ID: 1073398250

View in Genome Browser
Species Human (GRCh38)
Location 10:103236162-103236184
Sequence CTTCCCTGCAGCTCTCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073398250_1073398252 -2 Left 1073398250 10:103236162-103236184 CCGGCAGGAGAGCTGCAGGGAAG No data
Right 1073398252 10:103236183-103236205 AGAGATACTAGAGTTTTTCAGGG No data
1073398250_1073398251 -3 Left 1073398250 10:103236162-103236184 CCGGCAGGAGAGCTGCAGGGAAG No data
Right 1073398251 10:103236182-103236204 AAGAGATACTAGAGTTTTTCAGG No data
1073398250_1073398256 30 Left 1073398250 10:103236162-103236184 CCGGCAGGAGAGCTGCAGGGAAG No data
Right 1073398256 10:103236215-103236237 ATGCAGTGTGAGGAAGAACGAGG No data
1073398250_1073398253 3 Left 1073398250 10:103236162-103236184 CCGGCAGGAGAGCTGCAGGGAAG No data
Right 1073398253 10:103236188-103236210 TACTAGAGTTTTTCAGGGACTGG No data
1073398250_1073398254 7 Left 1073398250 10:103236162-103236184 CCGGCAGGAGAGCTGCAGGGAAG No data
Right 1073398254 10:103236192-103236214 AGAGTTTTTCAGGGACTGGCTGG No data
1073398250_1073398255 20 Left 1073398250 10:103236162-103236184 CCGGCAGGAGAGCTGCAGGGAAG No data
Right 1073398255 10:103236205-103236227 GACTGGCTGGATGCAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073398250 Original CRISPR CTTCCCTGCAGCTCTCCTGC CGG (reversed) Intergenic
No off target data available for this crispr