ID: 1073415490

View in Genome Browser
Species Human (GRCh38)
Location 10:103378136-103378158
Sequence ACATTGAAAATATTCTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 0, 2: 14, 3: 139, 4: 742}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073415487_1073415490 10 Left 1073415487 10:103378103-103378125 CCTACAGCTTAGTTCAGGATTAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1073415490 10:103378136-103378158 ACATTGAAAATATTCTGGGATGG 0: 1
1: 0
2: 14
3: 139
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073415490 Original CRISPR ACATTGAAAATATTCTGGGA TGG Intronic
901751270 1:11411009-11411031 AAATTGAAAACCTTCTGGAAAGG + Intergenic
901910227 1:12451243-12451265 ACAATGAGATTATTTTGGGAAGG + Intronic
902165323 1:14566044-14566066 AAATTGAAAACCTTCTGGAAAGG - Intergenic
902848296 1:19130221-19130243 ACTTTGAAAATATTCTGGGCTGG - Intronic
903055861 1:20635550-20635572 ACATTTAAAAAATTCTGGGCCGG + Intronic
903783886 1:25843414-25843436 AAATTGAAAATCTTCTGAAAAGG + Intronic
903881362 1:26511971-26511993 ACACTGAAAATATGTTGGGTGGG - Intergenic
904332576 1:29771823-29771845 AAATTGAAAATATCATGAGATGG + Intergenic
904494492 1:30878937-30878959 ACACTGAAAGCCTTCTGGGATGG - Intronic
904863130 1:33555052-33555074 ATATTGAAAACCTTCTGGAAAGG + Intronic
905056944 1:35103429-35103451 ACCTTGAAAATATTATGCTAAGG - Intronic
905144352 1:35875977-35875999 AAATTGAAAACCTTCTGGAAAGG + Intronic
905260906 1:36718193-36718215 AAATTGAAAACCTTCTGGAAAGG - Intergenic
905545798 1:38799376-38799398 AAATTGAAAACCTTCTGGAAAGG - Intergenic
906092054 1:43188097-43188119 ACATTGAAAACATGCTGGCCAGG - Intronic
906236099 1:44211874-44211896 ACATAGAAAAAATTCTGGAAAGG - Intergenic
906269698 1:44466473-44466495 AAATTGAAAATCTTCTGGAAAGG - Intronic
906994671 1:50779346-50779368 ACATTGAAAACCATCTGGAAAGG - Intronic
907002150 1:50872158-50872180 ACACTGAAAACTTTCTGGAAAGG + Intronic
907033594 1:51196402-51196424 ACATTGAAAACCTTCTGGAAAGG - Intergenic
907056812 1:51376922-51376944 ACACTGAAAACCTCCTGGGAAGG + Intronic
907627792 1:56048036-56048058 CCATTGAAAACCTTCTGGGATGG - Intergenic
907633069 1:56104314-56104336 CAATTGAAAACCTTCTGGGAAGG - Intergenic
907916910 1:58879051-58879073 ACATTTAAAACACTCTGGAAAGG + Intergenic
907965760 1:59327638-59327660 AAATTGAAAACATTCTGGAAAGG - Intronic
908682223 1:66674922-66674944 TCATTGAAAATATTCAGGTGTGG - Intronic
908975330 1:69890138-69890160 AAATTGAAAACATTCTGGAGAGG - Intronic
909089639 1:71209171-71209193 ACATTGAAATGATTCAGGAAGGG - Intergenic
909246382 1:73290388-73290410 ACATTGAAAATTCTCTAGAAAGG - Intergenic
909322203 1:74303753-74303775 AAATTGAAAATCTTCTGGAATGG + Intronic
910054777 1:83020263-83020285 ACATTGAAAATCTTCTGGAAAGG - Intergenic
910068038 1:83177238-83177260 ACATTGAAAGCCTTCTGGAAAGG - Intergenic
910520801 1:88120012-88120034 ACAATGAAAAAATTCTAGGCAGG - Intergenic
910718783 1:90261587-90261609 AAATTGAAAACCTTCTGGGAAGG + Intergenic
910782504 1:90954902-90954924 AAATTGAAAACTTTCTGGAAAGG - Intronic
910810702 1:91232918-91232940 AAATTCAAAATATTCTGAAATGG - Intergenic
910845074 1:91597228-91597250 ACATGGAAAATCTTCTGGAAAGG - Intergenic
911392261 1:97260427-97260449 ACAATGAAAGTATTCTGGAGAGG + Intronic
911706088 1:101015146-101015168 AAATTGAAAACCTTCTGGAAAGG - Intronic
911712610 1:101092375-101092397 AAATTGAAAACCTTCTGGAAAGG - Intergenic
911759005 1:101595172-101595194 AAATTGAAAATCTTCTGGAAAGG - Intergenic
911987394 1:104645334-104645356 AAATTGAAAACATTCTGGAATGG + Intergenic
912296870 1:108478153-108478175 ACAGTGAAAATTTTGGGGGATGG - Intergenic
912859581 1:113201505-113201527 AAATTGAAAATCTTCTGAAAAGG + Intergenic
913046097 1:115074651-115074673 ACTTAGAAAATATACTGAGAAGG - Intronic
913265376 1:117038185-117038207 CCTGTGTAAATATTCTGGGAGGG - Intergenic
913308091 1:117453336-117453358 AAATGGAAAATCTTCTGGAAAGG + Intronic
914264676 1:146028205-146028227 ACATTGAAAATTTTGTCGGCCGG + Intergenic
914709528 1:150200253-150200275 AAATTGAAAACCTTCTGGAAAGG - Intergenic
914738021 1:150437123-150437145 AAATTGAAAACCTTCTGGAAAGG + Intronic
914774475 1:150723490-150723512 AAATTGAAAACCTTCTGGAAAGG - Intergenic
914960354 1:152200505-152200527 AAATTGAAAATCTTCTGGAAAGG - Intergenic
915695211 1:157733980-157734002 AAATTGAAAATGTTCTGGAAAGG + Intergenic
915845211 1:159256152-159256174 AAATCGAAAATTTTCTGGAAAGG - Intergenic
916169566 1:161991197-161991219 AAATTGAAAACCTTCTGGAAAGG - Intronic
916566748 1:165986096-165986118 AAATTGAAAAACTTCTGGAAAGG + Intergenic
916844848 1:168639315-168639337 ACATTGTAAATACTCTAGGAAGG - Intergenic
916847160 1:168663379-168663401 AAATTGAAAACTTTCTGGGAAGG + Intergenic
916956792 1:169845915-169845937 AAATTGGAAACCTTCTGGGAAGG - Intronic
917271903 1:173285038-173285060 CCATTGAAAACTTTCTGGAAAGG + Intergenic
917653461 1:177102275-177102297 ACCTTGAAAAGATTTTGTGAAGG - Intronic
918361307 1:183761176-183761198 AAATTGAAAATCTTTTGGAAAGG - Intronic
918694480 1:187527260-187527282 AAATTGAAAATCTCCTGGAAAGG + Intergenic
919054908 1:192558452-192558474 AAATTGAAAACATTGTGGGAAGG - Intergenic
919400937 1:197115485-197115507 AAATTGAAAACCTTCTGGAAAGG - Intronic
919436154 1:197563765-197563787 AAATTGAAAACCTTCTGGAAAGG + Intronic
919544275 1:198894396-198894418 ACATTTCAAATATACTGGCAAGG + Intergenic
919660328 1:200237692-200237714 ATAATGAAAACATTCTGGGCTGG - Intergenic
920041193 1:203098606-203098628 GCAGTGAACATGTTCTGGGAGGG + Intronic
920277420 1:204817210-204817232 AAATTGAAAACATTCTGGAAAGG + Intergenic
920644275 1:207787536-207787558 AATTTTAAAATATTTTGGGAAGG + Intronic
920887666 1:209947310-209947332 AAATTGAAAACTTTCTGGAAAGG + Intronic
921090950 1:211842172-211842194 AAATCGAAAATCTTCTGGGACGG - Intergenic
921276107 1:213522007-213522029 AAATTGAAAACGTTCTGGAAAGG - Intergenic
921292103 1:213668147-213668169 AAATTGAAAACCTTCTGGAAAGG - Intergenic
921303871 1:213776228-213776250 CCATTAAAAATGTTCTGGAAAGG - Intergenic
921408328 1:214806861-214806883 AAATTGAAAACCTTCTGGAAAGG + Intergenic
921714557 1:218404415-218404437 ACATTTTAAAGCTTCTGGGAAGG - Intronic
921870575 1:220135343-220135365 ACATGTGAAATGTTCTGGGATGG - Intronic
922065387 1:222133927-222133949 CAATTGAAAACATTCTGGAAAGG - Intergenic
922588797 1:226756718-226756740 AGATTGAAAACATTCTGGAAAGG + Intergenic
923245362 1:232125563-232125585 ACATAGAAAATTCTCTAGGATGG - Intergenic
923247333 1:232145213-232145235 ACATAGAAAATAAGTTGGGAAGG + Intergenic
923795771 1:237153906-237153928 ACTTTTAAAATTTTCTGGGTTGG + Intronic
923936060 1:238761838-238761860 AAATTGAAAACCTTCTGGAAAGG - Intergenic
924168705 1:241313734-241313756 AAATTGAAAACCTTCTGGAAAGG + Intronic
924259752 1:242217283-242217305 AAATTGAAAATCTTCTGGGAAGG + Intronic
924365930 1:243293576-243293598 ACCTTGAAAATATTATGCTAAGG - Intronic
924661926 1:246027870-246027892 AAATTGAAAACCTTCTGGAAAGG + Intronic
924835756 1:247645543-247645565 CCATTAAAAATATTTTTGGACGG + Intergenic
1062995765 10:1865049-1865071 AAATTGAAAACTTTCTGGAAAGG + Intergenic
1063142756 10:3269984-3270006 GCATTGAAAATCTGCGGGGATGG + Intergenic
1063190812 10:3693105-3693127 ACATTGAAAATATTATTAAAGGG - Intergenic
1063811220 10:9710338-9710360 ACATTGAAGATATTTGTGGATGG - Intergenic
1063824914 10:9885247-9885269 AAATTAAAAATCTTCTGGAAAGG - Intergenic
1063934410 10:11062390-11062412 AAATTGAAAACCTTCTGGAAAGG + Intronic
1064135146 10:12744109-12744131 ACATTGAAAACATTATGCTAAGG - Intronic
1065059165 10:21880368-21880390 AAATTGAAAACTTTCTGGGAAGG - Intronic
1065100788 10:22330392-22330414 ACATTAAAAATATTCTTTGCTGG - Exonic
1065439619 10:25737793-25737815 AAATTGAAAATCTTCTGAAAAGG + Intergenic
1065546418 10:26826086-26826108 AAATTGAAAACTTTCTGGAAAGG - Intronic
1065719152 10:28608875-28608897 ACTTTCAAAAAATTCTGAGAAGG + Intronic
1066050979 10:31635038-31635060 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1066134778 10:32434253-32434275 ATATTGAAAACCTTCTGGAAAGG - Intergenic
1066374872 10:34848855-34848877 AAATTGAAAACCTTCTGGGAAGG - Intergenic
1066478880 10:35775855-35775877 AAATTGAAAACTTTCTGAGAAGG - Intergenic
