ID: 1073403271

View in Genome Browser
Species Human (GRCh38)
Location 10:103276215-103276237
Sequence TGGGATGCCCACAGTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073403271_1073403278 24 Left 1073403271 10:103276215-103276237 CCTCTGCCACTGTGGGCATCCCA No data
Right 1073403278 10:103276262-103276284 CAGAAATCCAATTTCTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073403271 Original CRISPR TGGGATGCCCACAGTGGCAG AGG (reversed) Intergenic
No off target data available for this crispr