ID: 1073392586

View in Genome Browser
Species Human (GRCh38)
Location 10:103192263-103192285
Sequence GTGTGTGCGCGCCCGTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073392586_1073392596 7 Left 1073392586 10:103192263-103192285 CCCCTGGACGGGCGCGCACACAC No data
Right 1073392596 10:103192293-103192315 TAATGGTGACTAGTCATTTCGGG No data
1073392586_1073392589 -10 Left 1073392586 10:103192263-103192285 CCCCTGGACGGGCGCGCACACAC No data
Right 1073392589 10:103192276-103192298 GCGCACACACCCCCCTGTAATGG No data
1073392586_1073392597 8 Left 1073392586 10:103192263-103192285 CCCCTGGACGGGCGCGCACACAC No data
Right 1073392597 10:103192294-103192316 AATGGTGACTAGTCATTTCGGGG No data
1073392586_1073392595 6 Left 1073392586 10:103192263-103192285 CCCCTGGACGGGCGCGCACACAC No data
Right 1073392595 10:103192292-103192314 GTAATGGTGACTAGTCATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073392586 Original CRISPR GTGTGTGCGCGCCCGTCCAG GGG (reversed) Intronic