1066670152 10:37828488-37828510 CCAATAAAAATATTCTAGGAGGG + Intronic
1067120449 10:43467900-43467922 AAATTGAAAACCTTCTGGAATGG + Intronic
1067186601 10:44034097-44034119 AAATTGAAAACATTTTGGAAAGG - Intergenic
1068103418 10:52583868-52583890 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1068111733 10:52688428-52688450 ACATTCAAAATCTTATGGAATGG - Intergenic
1068330569 10:55561015-55561037 TCATTTAAGATACTCTGGGAAGG + Intronic
1068482398 10:57609232-57609254 ACATTGAAAACCTTCTGGAAAGG + Intergenic
1069270883 10:66525931-66525953 ACCTTGAAAATATTATGTTAAGG - Intronic
1069417910 10:68217872-68217894 AAATTGAAAAGCTTCTGGAAAGG + Intergenic
1069736526 10:70659205-70659227 AAGTTGAAAACCTTCTGGGAAGG + Intergenic
1069938018 10:71932446-71932468 AAATTGAAAATTTTCTGGAAAGG - Intergenic
1070034386 10:72707536-72707558 ATAATAAAAATATTCTGTGATGG - Intronic
1070360914 10:75688232-75688254 AAATTGAAAACCTTCTGGAAAGG + Intronic
1070420698 10:76234008-76234030 AAATTGAAAATCTTCTGGAAAGG - Intronic
1071084550 10:81854279-81854301 AAATTAAAAATCTTCTGGAAAGG - Intergenic
1071596466 10:86930952-86930974 ATATTGAAAATATTTTTGGCTGG + Exonic
1071847139 10:89532427-89532449 ACATTAAAAATATTATCAGAGGG + Intronic
1072873456 10:99146217-99146239 ACTTTGATAATATTTTTGGAAGG - Intronic
1073415490 10:103378136-103378158 ACATTGAAAATATTCTGGGATGG + Intronic
1073536851 10:104284749-104284771 ATAATGAAAATATTTTTGGAAGG - Intronic
1074091511 10:110263233-110263255 AGATAGAAAATATTTTAGGAAGG + Intronic
1074685374 10:115957658-115957680 TCATTGGAAATATTCTGCGGTGG + Intergenic
1074695067 10:116043081-116043103 TAATTGAAAATTTTCTGAGATGG - Intergenic
1075010207 10:118861819-118861841 ACATCGAAAACCTTCTGGAAAGG + Intergenic
1075113632 10:119608119-119608141 ACATTGAAAATATCCTATGTAGG - Intergenic
1075178797 10:120190946-120190968 ACATTAAAAATCTTCTGGAAAGG - Intergenic
1075431689 10:122389111-122389133 AAATTGAAAATTTTCTGGAGAGG - Intronic
1076276310 10:129201905-129201927 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1077755390 11:5023571-5023593 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1077757022 11:5042469-5042491 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1077911414 11:6574636-6574658 AAATTGAAAACCTTCTGGAAAGG - Intronic
1077924276 11:6664852-6664874 GGATTGAAAATATTTTGGAAGGG - Intergenic
1078584156 11:12566475-12566497 AAATTGAAAATCTTCAGGAAAGG - Intergenic
1078975760 11:16474330-16474352 AAATTGAAAACTTTCTAGGAAGG - Intronic
1079158554 11:17971820-17971842 TTATTAAAAATATTCTGGAAAGG + Intronic
1079272560 11:19002221-19002243 AAATTGAAAATCTTCTGGAAAGG + Intergenic
1080544062 11:33298561-33298583 AAATTGAAAACCTTCTGGAAAGG + Intronic
1080902117 11:36504687-36504709 AAATTGAAAACTTTCTGGAAAGG - Intronic
1080911951 11:36610010-36610032 CCTTTGAAAATATTCTGGATGGG - Intronic
1082880876 11:58036539-58036561 AAATTCAAAATCTTCTGGAAAGG + Intronic
1083314986 11:61809163-61809185 ACACTGCAAAAATTCAGGGAAGG - Intronic
1085724923 11:78946639-78946661 AAATTGAAAACTTTCTGGAAAGG + Intronic
1085858223 11:80200121-80200143 CAATTGAAAATCTTCTGGAAAGG + Intergenic
1086135750 11:83442595-83442617 ACAGTGAAAATTTTGGGGGATGG + Intergenic
1087023545 11:93627309-93627331 AGATTGAAAACTTTCTGGAAAGG - Intergenic
1087608736 11:100408869-100408891 AAATTGAAAATCTTCTGAAAAGG - Intergenic
1087635905 11:100700890-100700912 ACATTGAAAACCTTCGGGAAAGG - Intronic
1087650898 11:100866386-100866408 AAATTGAAAACCTTCTGGAAAGG - Intronic
1088389289 11:109296578-109296600 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1088439592 11:109854833-109854855 AGACTGAAAATCTTCTGGAAAGG - Intergenic
1088606276 11:111536432-111536454 AAAATGCAAATATTCTGGGATGG - Intronic
1089281549 11:117378307-117378329 ACACAGAAAATTTTCTGGAAAGG - Intronic
1089703758 11:120261722-120261744 ACAGTGACAAGATTCTGGGAGGG + Intronic
1090771263 11:129921607-129921629 ACTTTGAAAATATGCCAGGAAGG + Intronic
1091033958 11:132216596-132216618 ACATTGAAAATAAACTGGAAAGG - Intronic
1091172266 11:133529593-133529615 ACCTTAAAATTACTCTGGGATGG + Intronic
1091902803 12:4158328-4158350 ACATTGTAAAAACTATGGGATGG - Intergenic
1092382467 12:8008800-8008822 AAATTGAAAATCTTCTGGAGAGG + Intergenic
1092488502 12:8923526-8923548 AGATTGAAAATATTTGGGAAAGG + Intronic
1092757386 12:11776538-11776560 ACATTTAAAAAATTCTGGCTGGG - Intronic
1092866173 12:12763495-12763517 AAATTGAAAATATTGTGTGTGGG + Intronic
1093002434 12:14012780-14012802 AAATTGAAAATGTTCTGAAAAGG - Intergenic
1093667358 12:21830562-21830584 AGAATGAAGATATCCTGGGAGGG + Intronic
1093690816 12:22106553-22106575 AAATTGAAAATCTTCTGGAAAGG - Intronic
1093793241 12:23279767-23279789 ACATGGATAATACGCTGGGAAGG - Intergenic
1094399982 12:30052285-30052307 ACACTGAAAATAATTTAGGATGG + Intergenic
1094440028 12:30464924-30464946 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1095208789 12:39469012-39469034 AAATTGAAAATCTTCTGGAAAGG + Intergenic
1095233239 12:39767051-39767073 AAAGTGAAAATCTTCTGGAAAGG - Intronic
1095605887 12:44067335-44067357 AAATTGAAAATAGTCTGGAAAGG - Intronic
1095688035 12:45057868-45057890 AAATTGAAAACATTCTGGAAAGG - Intergenic
1095764046 12:45874746-45874768 AAATTGAAAATCTTCTGCAAAGG - Intronic
1095804766 12:46306961-46306983 ACATGGGACATTTTCTGGGATGG + Intergenic
1095910602 12:47422837-47422859 ACATTGAAAACCTTCTGGAAAGG + Intergenic
1097291816 12:57923009-57923031 ACAGTGAAACTATTCTGTAATGG + Intergenic
1097311212 12:58121665-58121687 AAATTGAAAATATTTTGTGGGGG - Intergenic
1097453677 12:59768167-59768189 AGATGGAAAATCTTCTGGAAAGG + Intronic
1097954827 12:65473159-65473181 AAATTGAAAACCTTCTGGAAAGG + Intronic
1098446099 12:70567418-70567440 ACAATGAGAATATTGGGGGAGGG - Intronic
1098647238 12:72918870-72918892 ACAGTGAAAAGGATCTGGGAAGG - Intergenic
1098744168 12:74214279-74214301 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1099060204 12:77898826-77898848 AAATTGAAAACCTTCTGGAAAGG + Intronic
1099162564 12:79261330-79261352 AGATTGAAAATATTGGAGGAAGG - Intronic
1099494399 12:83328461-83328483 ATATTGAAAGTATTCTTGGCTGG - Intergenic
1099713358 12:86258238-86258260 ATGCTGAAATTATTCTGGGAGGG - Intronic
1099820506 12:87703244-87703266 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1100117354 12:91323540-91323562 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1100468324 12:94868684-94868706 AAATTGAAAACCTTCTGGAATGG + Intergenic
1100962189 12:99974890-99974912 AAATTGAAAACCTTCTGGAAAGG - Intronic
1101732834 12:107440695-107440717 ACATGGTAATTATTCTGGGATGG + Intronic
1102601486 12:114034112-114034134 AAATTGAAAATCTTCTGGAAAGG + Intergenic
1103661204 12:122519233-122519255 GTATTGAAAATATTTTGGGGAGG - Intronic
1105587434 13:21758024-21758046 ACATTGATAATATTCTAGGTTGG + Intergenic
1105780207 13:23699262-23699284 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1105868409 13:24481942-24481964 AAATTGAAAACCTTCTGGAAAGG + Intronic
1105934256 13:25084736-25084758 ATATTGAATTTATTCTGGAATGG - Intergenic
1106397024 13:29391073-29391095 ACAATAATAATAATCTGGGATGG - Intronic
1106941372 13:34783538-34783560 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1107204934 13:37772932-37772954 ACATTGAGAAATTTCTGGGAAGG - Intronic
1107258751 13:38464614-38464636 AAAATGACAATATTCTGGAAAGG - Intergenic
1107534757 13:41317622-41317644 ACATTTAAAAGATTCTTTGAAGG + Intronic
1107869639 13:44734993-44735015 ACATGGACCATCTTCTGGGAAGG - Intergenic
1108149285 13:47515077-47515099 ACATCGAAAATATTATGCCAAGG + Intergenic
1108282644 13:48875125-48875147 AAAATGCAAATATTCAGGGAAGG - Intergenic
1108665222 13:52623444-52623466 AAATTGAAAATATTGCAGGATGG + Intergenic
1108997821 13:56757730-56757752 CCATTTAAAATATTTTGAGAAGG + Intergenic
1109080593 13:57894996-57895018 AAATTGAAAACATCCTGGAAAGG + Intergenic
1109135895 13:58650135-58650157 ATAATTAAGATATTCTGGGAAGG + Intergenic
1109265712 13:60198005-60198027 ACATTGAAAACCTTCTGGAAAGG - Intergenic
1109603799 13:64665070-64665092 ACATTAAAAATAGAGTGGGATGG - Intergenic
1109735512 13:66479446-66479468 AAATTTAAAATCTTCTGGAAAGG + Intronic
1109868062 13:68292408-68292430 AGTTTTAAAATACTCTGGGAAGG - Intergenic
1109917298 13:69007089-69007111 AATTTGAAAATATTTTGGAAAGG + Intergenic
1110368413 13:74713908-74713930 AAATGGAAAACTTTCTGGGAAGG - Intergenic
1110500392 13:76220930-76220952 AAAATGTAAATATTCTGGAAGGG + Intergenic
1110640186 13:77814736-77814758 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1110724020 13:78798590-78798612 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1110735606 13:78932786-78932808 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1110737516 13:78954639-78954661 AAATTGAAAACTTTCTGGAAAGG - Intergenic
1111207090 13:85025279-85025301 ACTTTGAAAATGTTCTGATAAGG - Intergenic
1111233713 13:85379927-85379949 ACATTGAAAATATTTTGCTTAGG - Intergenic
1111546381 13:89742352-89742374 ACAATTATAATATTTTGGGAGGG - Intergenic
1111646652 13:91039820-91039842 ACATTGCAAATATCCTAGAAAGG - Intergenic
1111780103 13:92712590-92712612 AAATTGAAACTACTCTGTGAAGG + Intronic
1111787275 13:92805190-92805212 AAATAGAAAATCTTCTGGAAAGG - Intronic
1112367771 13:98770390-98770412 TCTTTGAAAATTTCCTGGGAAGG + Intergenic
1112543964 13:100346225-100346247 AAATTGAAAACTTTCTGGGAAGG + Intronic
1112622933 13:101070400-101070422 ATATTGAAAACCTTCTGGAAAGG - Intronic
1113314985 13:109169448-109169470 AGATTGAAAATTTTCTTGCAAGG + Intronic
1113695130 13:112340446-112340468 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1113722585 13:112571183-112571205 AAATTGAAAACCTTCTGGAAAGG - Intronic
1113980899 13:114274524-114274546 ACATAGAAAACTTTCTGGAAAGG - Intergenic
1114137697 14:19870694-19870716 AAATTTAAAAGTTTCTGGGATGG - Intergenic
1114370537 14:22082728-22082750 AAATTGAAAAGCTTCTGGAAAGG - Intergenic
1115043593 14:28961276-28961298 AAACTGAAAATCTTCTGGAAAGG - Intergenic
1115568267 14:34643796-34643818 AAATTGAAAACCTTCTGGAAGGG - Intergenic
1115897041 14:38102272-38102294 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1116408797 14:44599030-44599052 AAATTGAAAATATTGTGGCAGGG + Intergenic
1116592272 14:46793202-46793224 ACATTAAAAACTTTCTGGAAAGG - Intergenic
1117201769 14:53397360-53397382 AAATTGAAAATCTTCTGGAAAGG + Intergenic
1117519672 14:56538395-56538417 AAATTGAAAGTCTTCTGGGAAGG + Intronic
1118218013 14:63827894-63827916 AGATTGAAAATATTTGGGGCTGG + Intergenic
1118560513 14:67075561-67075583 AAATTGAAAACTTTCTGGAAAGG + Intronic
1118662520 14:68029748-68029770 AAATTGAAAACTTTCTGGGAAGG - Intronic
1119237322 14:73030557-73030579 ACATTAAAAAATTTCTGGGCCGG + Intergenic
1119289832 14:73486744-73486766 AAAGTGTAAATATACTGGGAAGG - Intronic
1119867895 14:77989442-77989464 ACATTGCAAATGCTGTGGGAGGG + Intergenic
1119921179 14:78447679-78447701 AGATTGCAACTATTCTGTGAAGG - Intronic
1120084582 14:80255801-80255823 ACATTGAAAATCTCCTAGAAAGG + Intronic
1120430727 14:84411328-84411350 AGATTGCAAATCTTCTGGAAAGG + Intergenic
1121252297 14:92508628-92508650 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1121461556 14:94083002-94083024 ATATTGAAAACCTTCTGGAAAGG + Intronic
1122110529 14:99497930-99497952 ACATTGAAAACATTATCTGATGG - Intronic
1122702845 14:103601855-103601877 GCAATGAAAATATTCTGGCCAGG + Intronic
1124036634 15:26059169-26059191 AAACTAAAAATCTTCTGGGAAGG + Intergenic
1124093440 15:26627448-26627470 AAACTGAAAACATTCTGGAAAGG + Intronic
1124388892 15:29235168-29235190 ACTTTGAAAAGATTCAGGTAGGG - Intronic
1124461124 15:29892997-29893019 AAATTAAAAATCTTCTGGAAAGG + Intronic
1124553786 15:30707592-30707614 AAATAGAAAATATCCTTGGAGGG + Intronic
1124560379 15:30768159-30768181 ACATTGAAAACCTTCTGGAAAGG - Intronic
1124670864 15:31637625-31637647 ACATTGAAAACCTTCTGGAAAGG + Intronic
1124677462 15:31698080-31698102 AAATAGAAAATATCCTTGGAGGG - Intronic
1125366732 15:38925465-38925487 AAATTGAAAACCTTCTGGAAGGG - Intergenic
1126103699 15:45134612-45134634 AACATGAAAATAATCTGGGAGGG + Intronic
1126179913 15:45775297-45775319 ACATTTAAAATATTGTGGAATGG + Intergenic
1126686614 15:51253684-51253706 ACAATGAAAATATCCCAGGAGGG - Intronic
1126777996 15:52115956-52115978 ACCTTGAAAATATTGTGCCAGGG - Exonic
1126828386 15:52573907-52573929 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1128189805 15:65681356-65681378 AAATTGAAAACCTTCTGGAAAGG - Intronic
1130129631 15:81128734-81128756 AAATTGAAAACTTTCTGGAAAGG - Intronic
1130301637 15:82683679-82683701 AAATTGAAAACCTTCTGGAAAGG - Intronic
1130949768 15:88576261-88576283 AGATTGAAAATAGTCTGTGATGG - Intergenic
1131756481 15:95568813-95568835 ACATTGAAAATCTTCTGAAATGG - Intergenic
1131897996 15:97054563-97054585 AGATTGAAATTCTTCTGGGAAGG + Intergenic
1132032314 15:98448381-98448403 ACACTGAAAACCTTCTGGAAAGG - Intronic
1132275840 15:100563252-100563274 ACATAAAAAATATTCAGCGAGGG - Intronic
1132634232 16:935384-935406 ACGTTGAAAACATTCTGGCTGGG - Intronic
1134528185 16:14960890-14960912 AGATTAAAAATTTTCTGGGCTGG - Intergenic
1134563892 16:15234368-15234390 ACTCTGAAACTAGTCTGGGAGGG + Intergenic
1134738602 16:16522324-16522346 ACTCTGAAACTAGTCTGGGAGGG - Intergenic
1134928898 16:18189832-18189854 ACTCTGAAACTAGTCTGGGAGGG + Intergenic
1135491435 16:22913038-22913060 TGATTCAAAATATTCAGGGAAGG - Intronic
1135506531 16:23042013-23042035 ACATTGAAAACCTTGTGGAAAGG - Intergenic
1135665685 16:24333954-24333976 ACATTGGAATTACTTTGGGAAGG - Intronic
1135819590 16:25671146-25671168 AAATTGAAAATCTTCTGGAAAGG + Intergenic
1136118801 16:28115203-28115225 AAACTGAAAACCTTCTGGGAAGG - Intronic
1137234035 16:46598214-46598236 CAATTGAAAAGTTTCTGGGAAGG - Intronic
1137500213 16:49005212-49005234 ACATGGAGAAAACTCTGGGAAGG - Intergenic
1137723966 16:50644782-50644804 ACACTGGAAATATTCTGGCCAGG - Intergenic
1137841376 16:51643816-51643838 ACTTTGAAAAGTTCCTGGGAGGG - Intergenic
1138073106 16:54013063-54013085 TAATTGAAAACCTTCTGGGAAGG + Intronic
1138750522 16:59414291-59414313 ACATTGAAAACCTTCTGGAAAGG - Intergenic
1138860959 16:60756508-60756530 ACTTTAAAAAAATTCTGTGAAGG + Intergenic
1139027140 16:62832670-62832692 ACAATTATAATATTCAGGGATGG + Intergenic
1139927562 16:70498917-70498939 ATAATGAAAATATTCTGGTCAGG + Intronic
1140028696 16:71316233-71316255 ACAGAGAATATATTCTAGGATGG + Intergenic
1140162449 16:72512178-72512200 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1140549019 16:75843615-75843637 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1140658022 16:77160128-77160150 ACATTGAAAGTATTCTGAGCAGG - Intergenic
1140872164 16:79116805-79116827 AAATTGAAAATCTTCTAGAAAGG - Intronic
1140961731 16:79919271-79919293 ACATTGCAAATGGCCTGGGAAGG - Intergenic
1141998733 16:87651439-87651461 CCATTGAAAACCTTCTGGAAAGG + Intronic
1146966077 17:37031154-37031176 AGATTGAAAATATTCAGGCATGG + Intronic
1147037591 17:37693326-37693348 ACATTGAATATTTTGTGAGATGG + Intronic
1147049528 17:37781558-37781580 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1148692439 17:49538162-49538184 AAATTGAAAGTCTTCTGGAAAGG - Intergenic
1149189759 17:54046454-54046476 ACATTTAAACTATTATAGGAAGG + Intergenic
1149390302 17:56183267-56183289 ACATTGACAAAATTCTGGAAAGG + Intronic
1149726272 17:58897652-58897674 ACGTTGAAAACTTTCTGGAAAGG + Intronic
1149730463 17:58941005-58941027 ACATTAAAAATGATCTGGGCCGG - Intronic
1149946388 17:60932189-60932211 ACATTGAAAAGATACTCTGATGG - Intronic
1150014632 17:61541785-61541807 ACATTGAAAACTTTCGGGAAAGG + Intergenic
1150460127 17:65343750-65343772 TCATTAAAAATCTCCTGGGAAGG + Intergenic
1150509255 17:65732036-65732058 AAATTGAAAACTTTCTGGAAAGG - Intronic
1150747778 17:67830098-67830120 ACATTGCCAATATACTGAGAAGG + Intronic
1151027518 17:70696098-70696120 AAATTGAAAATCTTCTGGAAAGG + Intergenic
1151377542 17:73700806-73700828 TCATTGAAAACCTTCTGGAAAGG - Intergenic
1151949109 17:77339233-77339255 AAATTGAAAACCTTCTGGAAAGG - Intronic
1153181481 18:2439940-2439962 CCATTGAAAACCTTCTGGAAAGG - Intergenic
1153375438 18:4372096-4372118 ACATAGAAAATGTTCTAAGATGG + Intronic
1153566318 18:6421539-6421561 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1154227739 18:12523036-12523058 ACATTGAAAACCTTCTGGAAAGG + Intronic
1154491366 18:14924817-14924839 ACCTTGAAATGACTCTGGGAAGG + Intergenic
1155406522 18:25494256-25494278 ACATTGAAAACCTCCTGGAAAGG + Intergenic
1155463742 18:26113137-26113159 ACTTTGAAAATGTTGTGGGCTGG + Intergenic
1155536802 18:26827156-26827178 ACATAGAAAATATTTTACGATGG - Intergenic
1155735496 18:29217672-29217694 ACTGAGAAAATGTTCTGGGAGGG - Intergenic
1155793200 18:29999065-29999087 AGATTGAAGATATTCTGGTTAGG + Intergenic
1156126420 18:33910839-33910861 ACATGGAAAATATTCCAAGAGGG - Intronic
1156255596 18:35392874-35392896 ACCTTGAAAACATTATGGTAAGG - Intergenic
1156444772 18:37227895-37227917 AAATTGAAAACCTTCTGGAAAGG + Intronic
1156575550 18:38311305-38311327 TCATTGAAAATATTCTGACAAGG + Intergenic
1156631640 18:38976257-38976279 ACATAACAAATTTTCTGGGAAGG + Intergenic
1156875874 18:42010778-42010800 AAATTGAAAAGCTTCTGGAAAGG - Intronic
1157371753 18:47119723-47119745 AAATTGAAAACCTTCTGGAAAGG - Intronic
1158369930 18:56789290-56789312 AAAATGAAAGTATTCTTGGATGG + Intronic
1158399570 18:57109723-57109745 GAATTGAAAATTTTCTGGAAGGG - Intergenic
1158816573 18:61104841-61104863 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1160513018 18:79463095-79463117 ACTTGGAAAAGGTTCTGGGAAGG - Intronic
1160830102 19:1100210-1100232 ACAATGAAAATACTCTGTGCTGG + Intergenic
1161799382 19:6407825-6407847 ACAAGGAAAAAATTCTGGGCTGG + Intergenic
1161836209 19:6648698-6648720 ACATTCAAAATATTCAAGGGGGG + Intergenic
1162101174 19:8340047-8340069 ACATGGAAAACCTTCAGGGAGGG + Intronic
1163254918 19:16149982-16150004 AAATTGAGAAAATTCTGTGAAGG + Intronic
1164001473 19:21104140-21104162 ACTTTGAAAATATTATGTCATGG - Intronic
1164490112 19:28702749-28702771 CAATTGAAAACCTTCTGGGAAGG - Intergenic
1164758697 19:30710549-30710571 ACAACAAAAATATTCAGGGATGG + Intronic
1164901106 19:31924806-31924828 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1165115781 19:33527831-33527853 ACACTGGAAATAAGCTGGGATGG - Intergenic
1166259935 19:41631391-41631413 ACATTGATATTATCCTGGAAAGG + Intronic
1167816315 19:51884113-51884135 ACACTGAAAATGGTCTAGGATGG + Intronic
925200359 2:1962985-1963007 AAATTGAAAATCTTATGGGAAGG - Intronic
925712627 2:6756840-6756862 ACATTTAAAATTTTGTGGAAGGG - Intergenic
926450064 2:12992391-12992413 AAATTGAAAACCTTCTGGAAAGG + Intergenic
926467686 2:13211826-13211848 AAATTGAAAACCTTCTGGAAAGG + Intergenic
926668099 2:15547142-15547164 ACATTTAAAACATTCTCGAATGG + Intronic
926895295 2:17680444-17680466 AAATTGAAAACCTTCTGGAAAGG - Intronic
927324529 2:21788754-21788776 AAACTGAAAACCTTCTGGGAAGG - Intergenic
927396537 2:22657466-22657488 AAATTGAAAACCTTCTGGAAAGG + Intergenic
927659199 2:24978337-24978359 ACACTTAATATATTCTGGAAAGG + Intergenic
928586580 2:32765105-32765127 AAATTGAAAATCTTCTGGAAAGG - Intronic
928745565 2:34410466-34410488 AAATTAAAAATATTTTGGGCTGG + Intergenic
929487733 2:42369931-42369953 TGATTGCAAATATTGTGGGAAGG + Intronic
929672960 2:43892881-43892903 AAACTGAAAACCTTCTGGGAAGG + Intronic
929677694 2:43953694-43953716 ACATTGAAAATATTCGAAAATGG - Intronic
929708733 2:44244100-44244122 ACATTTAAAATATACTGAGGAGG - Intronic
929973568 2:46608523-46608545 AAATTGAAAACCTTCTGGAAAGG - Intronic
930185475 2:48408476-48408498 ACAATGAAAATATCATGGTAGGG + Intergenic
930226879 2:48803073-48803095 TGATTGAAAATAATTTGGGAGGG - Intergenic
930351295 2:50258663-50258685 ACATTGAAAACCTTCTGGAAAGG - Intronic
930941488 2:57019477-57019499 ACTTTGAAAATATTTTGAGTGGG - Intergenic
931105346 2:59049184-59049206 ACTGTGAAAAAGTTCTGGGATGG - Intergenic
931462753 2:62462685-62462707 TTATTGAAAGTATTCAGGGAAGG - Intergenic
931683770 2:64774994-64775016 AAATTGAAAACCTTCTGGAAAGG - Intergenic
931807766 2:65824260-65824282 ATATTGAACATCTTCTGGGCAGG + Intergenic
931955649 2:67421117-67421139 AAATTGAAAATCTTCTGGAAAGG + Intergenic
932186021 2:69696569-69696591 AAATTGAAAACCTTCTGGAAAGG - Intronic
932316262 2:70785843-70785865 GCATTAAAAATATTATGGCATGG + Intronic
932328689 2:70883568-70883590 ACCTTGAAAACATTATGGTAAGG + Intergenic
932469812 2:71946937-71946959 AAATTGAAAACCTTCTGGAAAGG - Intergenic
932507938 2:72254678-72254700 AGATTGAAGATATTCTTGGTAGG + Intronic
932997908 2:76879741-76879763 AAATTGAAAACCTTCTGGGAAGG + Intronic
933511759 2:83249070-83249092 ATATTAAAAATAATCTGGGCCGG + Intergenic
933906356 2:86897672-86897694 CCATTGAAAACCTTCTGGGCCGG + Intergenic
934061741 2:88300988-88301010 AAATTGAAAACCTTCTGGAAAGG + Intergenic
935168773 2:100593107-100593129 AAATTGAAAACTTTCTGGAAAGG - Intergenic
935212275 2:100948335-100948357 ACATTTTAAGTATTCTGGGGAGG - Exonic
935409839 2:102750294-102750316 ACAATGATAAAGTTCTGGGAAGG - Intronic
935460279 2:103323235-103323257 AAATTGAAAACCTTCTGGAAAGG + Intergenic
935776191 2:106474085-106474107 CCATTGAAAACCTTCTGGGCCGG - Intergenic
936551660 2:113448048-113448070 AAATTGAAAACCTTCTGGAAAGG - Intronic
937874352 2:126809969-126809991 AAATAGAAAATGTTCTGGGAAGG + Intergenic
937947794 2:127356245-127356267 AAATTGAAAACCTTCTGGAAAGG - Intronic
937950583 2:127384401-127384423 AAATTGAAAACCTTCTGGAAAGG + Intronic
938022312 2:127916080-127916102 AAATTGAAAACCTTCTGGAAAGG - Intergenic
938621410 2:133058364-133058386 AAATTGAAAACCTTCTGGAAAGG + Intronic
939132095 2:138248118-138248140 AAACTGAAAATCTTCTGGGAAGG - Intergenic
939151566 2:138479145-138479167 ACAGTGAATATATTCTGGTTGGG + Intergenic
939379041 2:141410725-141410747 ACATGGAAAATATTCTGTTTGGG - Intronic
940252646 2:151696436-151696458 ACAGTGAAACAATTCTGTGAAGG - Intronic
940399948 2:153236890-153236912 AAATTGAAAACTTTCTGGAAAGG + Intergenic
940727978 2:157357160-157357182 AAATTGCATTTATTCTGGGAAGG - Intergenic
940733841 2:157426789-157426811 CCATTGAAAATTCCCTGGGATGG - Intronic
941238335 2:163004129-163004151 AAATTGAAAACTTTCTGGAAAGG + Intergenic
941386814 2:164862998-164863020 ACATTGATAGTATTTAGGGAAGG - Intergenic
941503668 2:166312564-166312586 AAATTGAAAATCTTCTGGAAAGG - Intronic
941801775 2:169667472-169667494 AAATTGAAAACCTTCTGGAAAGG - Intronic
942051049 2:172141311-172141333 AAATTGAAAACTTTCTGGAAAGG + Intergenic
942526627 2:176860125-176860147 ACATATATAATATTCTAGGAGGG + Intergenic
942877060 2:180813469-180813491 ATATTGAAAACCTTCTGGAAAGG + Intergenic
943123353 2:183765555-183765577 ACATTGAAAACCTTCTGGAATGG - Intergenic
943330815 2:186556808-186556830 AAATTGAAAACCTTCTGGAAAGG - Intergenic
943531755 2:189091022-189091044 AAATTGAGAATCTTCTGGAAAGG + Intronic
944058929 2:195551560-195551582 ATATTGAAAACCTTCTGGGAAGG - Intergenic
944148599 2:196532939-196532961 ACACTGAAAATATTTGGGGAAGG + Intronic
945575192 2:211522150-211522172 AAATTGAAAATCTTCTGAAAAGG + Intronic
946575315 2:221069501-221069523 AAATTGAAAACCTTCTGGAAAGG + Intergenic
946886920 2:224230507-224230529 ACAGTGAAAATTTTGGGGGATGG - Intergenic
946893692 2:224301873-224301895 ACAGTGAAAATTTTGGGGGATGG - Intergenic
946901372 2:224375531-224375553 AAATTGAAAACCTTCTGGAAGGG + Intergenic
947203715 2:227640781-227640803 ACTTTAAAAATATTCTTGGGAGG + Intergenic
947567867 2:231206564-231206586 ACATAGAAAAAAGTCTGGGAGGG - Intronic
947584091 2:231341579-231341601 ACATAGAAAATAATCTGAAAGGG - Intronic
947754074 2:232548753-232548775 AAATTGAAAACCTTCTGGAAAGG - Exonic
949006784 2:241654124-241654146 ACTTTTAAAAGATTCTGGGCTGG + Intronic
1169515167 20:6309180-6309202 TCATTAGAAATATTCAGGGATGG - Intergenic
1169653975 20:7901770-7901792 AAATTGAAAACTTTCTGGAAAGG + Intronic
1170280502 20:14641458-14641480 ACACTGAAAACCTTCTGGAAAGG - Intronic
1170317030 20:15053808-15053830 ACATTGAAAACCTTCTGGAAAGG + Intronic
1170667498 20:18399528-18399550 ACATTTAAAATATTGTGTAAGGG - Intronic
1170904468 20:20500723-20500745 CCATTGAAAACCTTCTGGAATGG - Intronic
1170964805 20:21058214-21058236 TCATTGACCATATTCTGGGAAGG - Intergenic
1171323723 20:24271405-24271427 AGATTGAAAACCTTCTAGGAAGG - Intergenic
1173313267 20:41919696-41919718 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1173489946 20:43471713-43471735 ACTTTGAAAATATTTTAGGCCGG + Intergenic
1174129939 20:48336698-48336720 ACATAAAAAACATTCTGGGATGG - Intergenic
1175702038 20:61146545-61146567 ATATTAAAAATATTGTGGTATGG - Intergenic
