ID: 1073412173

View in Genome Browser
Species Human (GRCh38)
Location 10:103351125-103351147
Sequence CTCGGACGCCACCACTGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073412165_1073412173 21 Left 1073412165 10:103351081-103351103 CCAGGCGAGGCGAGGCGGCGGGA 0: 1
1: 0
2: 1
3: 20
4: 245
Right 1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073412173 Original CRISPR CTCGGACGCCACCACTGCGC AGG Exonic
900517549 1:3090185-3090207 CCCGAACGCCACCACGGGGCTGG + Intronic
922809784 1:228409079-228409101 CTCGGAAGCCACCAATGGGGGGG - Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1069521471 10:69124565-69124587 CTCGGACCCCGCCTCTGCGGGGG + Intronic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1074864017 10:117534791-117534813 CTCGGAGGCCTCCTCTACGCTGG - Intergenic
1078654892 11:13229446-13229468 CTCGGACTCCAACACTGTCCAGG + Intergenic
1081734046 11:45391265-45391287 CTCCGAGGCCATCACTGGGCAGG - Intergenic
1083674520 11:64318092-64318114 CTGGGCCGCCTCCACTGCGCAGG - Exonic
1085232942 11:74988775-74988797 CTCGGTCCCCACCACGGCGTGGG - Exonic
1092197070 12:6555929-6555951 CTGGGAGGCGACCACTTCGCCGG - Exonic
1092780677 12:11983815-11983837 CTCGGAAGACATCACTGCTCTGG + Intergenic
1119252187 14:73165912-73165934 ATCGGCATCCACCACTGCGCCGG - Intronic
1122789038 14:104176690-104176712 CTCGGATCCCACCGCTGCGGAGG + Exonic
1126172263 15:45704806-45704828 CTCGGTCCCCTCCACTGCACTGG + Intergenic
1127333757 15:57963893-57963915 CTTTGACCCCACCACTGAGCAGG - Exonic
1129221646 15:74134847-74134869 CTGGGACTCCACCAGTGAGCAGG - Exonic
1133102611 16:3488343-3488365 CTCGGGCTCCACCCCTGAGCAGG - Intergenic
1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG + Exonic
1136485953 16:30571725-30571747 TTCGGACGCCACGGCTGGGCGGG - Exonic
1141755879 16:85990495-85990517 CTCGGAGGCCACCAGTCCGCGGG - Intergenic
1142105426 16:88299868-88299890 CTCTGAGGCCAGCACTGCCCCGG + Intergenic
1152154212 17:78622388-78622410 CTCGGACGTCACCATGGCACAGG - Intergenic
1152235350 17:79135594-79135616 CCCCGATGCCCCCACTGCGCTGG - Intronic
1152720525 17:81921438-81921460 CACGGACGACACCACGGCACCGG + Exonic
1161098547 19:2408410-2408432 CTCGGAGGCCAGCACCGTGCGGG + Exonic
1163118064 19:15200148-15200170 CTGGGACCCCGCCCCTGCGCGGG - Intronic
1165258798 19:34596344-34596366 CATGGACGCCTGCACTGCGCAGG - Exonic
1167745963 19:51352042-51352064 CTCGGGCACCACCTCTGCTCAGG - Intronic
934760648 2:96854337-96854359 CTCGGCCGGCTACACTGCGCTGG - Exonic
935676403 2:105598229-105598251 ATTGGAAGCCACCAATGCGCAGG + Intergenic
946509039 2:220334722-220334744 CTCTGTGGCCACCACTGCCCTGG + Intergenic
1180049007 21:45322937-45322959 CTCTGATGCCACCTCTGGGCTGG + Intergenic
950304524 3:11907814-11907836 CTGGGACTCCACCACTGCTGCGG - Intergenic
957939792 3:86990749-86990771 CTCGGGGGCCGCCACTGCCCCGG - Exonic
962613849 3:137104533-137104555 CTGGGAGGCCACCACTCTGCAGG - Intergenic
969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG + Intergenic
974047311 4:56908477-56908499 CTGGGACGCCGCCTCCGCGCTGG + Intronic
975016746 4:69430872-69430894 CTCGCACGCCCGCACTGCCCAGG + Intergenic
985894435 5:2740163-2740185 CCCGCACGCCACGACTGCCCCGG - Intergenic
990376186 5:55173259-55173281 CTCTGACGACACCGCGGCGCCGG - Intergenic
990553754 5:56909788-56909810 CCCAGACGCCACCACGGCGGCGG + Intronic
1019557531 7:1640141-1640163 CTGTGACGCCACCACTGCACTGG - Intergenic
1027011140 7:74745829-74745851 CTGTGAGGCCACCACTGTGCTGG + Intronic
1027773964 7:82443146-82443168 CTCGGGCGCCTCCACGGGGCCGG - Intronic
1028539648 7:91927782-91927804 CTCAGACCGCACCACTGCACTGG + Intergenic
1030657849 7:112187619-112187641 CTCAGAAGCCACCACTTCTCAGG + Intronic
1039914487 8:41849630-41849652 CTCGGATCCCACCGCCGCGCAGG + Intronic
1042611554 8:70607442-70607464 CTGGCGCGCCTCCACTGCGCCGG + Intronic
1048324638 8:133429546-133429568 CTCAGCTGCCACCACTGCTCTGG + Intergenic
1049260614 8:141637047-141637069 CTCGGAGGCCAGCACCACGCAGG - Intergenic
1062162601 9:135088295-135088317 CAGGGTCGCCACCGCTGCGCCGG - Intronic
1192170790 X:68853215-68853237 CTCAGACCCCACCAATGGGCAGG - Intergenic