ID: 1073415868

View in Genome Browser
Species Human (GRCh38)
Location 10:103381417-103381439
Sequence CCACCCTGCTTGGCTAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073415862_1073415868 8 Left 1073415862 10:103381386-103381408 CCTCACAAGTAGATGGGATTACA 0: 4
1: 819
2: 55774
3: 154786
4: 259735
Right 1073415868 10:103381417-103381439 CCACCCTGCTTGGCTAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073415868 Original CRISPR CCACCCTGCTTGGCTAATTT TGG Intronic
No off target data available for this crispr