1175813919 20:61873826-61873848 ATGGTGAACATATTCTGGGACGG - Exonic
1177044123 21:16148188-16148210 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1177447943 21:21222390-21222412 AAATTGAAAACTTTCTGGAAAGG + Intronic
1177770523 21:25509927-25509949 ACAGTTAAAAGATTCTGAGAAGG + Intergenic
1178574665 21:33774898-33774920 ACTTTGAAAATATACTAAGATGG + Intronic
1178842372 21:36148065-36148087 ACCTCGTAAACATTCTGGGAAGG - Intergenic
1178967615 21:37137300-37137322 AAATTGAAAACCTTCTGGAAAGG + Intronic
1179068343 21:38047907-38047929 ACATTGGAGATCCTCTGGGAGGG - Intronic
1180899966 22:19363600-19363622 GCATTGAAACTATTCTGGCTGGG + Intronic
1182336306 22:29585715-29585737 GCAAGGAAAAGATTCTGGGATGG - Intergenic
1182605308 22:31498372-31498394 AAATTGAAAATGTTCTGGAAAGG + Intronic
1182820606 22:33212678-33212700 AAATTGAAAATCTTCTGGAAAGG + Intronic
1183008352 22:34923090-34923112 AAATTGAAAATTTTCTGGAAAGG - Intergenic
1183349975 22:37329661-37329683 ACAGTGAGAATATTGTTGGAGGG + Intergenic
1185003970 22:48264459-48264481 ACATAGGAAATATTGTGGGTTGG - Intergenic
949813355 3:8032274-8032296 AAATTGAAAACCTTCTGGAAAGG - Intergenic
950051820 3:9997363-9997385 ACCTTGAAAATATGCTGGCTGGG - Intronic
950817953 3:15727238-15727260 AAATTGAAAACCTTCTGGAAAGG + Intronic
952660197 3:35836677-35836699 AACTTGAAAATATTCTAGAAAGG - Intergenic
952681179 3:36095090-36095112 ACACTGAAAATTTGCTAGGAAGG + Intergenic
953836606 3:46351608-46351630 AGAATGAAAATATTTTTGGAGGG - Intergenic
954503184 3:51041081-51041103 AAATTGAAAATCTTCTAGAAAGG - Intronic
954920077 3:54183080-54183102 ACATGAAAAATATTTTGGGGGGG - Intronic
955211337 3:56944265-56944287 AAATTGAAAATCTTCTGTAAAGG + Intronic
955296649 3:57741624-57741646 ACACTTAAAATATTTTGGGCTGG + Intergenic
955362089 3:58284311-58284333 CTATTGAAAAGATTCTGGGGAGG - Intronic
955385445 3:58475642-58475664 ACATTTAAAATATTCTTAAAAGG - Intergenic
955418235 3:58712536-58712558 ACACTGAAAACACTCAGGGAAGG - Intergenic
955459813 3:59169771-59169793 AAATTGAAAATCTTCTGGAAAGG + Intergenic
956960770 3:74397730-74397752 AAATTGAAAACCTTCTGGGAAGG + Intronic
957115705 3:76022372-76022394 AAATTGAAAATCTTCTGGAAAGG - Intronic
957157761 3:76567522-76567544 ACACTGAAAATATCCAGGAAGGG + Intronic
957536833 3:81516645-81516667 AAATTGAAAATCTTCTGGAAAGG + Intronic
957783002 3:84844044-84844066 AAATTGAAAACCTTCTGGAAAGG + Intergenic
957891708 3:86367318-86367340 ACAATGAGAATATTCTTTGAAGG + Intergenic
957955630 3:87183441-87183463 AAATTGAAAACTTTCTGGAAAGG - Intergenic
958020247 3:87985749-87985771 ATATTGTAAATAGCCTGGGATGG - Intergenic
958096133 3:88947563-88947585 AAATTGGAAATCTTCTGGAAAGG + Intergenic
958718200 3:97812953-97812975 CCATTGAAAATCTTCTGGAAAGG - Intergenic
958885337 3:99720331-99720353 AGATGGAAAATTTTCAGGGAAGG + Intronic
959261988 3:104094130-104094152 ACATTTCAAATATTTTAGGAAGG + Intergenic
959282657 3:104364553-104364575 ACAATCAAGATATTCTGAGATGG + Intergenic
959515625 3:107263701-107263723 ACACTGAAATTCTTCTGGGTCGG - Intergenic
959600230 3:108174091-108174113 AAATTTAGAATATTCTGGAATGG - Intronic
960009447 3:112817535-112817557 AACTAGAAAATATTCTGAGAAGG + Intronic
960035567 3:113099311-113099333 AAATTGAAAACATTCTGGAAAGG - Intergenic
960230026 3:115215169-115215191 ACATTGAAAACCTTCTGGGAAGG + Intergenic
960242178 3:115357729-115357751 AAATTGAAAACTTTCTGAGAAGG - Intergenic
960258768 3:115540832-115540854 AAATTGAAAATATTCTGGAAAGG - Intergenic
960549182 3:118954583-118954605 CCACTGAAAATCTTCTGGAAAGG - Intronic
961613245 3:128157939-128157961 AAATTGAAAACCTTCTGGAAAGG + Intronic
962033614 3:131627593-131627615 AAATTGAAAATAGTTTGGAAAGG + Intronic
962088389 3:132216639-132216661 AAAGTGAAAATATATTGGGAAGG - Intronic
962116069 3:132509136-132509158 AAATTGAAAACCTTCTGGAAAGG + Intronic
962544112 3:136414663-136414685 AAATTGAGAAACTTCTGGGAAGG - Intronic
962686105 3:137849206-137849228 GTATTGAAAAGATCCTGGGATGG - Intergenic
963054109 3:141170370-141170392 AAATTGAAAACCTTCTGGAAAGG + Intergenic
963608718 3:147438049-147438071 AAATTGAAAACCTTCTGGAAAGG - Intronic
964469217 3:157034291-157034313 AAATTCAAAACCTTCTGGGAAGG + Intronic
964599221 3:158476858-158476880 AAATTGAAAACCTTCTGGAAAGG + Intronic
964813673 3:160693732-160693754 ACATTGAAAAGCTTCTGGAAAGG + Intergenic
964823429 3:160798841-160798863 ACATTGAAAAACTTCTGGAAAGG + Intronic
964942239 3:162173226-162173248 ACAATGAAAATCTTCTAGAAAGG + Intergenic
965066988 3:163862547-163862569 ACATTTAAAATCTTCTGGAAAGG + Intergenic
965104829 3:164342645-164342667 ACATTGAAAATTTTTGGGGGTGG + Intergenic
965363364 3:167767570-167767592 AAATTGAAATTTTTCTGGAAAGG + Intronic
965458878 3:168936457-168936479 AAATTGAAAACCTTCTGGAAAGG - Intergenic
965886620 3:173453887-173453909 AAATTGAAAACCTTCTGGAAAGG - Intronic
965953117 3:174334872-174334894 GCATTGAAGATATTCAAGGAGGG - Intergenic
965960650 3:174424985-174425007 TCATGGAGAAAATTCTGGGAGGG - Intergenic
966024062 3:175253651-175253673 ACATAGAAAACTTTCTGGAAAGG + Intronic
966503493 3:180672817-180672839 AAATTGAAAACCTTCTGGAAAGG + Intronic
966995637 3:185277571-185277593 AAATTGAAAACTTTCTGGAAAGG - Intronic
967077426 3:186016349-186016371 AAATTGAAAACCTTCTGGAAAGG - Intergenic
967510807 3:190309327-190309349 ACACTGTAAATCTTATGGGATGG + Intronic
967603737 3:191419260-191419282 AAATTGAAAAACTTCTGGAAGGG + Intergenic
967710694 3:192704121-192704143 AAATTGAACATCTTCTGGAAAGG - Intronic
968153775 3:196361017-196361039 AAACTGAAAATCTTCTGGAAAGG + Intronic
968539598 4:1157940-1157962 AAATTGAAAACCTTCTGGAAAGG - Intergenic
969095259 4:4728069-4728091 AATTTGAAAAAATTATGGGAAGG - Intergenic
969167252 4:5327329-5327351 AAATTGAAAATCTTCTGGAAAGG - Intronic
969217978 4:5737964-5737986 AAATTGAAAACCTTCTGGAAAGG + Intronic
970189490 4:13499572-13499594 ACATGGAGAATAACCTGGGAAGG + Intergenic
970332157 4:14998004-14998026 AAATTGAAAACCTTCTGGAAGGG + Intergenic
970390318 4:15603162-15603184 AAATTGAAAATATTCTGGAAAGG - Intergenic
970724640 4:19029306-19029328 AGGTTGAAAATATTTTGGAAAGG + Intergenic
970884518 4:20972267-20972289 AAATTGAAAACTTTCTGGAAAGG - Intronic
970895586 4:21099712-21099734 AAACTGAAAATCTTCTGGAAAGG + Intronic
970944972 4:21680511-21680533 AAATTGAAAACCTTCTGGAAAGG - Intronic
971708973 4:30086867-30086889 AAATTGAAAATGTTTTGGAAAGG - Intergenic
971881224 4:32376187-32376209 AAATTGAAAATCTTCTGGAAAGG - Intergenic
972023000 4:34338569-34338591 GTATTGAAAAGTTTCTGGGAAGG + Intergenic
972189249 4:36569930-36569952 AAATTAAAAATCTTCTGGAAAGG - Intergenic
972356713 4:38286032-38286054 ATATAGAAAATAATCTGGAAGGG - Intergenic
972383564 4:38541872-38541894 AAATTAAAAATCTTCTGGAAAGG - Intergenic
972466783 4:39365318-39365340 ACAGTGACAACATTCTGGGGGGG - Intronic
972768862 4:42177056-42177078 AAATTGAAAACCTTCTGGAAAGG - Intergenic
972889032 4:43531934-43531956 ACATTAAAAAAATTCTGGTAGGG - Intergenic
972988231 4:44792061-44792083 ATACTGAAAAAATGCTGGGAAGG + Intergenic
973165050 4:47066873-47066895 AAATTGAAAACCTTCTGGAAAGG - Intronic
973233779 4:47873325-47873347 AAATTGAAAACGTTCTGGAAAGG - Intronic
973235202 4:47894850-47894872 AAATTGAAAACCTTCTGGAAAGG - Intronic
973658286 4:53074477-53074499 ACATTGCAAACCTTCTGGAAAGG - Intronic
973697323 4:53503269-53503291 AAATTGAAAACCTTCTGGAAAGG - Intronic
973719551 4:53709300-53709322 ACATTGCAAAGATTCTCTGATGG - Intronic
974423156 4:61705120-61705142 AAATTGAAAACCTTCTGGAAAGG - Intronic
974531345 4:63111455-63111477 ACATTGAAAACCTTCTGGAAGGG + Intergenic
975133846 4:70855003-70855025 ACATTGAAAACCTTCTGGAAAGG + Intergenic
975323090 4:73030515-73030537 ACATTGAAACCCTTCTGGAAAGG + Intergenic
975475410 4:74817499-74817521 AAATTGAAAACCTTCTGGAAAGG - Intergenic
975821013 4:78270501-78270523 GTATTGAAAAAATTGTGGGAGGG - Intronic
975900297 4:79143471-79143493 AAATTGAAAACCTTCTGGAAAGG - Intergenic
976078504 4:81326909-81326931 AAATTGAAAATAAACAGGGAGGG + Intergenic
976835394 4:89367002-89367024 ACATTGAAAACCTTCGGGAAAGG + Intergenic
976991671 4:91375070-91375092 AAATTGAAAACCTTCTGGAAAGG + Intronic
