123366007-123366029 GTGTGTGCGCGCCAGGCTACGGG + Exonic
1061577701 9:131517818-131517840 AGGTGTGCGCGCCCGGCCTGCGG + Intronic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188143251 X:26578386-26578408 GTGTGTGTGTGCCCGCCCACAGG + Intergenic
1194035536 X:88866238-88866260 GTGTGTGCGCGCGCGCAAAGGGG + Intergenic