ID: 1073399411

View in Genome Browser
Species Human (GRCh38)
Location 10:103244537-103244559
Sequence AAGTTGTAGTAGAGGGCACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073399408_1073399411 -6 Left 1073399408 10:103244520-103244542 CCTTAACAAAAGGCAGTAAGTTG No data
Right 1073399411 10:103244537-103244559 AAGTTGTAGTAGAGGGCACGAGG No data
1073399407_1073399411 1 Left 1073399407 10:103244513-103244535 CCTGTCTCCTTAACAAAAGGCAG No data
Right 1073399411 10:103244537-103244559 AAGTTGTAGTAGAGGGCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073399411 Original CRISPR AAGTTGTAGTAGAGGGCACG AGG Intergenic
No off target data available for this crispr