977024744 4:91803290-91803312 ACATTGAAAACCATCTGGAAGGG + Intergenic
977111626 4:92963745-92963767 AAATTGAAAATATTCTGGAAAGG - Intronic
977808345 4:101330067-101330089 ACATTGAAAACCTTCTGGAAAGG + Intronic
977996325 4:103500816-103500838 TCATTGAATATATTTTTGGAGGG + Intergenic
978134333 4:105238819-105238841 ACATTGAAAGCCTTCTGGAAAGG - Intronic
978458049 4:108917332-108917354 GGATTTAAAATACTCTGGGAAGG + Intronic
978530294 4:109705550-109705572 AAATTGAAAATCTTCTGGAAAGG + Intergenic
978810316 4:112842304-112842326 ACATTGAAAATAATTTGGGCCGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979448921 4:120845790-120845812 AAATTGAAAACCTTCTGGAAAGG + Intronic
979800379 4:124900622-124900644 ACATTTCAAATATTGTGAGAAGG - Intergenic
980187793 4:129483761-129483783 AAATTGAAAACCTTCTGGAAAGG - Intergenic
980546667 4:134272429-134272451 AAATTGAAAACCTTCTGGAAGGG + Intergenic
980730495 4:136817686-136817708 ACATTGGAAATTTGCTGGGAAGG + Intergenic
980952783 4:139397887-139397909 AAATTGAAAACTTTCTGGAAAGG - Intronic
981040662 4:140218714-140218736 ACAGTGAAAATTTTGGGGGATGG - Intergenic
981412335 4:144447444-144447466 CTATTGAAAACATTCTGGAAAGG - Intergenic
981658773 4:147142118-147142140 ACATTAAAAATCTTCTGGGAAGG + Intergenic
982152861 4:152481569-152481591 AAATTGAAAGCCTTCTGGGAAGG + Intronic
982247746 4:153370853-153370875 AAATTGAAAACCTTCTGGGAAGG - Intronic
982299596 4:153865557-153865579 AGCTTTAAAATATTTTGGGAGGG + Intergenic
982344548 4:154342849-154342871 ACATTGAAAACTTTCTGGAAAGG - Intronic
982520561 4:156411509-156411531 AAATTGAAAACCATCTGGGAAGG - Intergenic
982552449 4:156819829-156819851 AAACTGAAAATCTTCTGGAAAGG + Intronic
982575794 4:157108324-157108346 ACATTGAAAACCTTCTGGAAAGG + Intronic
983154869 4:164334763-164334785 AAATTGAAAACTTTCTGGAAAGG + Intronic
983701874 4:170606867-170606889 AAATTGAAAATCTTCTGGAAAGG - Intergenic
983764342 4:171458743-171458765 AAATTGAAAACTTTCTGGAAAGG - Intergenic
985188136 4:187340289-187340311 AAATTGAAAACCTTCTGGAAAGG - Intergenic
986380878 5:7184337-7184359 AGATTGAAAATGTTCTGGCCAGG - Intergenic
986485756 5:8235058-8235080 ACATTAAATAACTTCTGGGAAGG - Intergenic
986500983 5:8399984-8400006 ATATTTAAAATATTTTTGGAAGG + Intergenic
986535542 5:8783165-8783187 TCATTGAAAATAATGTGGGCAGG - Intergenic
986617418 5:9632943-9632965 AAATTGAAAACTTTCTGGAAAGG - Intronic
986629081 5:9751988-9752010 ACATAGAAAGCAATCTGGGAAGG + Intergenic
987329044 5:16839200-16839222 ACATTGAAAACCTTCTGGAAAGG + Intronic
987449784 5:18068380-18068402 AATATGAAAATATTCTGTGATGG - Intergenic
987454603 5:18128062-18128084 AAGTTGAAAATATTCTGGAGAGG - Intergenic
988209282 5:28182291-28182313 ATATTGAAAATATGCTGCTAAGG + Intergenic
988596982 5:32604035-32604057 ACATTTAAAATATTCACAGATGG - Exonic
988669680 5:33367682-33367704 AAATTGAAAACCTTCTGGAAGGG - Intergenic
989324596 5:40177016-40177038 AAATTGAAAACCTTCTGTGAAGG - Intergenic
989654020 5:43724723-43724745 CAATTGAAAAGCTTCTGGGAAGG - Intergenic
989666242 5:43857707-43857729 ACAAAGAATATAATCTGGGAAGG + Intergenic
990365133 5:55062786-55062808 ACATTTAAAATACTCTAGGCTGG + Intergenic
990572249 5:57090634-57090656 AAATTGAAAATCTGCTGGAAAGG + Intergenic
990804883 5:59648962-59648984 GCATTGAGAATGTTCTGAGATGG + Intronic
990973972 5:61541241-61541263 AGATTCAAAATATCCAGGGACGG - Intronic
991212820 5:64126228-64126250 AAATTCAAAAAATTCTAGGAAGG - Intergenic
991228716 5:64304375-64304397 ACATGGAAAACCTTCTGGAAAGG + Intronic
991257378 5:64629930-64629952 CCATTGTTAATATTCTTGGAGGG + Intergenic
991328442 5:65464224-65464246 GCATTTAAAATATTCTGAGGAGG - Intronic
991359657 5:65806326-65806348 ACATTGACAACCTTCTGGAAAGG + Intronic
991428237 5:66514506-66514528 ACATTGAAAACCTTTTGGAAAGG - Intergenic
991602349 5:68366322-68366344 TCTTTAAAAATATTCTGGGCTGG + Intergenic
992074651 5:73180197-73180219 AAATTGAAAACCTTCTGGAAAGG + Intergenic
992730484 5:79662391-79662413 ACATTGAAAGCTTTCTGGAAAGG - Intronic
992837118 5:80652506-80652528 ACATAGTAAAGATTCTGGGGAGG + Intronic
993082219 5:83315978-83316000 AAATTGAAAATGTTCTGGAAAGG + Intronic
993126463 5:83842095-83842117 TAATTGAAAATCTTCTGGAAAGG + Intergenic
993246952 5:85463590-85463612 ACATTTAAGATTTTCTGAGAGGG - Intergenic
994431213 5:99663666-99663688 ATATTGAAAACATTCTGGAAGGG - Intergenic
994516861 5:100783223-100783245 AAATTGAAAACTTTCTGGAAAGG - Intergenic
994760904 5:103852594-103852616 AAATTGAAAACCTTCTGGAAAGG - Intergenic
995215897 5:109594066-109594088 GCATTGAAAAAATACTGGAATGG - Intergenic
995632037 5:114144773-114144795 ACAGTGTATATATTTTGGGATGG + Intergenic
995658724 5:114456617-114456639 AAATTGAAAACCTTCTGGAAAGG + Intronic
995678412 5:114689593-114689615 AAATTGAAAACATCCTGGAAAGG - Intergenic
995802215 5:116009505-116009527 AAATTGAAAATCTTCTGGTAGGG + Intronic
995887044 5:116907069-116907091 AAATTGAAAATCTTTTGGAAAGG + Intergenic
996007965 5:118446265-118446287 ACATTGTAATTATGCTGGGGTGG - Intergenic
996067416 5:119094668-119094690 AAATTGAAAACCTTCTGGAAAGG + Intronic
996195267 5:120598352-120598374 CCATTGAAAATGTTTTGGTATGG + Intronic
996843738 5:127876972-127876994 AAATGGATAATATTCTGTGACGG - Intergenic
996947421 5:129087255-129087277 ACTCTGAAAATATTCTGCAAAGG - Intergenic
997018118 5:129962089-129962111 ATAATGAAAATTTTCTGAGAGGG - Intronic
997121142 5:131174474-131174496 AAATTGAAAACCTCCTGGGAAGG - Intronic
998609181 5:143669346-143669368 AGAGTGAAAATATTCTGTCAAGG - Intergenic
998719268 5:144925519-144925541 ACTTTGAAAACCTTCTGGAAAGG + Intergenic
999035891 5:148349255-148349277 ACATTGTAAAAATTCTAGGAGGG + Intergenic
999897378 5:156049679-156049701 ACATTGAAAACCTTCTGGAATGG + Intronic
1000195793 5:158956650-158956672 ATATTGAAAATATTATAGAAAGG + Intronic
1000586621 5:163107671-163107693 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1000758324 5:165188486-165188508 AAATTGGAAATATTCGGGAAGGG + Intergenic
1000863306 5:166482859-166482881 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1001360421 5:171079010-171079032 AAATTGAAAACCTTCTGGAAAGG + Intronic
1001369658 5:171185848-171185870 AAATTGAAAACCTTCTGGAAAGG - Intronic
1001864350 5:175090435-175090457 AAATTAAAAAAATTGTGGGAAGG + Intergenic
1003598670 6:7498162-7498184 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1003996087 6:11540712-11540734 AAATTGAAAACCTTCTGGAAAGG - Intronic
1004569179 6:16828680-16828702 ATATTGAAAACCTTCTGGAAAGG - Intergenic
1004837462 6:19544332-19544354 ACAGTGAAAATTTTTGGGGATGG - Intergenic
1004857312 6:19764695-19764717 ACATGGAAAACCTTCTGGAAAGG + Intergenic
1005246893 6:23896483-23896505 AAACTGAAAATATTCTGGAAAGG + Intergenic
1005282489 6:24289087-24289109 ACATTACAAATCTTTTGGGATGG - Intronic
1005579036 6:27216256-27216278 ACCTTGAAAATATTATGCTAAGG + Intergenic
1005703177 6:28424930-28424952 ACATTGAAAACCTTCTGGAGAGG - Intergenic
1006778235 6:36613195-36613217 AAATTGAAAATCTTTTGGAAAGG + Intergenic
1006928240 6:37671163-37671185 ACAGTGAAAATCGTCTGTGATGG - Intronic
1007932624 6:45706172-45706194 ACATTGCAAATATTCTTGAGGGG - Intergenic
1008125911 6:47668228-47668250 AAATTGAAAACCTTCTGGAAAGG + Intronic
1008319511 6:50090964-50090986 AAAATGAAAACCTTCTGGGAAGG + Intergenic
1008939990 6:57036672-57036694 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1009241375 6:61189852-61189874 ACATTTAAAACCTTCTGGAAAGG + Intergenic
1009306726 6:62100008-62100030 AAATTGAAAACCTTCTGGAAAGG + Intronic
1009509564 6:64532411-64532433 ACATTTAAAATATTCTAGGCCGG + Intronic
1009567645 6:65331782-65331804 ACATTGAAAACATTTTGATAAGG - Intronic
1009647744 6:66428345-66428367 AAATGGAAAACATTCTGGAAAGG + Intergenic
1009825523 6:68861276-68861298 CTAATTAAAATATTCTGGGAGGG + Intronic
1009903302 6:69836417-69836439 ACAATGAGAATATTCAGGAAAGG - Intergenic
1010050145 6:71494249-71494271 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1010288929 6:74113222-74113244 AAACTGAAAACATTCTGGAAAGG + Intergenic
1010415131 6:75602860-75602882 ACATTTAAAAAATTTTGGGGTGG + Intronic
1010697415 6:78993921-78993943 ACATTGAAAACCTTCTAGAAAGG + Intronic
1010713158 6:79198697-79198719 ACATTTAAGATTTTATGGGATGG + Intergenic
1010724497 6:79317776-79317798 ACATTGAAAACCTCCTGGAAAGG - Intergenic
1010796221 6:80119682-80119704 AAATTGAAAATCTTCTGGGAAGG - Intronic
1011069728 6:83366908-83366930 AAATTGAAAACCTTCTGGAAAGG - Intronic
1011871970 6:91906656-91906678 AAATTGAAAAATTTCTGAGAAGG - Intergenic
1012018135 6:93879439-93879461 AGATTGAAAAGATTCTTGGTGGG + Intergenic
1012119330 6:95344507-95344529 AAATTGAAAATCTTTTGGAAAGG - Intergenic
1012287562 6:97411138-97411160 AAATTTAAAACATTCTGGAAAGG - Intergenic
1012739865 6:103002787-103002809 AGATTGCAAAAATTCTGGAAAGG + Intergenic
1012918643 6:105198216-105198238 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1013030965 6:106332534-106332556 AAATTGAAAATATTCCGGAAAGG + Intergenic
1013172783 6:107652196-107652218 ACATTGAAAATCTTCTGGAAAGG + Intronic
1013202931 6:107918788-107918810 AAATTGAAAACCTTCTGGAAAGG + Intronic
1013381976 6:109582320-109582342 AAATTGAAAACCTTCTGGAAAGG + Intronic
1013729686 6:113150010-113150032 AAACTGAAAATTTTCTGGAAAGG - Intergenic
1013902355 6:115172535-115172557 ACAGTGAAAATATCCTTTGAAGG + Intergenic
1014034965 6:116756147-116756169 AAATTGAAAACCTTCTGGAAAGG + Intronic
1014080806 6:117283859-117283881 TTATTAAAAATATTTTGGGAGGG - Intergenic
1014155344 6:118103092-118103114 ATATTGAACATATTCTTGGGAGG - Intronic
1014249473 6:119100658-119100680 ACATTAAAAATACTCTAGGCTGG + Intronic
1014419329 6:121221498-121221520 AAATTGAAAACCTTCTGGAAAGG + Intronic
1014590693 6:123264195-123264217 AAATTGAAAGTCTTCTGGAATGG + Intronic
1014742251 6:125159616-125159638 AAATTGAAAACATTCTGGAAAGG - Intronic
1015259656 6:131222045-131222067 AAATTGAAAACCTTCTGGAAAGG + Intronic
1015533353 6:134242759-134242781 AAATTTAAAAAATTCTAGGATGG - Intronic
1015746377 6:136514116-136514138 AAATTGAAAACCTTCTGGAAAGG - Intronic
1015993801 6:138977453-138977475 TCATTGAAGCTATTCTTGGAAGG - Intronic
1016148399 6:140704920-140704942 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1016222896 6:141697502-141697524 AAATTGAAAACTTTCTGGAAAGG + Intergenic
1016794196 6:148100404-148100426 ACATTGAAAACCTTCTGGAAAGG + Intergenic
1016919997 6:149283283-149283305 ACATTGAAAATATGGGAGGATGG + Intronic
1017183928 6:151581631-151581653 AAATTGAAAACCTTCTGGAAAGG - Intronic
1018224297 6:161613079-161613101 ACACTGAAAACCTTCTGGAAAGG + Intronic
1018361501 6:163075087-163075109 ACATTGAAAATATCATGATAGGG + Intronic
1018691633 6:166349725-166349747 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1019016050 6:168880231-168880253 ATATGGAACCTATTCTGGGATGG - Intergenic
1020423937 7:8042317-8042339 AAATTGAAAACCTTCTGGAAAGG + Intronic
1020523399 7:9224433-9224455 AAATTGAAAATATTTTGTGAAGG + Intergenic
1020548850 7:9572319-9572341 ACATTGAAAATTTTTTGGAAAGG - Intergenic
1020644241 7:10794752-10794774 TCATTGAGACTATTCTGGAATGG + Intergenic
1020704411 7:11526093-11526115 AAATTGAAAATATTCTGGTAGGG - Intronic
1021037204 7:15814797-15814819 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1021071430 7:16246475-16246497 AAATTGAAAACCTTCTGGAAAGG - Intronic
1021378648 7:19939792-19939814 ACATTGAAAATAGACAGGAAGGG - Intergenic
1021633314 7:22667228-22667250 AAAGAGAAAACATTCTGGGAAGG - Intergenic
1022006485 7:26270663-26270685 ACATTGAAAACCTTCTGGAAAGG - Intergenic
1022424860 7:30258849-30258871 AAATTGAAAATCTTCTAGAAAGG + Intergenic
1022566751 7:31411373-31411395 AAATTGAAGACCTTCTGGGAAGG + Intergenic
1022958942 7:35407077-35407099 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1022997816 7:35775945-35775967 ACTGTTAAAATATTCAGGGAAGG - Intergenic
1023099637 7:36703306-36703328 AAATTGAAAACCTTCTGGAAAGG - Intronic
1023488531 7:40712876-40712898 TCACTGAAAAAGTTCTGGGATGG - Intronic
1023724546 7:43128724-43128746 CCATTGAAAACCTTCTGGAAAGG + Intronic
1023929010 7:44693522-44693544 ACAAAGAAAATAATCTGGAAAGG + Intronic
1024561491 7:50648855-50648877 ACAAAGTAAATATTCTGGGTGGG + Intronic
1024786059 7:52909391-52909413 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1024837961 7:53546417-53546439 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1025017693 7:55452485-55452507 AAATTGAAAACCTTCTGGAAAGG - Intronic
1026287940 7:68980016-68980038 ACCTTGAATATATTCTGTAAGGG + Intergenic
1027276059 7:76557522-76557544 ACATTGAAAGCCTTCTGGAAAGG + Intergenic
1027490389 7:78816976-78816998 AAATTGAAAATATTCTGGAAAGG + Intronic
1027526502 7:79276156-79276178 AAATTGAAAACTTTCTGGAAAGG + Intronic
1027573577 7:79903113-79903135 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1027659482 7:80971783-80971805 ACATTGCCAATATCCTGGGGAGG - Intergenic
1028352832 7:89870252-89870274 AAATTGAAAATTTTCTGGAAAGG - Intergenic
1028578081 7:92375758-92375780 AAATGGAAAATCTTCTGGAAAGG - Intronic
1029957410 7:104654004-104654026 ACATTAAAAATATCTTAGGATGG + Intronic
1029993630 7:104984949-104984971 ACATGTAAAACATTCTGAGATGG + Intergenic
1030038044 7:105424804-105424826 AAATTGAAAACCTTCTGGGAGGG - Intergenic
1030047394 7:105509850-105509872 ACATTGACAAGAAACTGGGAAGG + Intronic
1031147228 7:118010167-118010189 AAATAGAAAATATTCTGGAATGG - Intergenic
1031434660 7:121717998-121718020 AAATTGAAAACTTTCTGGAAAGG - Intergenic
1031475620 7:122217507-122217529 ACACTTAGAATATTCTGGGTTGG - Intergenic
1031602132 7:123722863-123722885 AGAATAAAAATGTTCTGGGAAGG + Intronic
1031747021 7:125512332-125512354 AAATTGAAAACCTTCTGGGTAGG - Intergenic
1031747090 7:125513304-125513326 AAATTGAAAACCTTCTGGGTAGG + Intergenic
1031827437 7:126583470-126583492 ACATTGAAAACTTCCTGGAAAGG + Intronic
1031895214 7:127340327-127340349 ACTTTGAAAATATTTGGGGCTGG - Intergenic
1031954847 7:127932135-127932157 AAATTGAAAACTTTCTGGAATGG + Intronic
1032374822 7:131402523-131402545 AAATTGAAAACCTTCTGGAAAGG - Intronic
1032814522 7:135458960-135458982 AAATTGAAAACCTTCTGGAAAGG - Intronic
1032888348 7:136166265-136166287 ACATTGAAAATGTTCAGTTAAGG - Intergenic
1033394219 7:140958181-140958203 AAATTGAAAACATTTTGTGAAGG + Intergenic
1034021981 7:147654721-147654743 ACATTGAAAACCTCCTGGTAAGG - Intronic
1034210897 7:149361597-149361619 AAATTGAAAACTTTCTGGAAAGG + Intergenic
1034259106 7:149743161-149743183 ACCTTGAAAATATTGTGGCCAGG + Intergenic
1034361885 7:150506668-150506690 AAATTGAAAACTTTCTGGGAAGG + Intergenic
1034873442 7:154704018-154704040 ACATTGAAAGCCTTCTGGAAAGG + Intronic
1035066854 7:156111689-156111711 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1035092285 7:156323538-156323560 AAATTGAAAATGTTCTGGAAAGG - Intergenic
1035837500 8:2770381-2770403 ACATAGACCATCTTCTGGGATGG + Intergenic
1036801084 8:11793221-11793243 ACATTTAAAATATTCATAGATGG - Intergenic
1036949775 8:13130092-13130114 AATTGGAAAATATTCAGGGAAGG - Intronic
1037135672 8:15456726-15456748 ACATTAAAAATAATTTTGGATGG + Intronic
1037297966 8:17421204-17421226 ACAAGGAAAATATTTAGGGATGG + Intergenic
1037622382 8:20576046-20576068 AAATTAAAAATATCCTGGCAGGG - Intergenic
1038178910 8:25207907-25207929 ACATTAAAAACCTTCTGGAAAGG + Intronic
1038278800 8:26143949-26143971 CCTATGAAAATATTCTGGGCTGG + Intergenic
1038424699 8:27457540-27457562 TCACTGAAAATATTTTGGAAAGG + Intronic
1038781351 8:30570889-30570911 ACATTTTAAGTATGCTGGGATGG + Intronic
1038933046 8:32216911-32216933 TCATTAAAAATATTCGGGGAGGG + Intronic
1039076675 8:33696309-33696331 ATATTGAAAACCTTCTGGAAAGG - Intergenic
1039273205 8:35905889-35905911 ACATTTATCAAATTCTGGGATGG - Intergenic
1040068260 8:43166833-43166855 CCATTGAAAACCTTCTGGAAAGG + Intronic
1040516616 8:48140919-48140941 ACATAGAAAAAGTTCTGGAAGGG + Intergenic
1040689198 8:49913658-49913680 ACATTGTAGGTTTTCTGGGAAGG - Intronic
1040766330 8:50915822-50915844 TCATTGAAAAGCTTCTGGCATGG + Intergenic
1041099998 8:54386708-54386730 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1041621972 8:59981771-59981793 AAATTGAAAACATTCTGGAAAGG - Intergenic
1042576110 8:70220575-70220597 AAAGTAACAATATTCTGGGAGGG + Intronic
1042943719 8:74133515-74133537 AAATTGAAAAACTTCTGGAAAGG + Intergenic
1043291937 8:78612892-78612914 TCATTCAAAATATTCTTGTATGG - Intergenic
