ID: 1073394409

View in Genome Browser
Species Human (GRCh38)
Location 10:103206344-103206366
Sequence TACTTGCCCCCCAGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073394409_1073394423 24 Left 1073394409 10:103206344-103206366 CCACCTCCCCTGGGGGGCAAGTA No data
Right 1073394423 10:103206391-103206413 GTCTACTCTCTCTTTTCTCTGGG No data
1073394409_1073394422 23 Left 1073394409 10:103206344-103206366 CCACCTCCCCTGGGGGGCAAGTA No data
Right 1073394422 10:103206390-103206412 TGTCTACTCTCTCTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073394409 Original CRISPR TACTTGCCCCCCAGGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr