ID: 1073403570

View in Genome Browser
Species Human (GRCh38)
Location 10:103277703-103277725
Sequence CCTGCTGGAGCGCGACGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073403564_1073403570 -1 Left 1073403564 10:103277681-103277703 CCAGCTCGGCTCGCTCGCAGGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1073403570 10:103277703-103277725 CCTGCTGGAGCGCGACGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 153
1073403560_1073403570 22 Left 1073403560 10:103277658-103277680 CCTGCGCGCGCAGCTGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1073403570 10:103277703-103277725 CCTGCTGGAGCGCGACGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073403570 Original CRISPR CCTGCTGGAGCGCGACGGGC TGG Exonic
900990321 1:6095637-6095659 CCTGGTGGGGAGGGACGGGCAGG + Intronic
901333016 1:8424833-8424855 CCTGCTGGAGCCCACCTGGCAGG - Intronic
902053775 1:13583921-13583943 CCTGGAGGAGCGCGACGGTGGGG - Exonic
903362976 1:22788502-22788524 CCTGCTGGAGCAGGACGTGCAGG + Intronic
903788325 1:25875656-25875678 GCTGCTTGTGCGCGGCGGGCGGG - Intergenic
903792820 1:25906276-25906298 CCTGCTGCAGGGCGGCGGGCGGG - Intronic
904160425 1:28518613-28518635 ACTGCGCGAGCGCGGCGGGCCGG + Intronic
905263959 1:36738485-36738507 CCTGCTGGAGGGAGACGGTGGGG + Intergenic
905534391 1:38708903-38708925 CCTGCTGCTGCCCGACTGGCTGG + Intergenic
908920611 1:69186668-69186690 CCTCCTGGAGAGGGAGGGGCTGG + Intergenic
912430551 1:109626358-109626380 CCTGCGGGAGCGTGATGTGCTGG + Exonic
913544413 1:119853308-119853330 CCTGCAGCAGCGCGACGGCCAGG + Intergenic
916214915 1:162386086-162386108 CCTGCAGCAGGGGGACGGGCAGG - Intronic
919586635 1:199447968-199447990 CCTGCTGGAGCCAGGGGGGCTGG - Intergenic
923744292 1:236686389-236686411 GCGGCTGGGGCCCGACGGGCGGG + Intergenic
1063369429 10:5511605-5511627 CCTGATGGTGAGAGACGGGCGGG - Intergenic
1064209106 10:13348196-13348218 CCGGCGGGAGCGCGGCGGCCCGG - Exonic
1067842442 10:49691749-49691771 CCTGCAGGAGGGCCAGGGGCAGG + Intronic
1071059051 10:81548425-81548447 CCTGCTGGAGCCAGAGAGGCTGG + Intergenic
1071134586 10:82438386-82438408 CCTGCTGGAGCCAGAAAGGCTGG - Intronic
1072188461 10:93062799-93062821 GCTCCTGGTGCGCGGCGGGCGGG + Exonic
1072719418 10:97771587-97771609 CCTGCTGGAGCACGAGAGCCTGG - Exonic
1072813551 10:98482652-98482674 CCTGCTGCAGCCCTATGGGCAGG - Exonic
1073098894 10:100997054-100997076 CCTGGTGGAGCGGGGCGGGGCGG - Intronic
1073403570 10:103277703-103277725 CCTGCTGGAGCGCGACGGGCTGG + Exonic
1074148834 10:110740469-110740491 CCTGCTGCAGAGGGAGGGGCAGG + Intronic
1076358259 10:129868598-129868620 CCTGCTGGGGCGGGAGGGGTTGG + Intronic
1076900609 10:133335790-133335812 CCTGCCAGAGCGCGGCGGGTGGG - Intronic
1078091664 11:8268146-8268168 CCAGCCGGAGCGCGCAGGGCTGG + Intronic
1079733383 11:23963490-23963512 CCTGCTGTAGTGTGACTGGCTGG - Intergenic
1082688393 11:56268721-56268743 CCTGTTGGAGCATGAGGGGCAGG + Intergenic
1083921960 11:65786178-65786200 GCTGGTGGAGCGCGGAGGGCTGG - Intergenic
1083951459 11:65958952-65958974 CCTGCTGGAACAGGAAGGGCCGG - Exonic
1085451256 11:76635307-76635329 CCTGGTGGAGGGCGCAGGGCAGG + Intergenic
1089682358 11:120125808-120125830 CCTGCTGGAGGGGGAGGGCCTGG - Exonic
1096148694 12:49295695-49295717 GCAGGTGGAGCGCGACGGGCTGG + Exonic
1096639955 12:52986228-52986250 TCTGCTGGAGAGCCACAGGCAGG - Intergenic
1100654395 12:96625316-96625338 ACTGCTGGAGCCAGACTGGCTGG - Intronic
1102418844 12:112788041-112788063 CCTGCTGCAGTGCCACAGGCTGG + Intronic
1105407773 13:20145865-20145887 CCTGCTGGAGCGGGATGGGGAGG - Intronic
1105835899 13:24211826-24211848 CCAGCTGGAGGACGACAGGCAGG - Intronic
1108747333 13:53409009-53409031 CCGGCTGGAGGGCCACGGGCGGG - Intergenic
1112137458 13:96597181-96597203 CCTACTGGAGGGCGAAGGGTAGG + Intronic
1112574452 13:100623173-100623195 CCTGCTGCAGGGCCAAGGGCAGG + Intronic
1113110092 13:106813692-106813714 CCTGCTGGAGGGTGAGGGGAGGG + Intergenic
1113417335 13:110138481-110138503 CCTGCAGGTGCGCGCGGGGCAGG + Intergenic
1113902582 13:113805044-113805066 CCTGCTGGAGTTGGACGCGCTGG + Intronic
1122938882 14:104972429-104972451 CCTGCTGGAGTGGGACAGGAAGG + Intronic
1123716790 15:23039483-23039505 GCAGCAGGAGCGCGACGTGCGGG - Exonic
1124046545 15:26155843-26155865 CCTGCTGGAACCAGACAGGCTGG - Intergenic
1129933647 15:79432012-79432034 CCAGCTTGAGCGCCCCGGGCGGG + Intergenic
1130283924 15:82540292-82540314 CAGGCTGGAGCGCAACGGGCCGG - Intronic
1132702819 16:1229299-1229321 CCTGCTGGAGCTGGAGGAGCCGG - Exonic
1132705507 16:1241569-1241591 CCTGCTGGAGCTGGAGGAGCCGG + Exonic
1132753406 16:1469902-1469924 CGTGCTGCAGCACGACGGGCCGG + Intronic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1134531893 16:14989914-14989936 CCTGCGGGAGCGCGGCGAGGCGG - Intronic
1134539573 16:15054123-15054145 CCGCCTGGGGCGCGGCGGGCAGG - Intronic
1136367679 16:29816408-29816430 CCTGCGGGAGCGTGATTGGCTGG + Exonic
1136492447 16:30618218-30618240 ACTGCTGGAGCGCCAGGGTCAGG - Intronic
1136568043 16:31081559-31081581 CCGGCTGGAGGGCCACGGGCGGG + Exonic
1136609348 16:31356877-31356899 GCTGCGGGAGTGCGATGGGCGGG - Intronic
1138213747 16:55184881-55184903 CCTGCTGGAGCACCTGGGGCTGG - Intergenic
1139849303 16:69940990-69941012 CCTCCTGGAGCTCCAGGGGCTGG - Exonic
1141727348 16:85798971-85798993 CCTGCTGGAGGGCGACCGCTGGG + Intronic
1142767670 17:2074840-2074862 CCTGATGGAGAGGGAGGGGCAGG + Intronic
1144854538 17:18260740-18260762 ACAGCTGGAGCGCGGCGGGGCGG + Intronic
1148419118 17:47531214-47531236 CCAGCCGGAGCGCTAGGGGCTGG - Exonic
1150135880 17:62694911-62694933 TAGGCTGGAGGGCGACGGGCAGG - Intergenic
1150709285 17:67516290-67516312 CATGCTGCAGCTAGACGGGCTGG + Intronic
1151155578 17:72121492-72121514 CGAGCCGGAGCCCGACGGGCAGG - Exonic
1151344293 17:73492307-73492329 CCTGCAGGAGCGTGCCGGCCGGG - Intronic
1152642649 17:81455621-81455643 CCTGCTGGAGTGAGACGAGGAGG - Intronic
1152688901 17:81708525-81708547 CCTGGGGGAGCGGGAGGGGCAGG + Intergenic
1152824948 17:82458785-82458807 TCATCTGGAGCGCGGCGGGCGGG - Exonic
1154121429 18:11655432-11655454 CCTGCGGCAACGCGACGGGATGG + Intergenic
1154501125 18:14998557-14998579 CCTGCTGGGGCGTGAGGTGCGGG - Intergenic
1159040591 18:63320078-63320100 CGGGCGGGAGCGCGGCGGGCGGG + Exonic
1160583194 18:79899249-79899271 GCTCCTGGAGCGCGCGGGGCTGG + Exonic
1160782985 19:886054-886076 CCTGCTGAAGCCCAGCGGGCAGG - Exonic
1160818333 19:1046540-1046562 CCTGCTGCAGCGGGAGGAGCAGG + Intronic
1161014438 19:1976686-1976708 CCTGCTGCAGCTGGACTGGCAGG - Intronic
1161014912 19:1978744-1978766 CCAGCTGGTGCGCGGCGGGCGGG + Exonic
1161037845 19:2095546-2095568 CCTGCGGGAGGGCAGCGGGCAGG + Intronic
1161168163 19:2799766-2799788 GCTCCTGGAGCGTGAAGGGCAGG - Exonic
1161479765 19:4504674-4504696 GCTGCTGGAGCTCGGCGGGCAGG + Exonic
1161950358 19:7464403-7464425 CCTGCTGGAGAGGGGCAGGCTGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162562034 19:11422533-11422555 CCAGCTGGAGCGCGCCTTGCGGG - Exonic
1162588278 19:11574898-11574920 CCTGCTGCAGCGCCACAGGTTGG + Exonic
1163113248 19:15174264-15174286 CCTGCTGGCCCGCGGCGTGCTGG - Exonic
1163282117 19:16324613-16324635 CCTGGCGGCGCGCGAGGGGCCGG + Intergenic
1166670028 19:44704145-44704167 CCAGGCGGAGAGCGACGGGCAGG - Exonic
1166883059 19:45940567-45940589 CCTGCTGGGCCCCGCCGGGCTGG - Exonic
1167676939 19:50893099-50893121 CCAGCAGGAGCCCGACGAGCAGG + Intergenic
925389098 2:3483467-3483489 CGTGCTGGAGAGTGACGGGCCGG - Intronic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
932774092 2:74516655-74516677 GGTGCTGGAGCGCGAGAGGCTGG + Exonic
933747994 2:85584628-85584650 ACTGCTGGAGCAGGACGGGGCGG + Intronic
947091011 2:226511460-226511482 CCTGCTGGAGAGAGAAGGTCAGG + Intergenic
947623357 2:231604682-231604704 CCTGCTGGGCCGGGCCGGGCTGG - Intergenic
948318730 2:237051964-237051986 CCTGCTGCAGCGCAATGAGCTGG - Intergenic
948334144 2:237194403-237194425 CCAGCTGCAGAGCTACGGGCAGG + Intergenic
948461339 2:238131306-238131328 GCTGCTGGAGTGCGACCTGCCGG + Exonic
948711011 2:239825583-239825605 CATGCTGGAGCATGGCGGGCTGG + Intergenic
948814425 2:240502604-240502626 ACTCCTGGTGAGCGACGGGCAGG - Intronic
1169980591 20:11379820-11379842 CCTGCTGGAGCCAGAGAGGCTGG + Intergenic
1172109436 20:32536591-32536613 CCTGCTGGAGCGGCTCGCGCGGG + Intronic
1176178583 20:63739643-63739665 CCGGCGGGAGCGCGGCCGGCCGG + Intronic
1176198019 20:63846526-63846548 CCTGCTGGAGCCGGGCCGGCGGG + Intergenic
1177187925 21:17818973-17818995 CATCCTGGAGCCCGGCGGGCGGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181407396 22:22694597-22694619 CCTGCTGCAGGGGGAGGGGCTGG + Intergenic
1181415394 22:22755364-22755386 CCTGCTGCAGGGGGAGGGGCTGG + Intronic
1181572114 22:23773241-23773263 GCGGCTGGAGCGCGAGAGGCAGG - Intronic
1184207508 22:43014688-43014710 CCTGCTGGAGAGGGAAGTGCAGG - Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949497262 3:4644271-4644293 CCTGCAGGAGCGGGTCTGGCAGG + Intronic
949895485 3:8764994-8765016 CCTGCTGAAGCCCAAGGGGCAGG - Intronic
955950653 3:64239235-64239257 CCTGCTGGGGGGCGGGGGGCTGG + Intronic
960385325 3:117015777-117015799 CCTGCTGGAACGAGAAGGGGTGG - Intronic
960413727 3:117359030-117359052 CCTGCTGGAGCCAGAGGGGCTGG + Intergenic
961604355 3:128082733-128082755 CCTCCTGGAGGGTGCCGGGCCGG - Intronic
972674856 4:41250411-41250433 TCTGCTGGAGGGGGATGGGCAGG - Intergenic
973884094 4:55303119-55303141 CCTGTTGGGGCGTGAGGGGCTGG + Intergenic
976732518 4:88278484-88278506 CCTGCTGCAGGACGACAGGCGGG - Exonic
983792244 4:171813066-171813088 CCGGCGGGAGCGCGGCGAGCCGG - Intronic
985146200 4:186896433-186896455 CCTGCTGGAGCCCCGCGTGCTGG - Intergenic
986695892 5:10354001-10354023 GCTGCTGGATCGCGGCGGGGCGG + Intronic
986744149 5:10729858-10729880 CATGCTGGAGCTCGCCAGGCAGG - Intronic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
997302099 5:132813687-132813709 CCTGCAGGAGCACGGCGGGAAGG + Exonic
999596887 5:153214841-153214863 CCTGCTGGAGCCAGAGAGGCTGG + Intergenic
1001482231 5:172096346-172096368 CCTGCTGGTGTGGGAGGGGCAGG - Intronic
1002891372 6:1335622-1335644 CCTGCTGGAGCAGGAGGGCCTGG + Intergenic
1003014348 6:2455994-2456016 CCTGCTGGAGAGAGCAGGGCAGG + Intergenic
1005082074 6:21966173-21966195 CCTGCTGGAGCGGAACCAGCAGG + Intergenic
1006277104 6:33013819-33013841 CCTGCTGGAGTGGGAGGAGCTGG - Intergenic
1006443859 6:34068142-34068164 CGTGCTGGAGGGAGACGGGGGGG + Intronic
1008651755 6:53570780-53570802 CAGGCTGGAGTGCAACGGGCGGG + Intronic
1015358183 6:132305172-132305194 CCTGCTGGAGCCAGAGAGGCTGG + Intronic
1019113538 6:169738140-169738162 CCTGCTGGAGCCAGGCAGGCTGG - Intergenic
1019331722 7:463664-463686 CCTGCTGGAGGGCACCCGGCAGG - Intergenic
1019625552 7:2014069-2014091 TCTGCTGGGGCCTGACGGGCAGG - Intronic
1019780498 7:2937018-2937040 CCAGGTGGGGCGGGACGGGCAGG - Exonic
1026956006 7:74376839-74376861 CCTGCTGGGGCGGGAGGGTCGGG + Intronic
1027520515 7:79200780-79200802 CCTGTTGGAGTGGGAAGGGCTGG - Intronic
1028921699 7:96316902-96316924 GCTGCTGGAGCCAGACTGGCAGG + Intronic
1031127729 7:117793538-117793560 ACTGCAGGAGCGCTACGGGAAGG - Intronic
1032391313 7:131556797-131556819 CGCCCTGGAGCGCGACGGGCGGG + Intronic
1035247290 7:157571775-157571797 CCTGCAGGGGTGGGACGGGCAGG - Intronic
1035406884 7:158604461-158604483 CCTGCTGAAGGACGAGGGGCCGG - Intergenic
1035453745 7:158996260-158996282 CCTGCTGGACCCCACCGGGCTGG - Intergenic
1037305177 8:17497090-17497112 CCTTCTGCAGCGCGGCCGGCGGG + Intronic
1045749770 8:105469466-105469488 CCAGCTGGAGAGCAATGGGCAGG - Intronic
1047557882 8:125952270-125952292 CATGCTGAAGGGCGAAGGGCTGG - Intergenic
1050618314 9:7426402-7426424 CCTGCTGGAGCCAGAGAGGCTGG - Intergenic
1053203147 9:36166200-36166222 CCAGCTGGAGCGCCGCGGGCGGG - Intergenic
1060267587 9:122121388-122121410 GCTGCTGGAGCCCAAGGGGCTGG - Intergenic
1060970623 9:127735404-127735426 CCTGCTGCGGAACGACGGGCGGG - Intergenic
1062499409 9:136845827-136845849 CCTGCTGGGGCGCGAGGTGCGGG + Exonic
1062587167 9:137254658-137254680 CCTGCGGGAGGGCGGCGGGCTGG + Intergenic
1189002776 X:36963709-36963731 TCGGCTGGAGCGCGCAGGGCGGG - Intergenic
1192930264 X:75799323-75799345 CCTGCTGGAGCCAGAGAGGCTGG - Intergenic
1193039300 X:76987646-76987668 CCTGCTGGAGCCAGAGGGGCTGG + Intergenic
1197728645 X:129792812-129792834 GCTGCTGGAGCGCATCGGCCTGG + Exonic
1199746640 X:150775957-150775979 CCTGCAAGAGCGCGTGGGGCTGG - Intronic
1200231058 X:154444073-154444095 CCAGCTGGCGCGCGGCGGGGCGG + Intergenic
1200787750 Y:7274447-7274469 CCTGCAGGACTGCGACGCGCTGG + Intergenic
1202372795 Y:24209850-24209872 CCTGCTGGAGCTGCAGGGGCAGG - Intergenic
1202497987 Y:25460270-25460292 CCTGCTGGAGCTGCAGGGGCAGG + Intergenic