1043327260 8:79068155-79068177 ACATTAAAAATATTTTGGCTGGG + Intergenic
1043420970 8:80098346-80098368 ACATTAAAAACCTTCTGGAAAGG + Intronic
1043536987 8:81216106-81216128 CCATTTATAATATGCTGGGACGG + Intergenic
1043559712 8:81478098-81478120 ATATTAAAAATATTTTGAGAGGG + Intergenic
1043687839 8:83110271-83110293 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1043714798 8:83468006-83468028 ACATTGCAAGTCCTCTGGGAAGG + Intergenic
1043990779 8:86751400-86751422 AAATTGGAAATCTTCTGGAAAGG - Intergenic
1045014119 8:97984150-97984172 ACAGTGAGAATATTGTAGGATGG - Intronic
1045541742 8:103092968-103092990 AAATTGAAAACTTTCTGGAAAGG - Intergenic
1045907714 8:107368032-107368054 AAATTGAAAACCTTCTGGAAAGG - Intronic
1046126602 8:109917620-109917642 ACATTCAAAATTGTCTGGAAAGG + Intergenic
1046275951 8:111960016-111960038 ACAGTGTAAGAATTCTGGGAAGG - Intergenic
1046494789 8:114999166-114999188 ACAGTAAAAATATTCTGGGAAGG + Intergenic
1047140373 8:122132132-122132154 TCTTTGAAAATATTCTGGGTAGG + Intergenic
1047321063 8:123783664-123783686 ACCCTGAAAATATCCTGAGAAGG - Intronic
1047888885 8:129284607-129284629 AAATTGAAAATCTTCTGGAAAGG + Intergenic
1048020520 8:130534654-130534676 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1048243638 8:132769219-132769241 ACATTCAAAATATGCTTTGAAGG - Intergenic
1048823912 8:138404973-138404995 AAATTGAAAACTTTCTGGAAAGG - Intronic
1049145355 8:140996965-140996987 ACATAGAAAACATGCTGGAAAGG + Intronic
1049227549 8:141464321-141464343 ACATTGAAAACCTTCTGGAAAGG + Intergenic
1049739358 8:144229294-144229316 AAACTGAAAACCTTCTGGGAAGG - Intronic
1049901336 9:169101-169123 AAATTGAAAACCTTCTGGAAAGG + Intronic
1050352900 9:4757339-4757361 ACATTGAAAAGATGGTGGGAAGG - Intergenic
1050649931 9:7765154-7765176 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1050902135 9:10962383-10962405 TCATTGAAAACTTTCTGGAAAGG + Intergenic
1051033257 9:12709343-12709365 CCATTGAAAAGATTCTGAAAGGG - Exonic
1051298334 9:15620265-15620287 AAATTGAAAACTTTCTGGAAAGG + Intronic
1051311371 9:15777442-15777464 ATAGTGAAAATAATGTGGGAAGG + Intronic
1051462053 9:17330518-17330540 AAATTGTAAATATTCAGAGAAGG - Intronic
1051507637 9:17843632-17843654 ATATAGAAAATACTCTGAGAGGG - Intergenic
1051601607 9:18880287-18880309 AAATAGAAAATGTTCTGGAAAGG - Intronic
1051639556 9:19212161-19212183 TCAATGAAAATATTCTGGGCCGG + Intergenic
1051721659 9:20043459-20043481 ATATTGAAAAGCTTCTGGAAAGG + Intergenic
1051777711 9:20654305-20654327 AAATTGAAAACCTTCTGGAAGGG - Intergenic
1051797689 9:20892359-20892381 AAATTGAAAACCTTCTGGAAAGG + Intronic
1052499095 9:29266173-29266195 AAATTGAAAACCTTCTGGGTAGG + Intergenic
1052760509 9:32586116-32586138 AAATTGAAAACCTTCTGGGAAGG - Intergenic
1053227798 9:36376275-36376297 ACCTTTAAAAAATGCTGGGATGG + Intronic
1053744376 9:41179415-41179437 AAATTGAAAACCTTCTGGAAAGG + Intronic
1054683969 9:68251835-68251857 AAATTGAAAACCTTCTGGAAAGG - Intronic
1054841920 9:69751517-69751539 GCATTAAAAATTTTCTTGGAAGG + Intronic
1054844170 9:69775087-69775109 ATAATGAAAATATTCTGGCTGGG - Intergenic
1054993639 9:71359401-71359423 ACATTTTAAATATTCTGTGAAGG - Intronic
1055039340 9:71851972-71851994 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1055542585 9:77327945-77327967 AAATTGAAAACCTTCTGGAAAGG - Intronic
1055557081 9:77485538-77485560 AAATTGAAAGCCTTCTGGGAAGG - Intronic
1055658844 9:78480785-78480807 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1055760560 9:79602841-79602863 AAATTGAAAACCTTCTGGAAAGG + Intronic
1055783434 9:79844673-79844695 ACATTGAAAACTTGCTGGAAAGG - Intergenic
1055906611 9:81302033-81302055 AAATTGAAAACTTTCTGGAAAGG + Intergenic
1055924837 9:81499380-81499402 ACATTGTAAATAGCCTTGGATGG - Intergenic
1056140275 9:83671328-83671350 AAATTGAAAACCTTCTGGAAAGG - Intronic
1056175098 9:84026802-84026824 AAATTGAAAATTTTCTGGAAAGG + Intergenic
1056959276 9:91107784-91107806 AAATTGAAAACCTTCTGGAAGGG - Intergenic
1056979387 9:91294632-91294654 AAATTGAAAACCTTCTGGAAAGG + Intronic
1057287234 9:93767440-93767462 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1057823564 9:98353484-98353506 ACATTGAAAACCTTCTGGAAAGG - Intronic
1057984580 9:99698989-99699011 AAATTGAAAACTTTCTGGAAAGG + Intergenic
1058059485 9:100479648-100479670 ACATTGAAAACATTATGCTAAGG - Intronic
1058927880 9:109686263-109686285 AAATTGAAAACCTTCTGGAAAGG - Intronic
1059092900 9:111380044-111380066 AAATTGAAAACCTTCTGGAAAGG - Intronic
1059158242 9:112009247-112009269 AAATTGAAAAACTTCTGGTAAGG + Intergenic
1060580849 9:124745374-124745396 ACATTAAAAAAATCCTGGCAGGG + Intronic
1060863229 9:126973554-126973576 ACATTGAAGAACTTCTGGGGTGG + Intronic
1185825671 X:3246892-3246914 GCATTGAACAAAATCTGGGATGG - Intergenic
1186854598 X:13613701-13613723 ACATTTCATATATTCTGGGCTGG - Intronic
1186953372 X:14653298-14653320 AAATTGAAAACCTTCTGGAAAGG + Intronic
1187074922 X:15925015-15925037 CAATTGAAAATCTTCTGGAAAGG + Intergenic
1187724325 X:22186853-22186875 ACTTTTAAAATATTCAGGTAAGG - Intronic
1187814856 X:23220246-23220268 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1188139369 X:26529533-26529555 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1188145741 X:26610665-26610687 AAATTTAAAATATCGTGGGAAGG + Intergenic
1188231171 X:27665134-27665156 AAATTGAAATCATTCTGGAAAGG + Intronic
1188238491 X:27756852-27756874 AAATTGAAGTTATTCTGGAAAGG + Intergenic
1188353451 X:29160755-29160777 ACATTGAAAAAAGTGTGGGCCGG + Intronic
1188425277 X:30039266-30039288 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1188429285 X:30087619-30087641 ACAATAAGAAAATTCTGGGAAGG - Intergenic
1188591502 X:31842022-31842044 AAACTGAAAATCTTCTGGAAAGG + Intronic
1188603801 X:32003024-32003046 AAATTGAAAATATGCTCTGAAGG - Intronic
1189464902 X:41271141-41271163 GCAGTGAAAATACTCTGGGCTGG + Intergenic
1190460632 X:50670016-50670038 AAATTGAAAATCTTATGGAAGGG - Intronic
1190482125 X:50888012-50888034 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1190715503 X:53099615-53099637 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1191111319 X:56804914-56804936 ACATTTGCAATATTCTGAGATGG - Intergenic
1191773898 X:64791782-64791804 ACGTTGAAAACCTTCTGGAAAGG + Intergenic
1192078799 X:68027636-68027658 ATATTGAAAACTTTCTGGAAAGG + Intergenic
1192668511 X:73113918-73113940 ACATTGAAAATCTTCTGGAAAGG - Intergenic
1193429007 X:81377213-81377235 TCACTGAAGATATTCAGGGAGGG + Intergenic
1193586058 X:83322917-83322939 ACATAGAAAGTGTTCTGGGAAGG + Intergenic
1194343659 X:92734102-92734124 CCATTAAAAAAATTCTGGGCTGG - Intergenic
1194581069 X:95671680-95671702 AAATTGAAAACCTTCTGGAAAGG - Intergenic
1194591353 X:95803868-95803890 AAATTGAAAATAATTTGGAAAGG + Intergenic
1195253317 X:103069440-103069462 AAATTGACAATCTTCTGGAAGGG + Intergenic
1195690767 X:107622866-107622888 AAATTGCAAATCTTCTGGAAAGG - Intergenic
1196092625 X:111762329-111762351 ACATTCAAAAAATGTTGGGAAGG - Intergenic
1196355126 X:114782419-114782441 AAATTAATAATATTCTGGGTGGG + Intronic
1196360193 X:114845082-114845104 ACATGGAACATTCTCTGGGATGG + Intronic
1196504850 X:116429638-116429660 ACAGTGAAAAGCTTCAGGGAAGG + Intergenic
1196619002 X:117800519-117800541 AAATTGAAAAAATTCTGGAAAGG - Intergenic
1196632615 X:117960722-117960744 AAACTGAAAATGTTTTGGGAAGG + Intronic
1196721552 X:118859248-118859270 AAATTGAAAACCTTCTGGAAAGG + Intergenic
1196971527 X:121114656-121114678 CAATTGAAAACTTTCTGGGAAGG - Intergenic
1197962915 X:132024409-132024431 AAAATGAAAATATAATGGGAGGG - Intergenic
1199023741 X:142912846-142912868 AAATTGAAAACCTTCTGAGAAGG + Intergenic
1199789438 X:151138368-151138390 AAATTGAAAATCTTCTGGAAAGG - Intergenic
1199916757 X:152350726-152350748 CCATTGAAAACCTTCTGGAAAGG - Intronic
1201239194 Y:11941922-11941944 AAGGTGAAAAAATTCTGGGATGG + Intergenic
1201574642 Y:15449459-15449481 AAATGGAAAACATTCTGGAAAGG + Intergenic
1201744768 Y:17359827-17359849 GCACAGAAAATATTCAGGGACGG - Intergenic
1201768496 Y:17595347-17595369 TCTTGGAAAATATTCTGGAATGG - Intergenic
1201833058 Y:18310638-18310660 TCTTGGAAAATATTCTGGAATGG + Intergenic